HO-1 axis

Journal Pre-proof

Hyperoside suppresses hypoxia-induced A549 survival and proliferation through ferrous accumulation via AMPK/HO-1 axis Dan Chen , Ya-Xian Wu , Yu-bao Qiu , Bin-bin Wan , Gang Liu , Jun-liang Chen , Mu-dan Lu , Qing-feng Pang PII: DOI: Reference:

S0944-7113(19)30454-4 https://doi.org/10.1016/j.phymed.2019.153138 PHYMED 153138

To appear in:

Phytomedicine

Received date: Revised date: Accepted date:

22 July 2019 1 November 2019 17 November 2019

Please cite this article as: Dan Chen , Ya-Xian Wu , Yu-bao Qiu , Bin-bin Wan , Gang Liu , Jun-liang Chen , Mu-dan Lu , Qing-feng Pang , Hyperoside suppresses hypoxia-induced A549 survival and proliferation through ferrous accumulation via AMPK/HO-1 axis, Phytomedicine (2019), doi: https://doi.org/10.1016/j.phymed.2019.153138

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier GmbH.

Hyperoside

suppresses

hypoxia-induced

A549

survival

and

proliferation through ferrous accumulation via AMPK/HO-1 axis Dan Chen a,b*. Ya-Xian Wu b,*. Yu-bao Qiub. Bin-bin Wanb. Gang Liub. Jun-liang Chenb. Mu-dan Lu c, #. Qing-feng Pangb*, # a School of Food Science and Technology, Jiangnan University, Wuxi 214122, Jiangsu Province, People's Republic of China b Department of physiopathology, Wuxi School of Medicine, Jiangnan University, Wuxi 214002, Jiangsu Province, People's Republic of China c Central Laboratory, The Affiliated Wuxi Matemity and Child Health Care Hospital of Nanjing Medical University, Wuxi 214122, Jiangsu Province, People's Republic of China *

These authors contributed equally to this work

#

Corresponding author: Mu-dan Lu and Qing-feng Pang

Mu-dan Lu Address: 48 Huaishu Lane, Liangxi District, Wuxi, Jiangsu Province, china Tel:+8618915283123, Fax: +86-510-82725094 E-mail: [email protected] Qing-feng Pang Address: 1800 Lihu Avenue, Binhu District, Wuxi, Jiangsu Province, China Tel: +8615052430172; Fax: +86-510-85329042; 1

E-mail: [email protected] Abstract Background: Hypoxia is commonly existed in tumors and lead to cancer cell chemo/radio-resistance. It is well-recognized that tumor hypoxia is a major challenge for the treatment of various solid tumors. Hyperoside (quercetin-3-O-galactoside，Hy) possesses antioxidant effects and has been reported to protect against hypoxia/reoxygenation induced injury in cardiomyocytes. Therefore, Hy may be attractive compound applicable to hypoxia-related diseases. Purpose: This study was designed to determine the role of Hy in hypoxia-induced proliferation of non-small cell lung cancer cells and the underlying mechanism. Study Design and Methods: A549, a human non-small cell lung cancer (NSCLC) cell line, was used in the present study. 1% O2 was used to mimic the in vivo hypoxic condition of NSCLC. The potential mechanisms of Hy on hypoxia-induced A549 survival and proliferation, as well as the involvement of AMPK/HO-1 pathway were studied via CCK-8 assay, EdU staining, flow cytometry, qRT-PCR and western blot. Results:

We

showed

that

pretreatment

with

Hy

suppressed

hypoxia-induced A549 survival and proliferation in dose-dependent manner. In terms of mechanism, hypoxia-treated A549 showed the lower AMPK phosphorylation and the reduced HO-1 expression, which were 2

reversed by Hy pretreatment. Both AMPK inhibitor (Compound C) and HO-1 activity inhibitor (Zinc protoporphyrin IX) abolished Hy-evoked A549 cell death under hypoxia stimuli. Of note, Ferrous iron contributed to Hy-induced A549 cell death under hypoxia, while Hy had no effect on lipid peroxidation under hypoxia. Conclusion: Taken together, our results highlighted the beneficial role of Hy against hypoxia-induced A549 survival and proliferation through ferrous accumulation via AMPK/HO-1 axis. Keywords: Hy; Heme oxygenase-1; Hypoxia; A549; survival List of abbreviations AMPK

Adenosine Monophosphate-Activated Protein Kinase

FTH

Ferritin Heavy Chain

GAPDH

Glycerakdehyde Phosphate Dehydrogenase

HO-1

Heme Oxygenase-1

NSCLC

Non-Small Cell Lung Cancer

ZnPP

Zinc protoporphyrin IX

Introduction Lung cancer is the most frequently diagnosed malignant tumor and the leading cause of cancer mortality worldwide. Non-small cell lung cancer (NSCLC) represents the main type and accounting for 80-85% of all lung cancer cases (William et al., 2012). Although hypoxia is toxic in normal cells, cancer cells can survive and even proliferate in a hypoxic 3

environment. Futhermore, hypoxia promotes genomic instability, enhanced aggressiveness, and metastases and is an important factor in treatment resistance (Harris, 2002). Recently, Salem et al. reported that hypoxia in NSCLC is an important factor in treatment resistance and poor survival (Salem et al., 2018). Therefore, it is crucial to find new therapeutic methods against hypoxia-induced cellular survival and proliferation in NSCLC. Natural products from plants have recently attracted more attention in drug research because they have frequently been served as major sources of chemical diversity for novel biomedical agents and pharmaceutical discovery(Zhang et al., 2018). Hyperoside (quercetin-3-O-galactoside, Hy), a major pharmacologically active component from the genera Crataegus and Hypericum (Wang and Yue, 2016; Wen et al., 2017), has many biological effects including anti-inflammatory and anti-oxidant. It is noteworthy that Hy significantly inhibited human cervical cancer cell proliferation in a dose and time-dependent manner. Moreover, Hy protected

against

hypoxia/reoxygenation-induced

injury

in

cardiomyocytes (Xiao et al., 2017). Hy also protected cortical neurons from oxygen-glucose deprivation-reperfusion induced injury (Liu et al., 2012).

However,

it

is

unknown

whether

Hy

would

relieve

hypoxia-induced A549 survival. In this study, we aimed to determine the effect of Hy on hypoxia-induced A549 survival and proliferation and to 4

identify the molecular mechanisms. Materials and Methods Regents and antibodies Hy (MW: 464.38, HPLC ≥98%) was purchased from Aladdin (Shanghai, China). Dorsomorphin (Compound C) was purchased from MCE (New Jersey, USA). Zinc protoporphyrin IX (ZnPP), 1,10-Phenanthroline monohydrade and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against HO-1, p-AMPK, T-AMPK, FTH and GAPDH were all purchased from Cell Signaling Technology (Beverly, MA, USA). Cell culture and treatment The lung adenocarcinoma cell line, A549, was obtained from Shanghai Institute of Cell Biology (shanghai, China). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 °C in humidified air containing 5% CO2. To induce hypoxia condition in vitro, 1% O2 was selected according to the previous study(Wohlkoenig et al., 2017). A549 cells were pretreated with or without Compound C (10 μM)(Liu et al., 2019a; Liu et al., 2019b), ZnPP (10 μM)(Song et al., 2016) and phenanthroline (0.4 μM)(Lee et al., 2011) 1 h before Hy stimuli for 6 h, then exposed to 1% O2 for 48 h. Cell morphology observation 5

A549 cells were visualized and photographed using a phase-contrast microscope equipped with a digital camera (DP11, Olympus, Tokyo, Japan). CCK-8 assay and IC50 determination Cell viability was determined using the Cell Counting Kit-8 (CCK-8, biosharp, Hefei, China) according to the manufacturer’s instructions. As we have previously reported (Chen et al., 2019), 10 μl of CCK-8 solution was added into each well, and incubated for 2 h at 37℃. The absorbance was measured at 450 nm with a microplate reader (Synergy H4, BioTek, Vermont, USA). The half-inhibitory concentration (IC50) was calculated with using GarphPad Prism 7.0 software. 5-Ethynyl-2′-deoxyuridine (EdU) incorporation assay EdU incorporation assay was used to determine A549 proliferation with In Vitro Imaging Kit (Guangzhou RiboBio, Guangzhou, China) as previously reported(Fu et al., 2016). A549 cells were observed under fluorescent microscopy (Ti-U, Nikon, Tokyo, Japan). The number of EdU positive cells were counted and normalized by the total number of Hoechst 33342 stained cells. Annexin V-FITC/PI assay Annexin V-FITC/PI Apoptosis Detection Kit (CoWin-biotech, Beijing, China) was used to detect cellular apoptosis according to the manufacturer’s instructions. Briefly, cells were harvested and washed 6

with cold PBS for twice, resuspended in binding buffer; then added 5 μl Annexin V-FITC regent and 10 μl PI regents and incubated for 15min at room temperature (RT) in the dark, followed by detecting cell death using Flow cytometry (BD Biosciences, C6 Plus, USA). Percentages of dead cells were detected by Annexin V/PI staining and calculated as previously reported (Rodriguez and Potter, 2013). Measurement of lipid peroxidation using flow cytometry Lipid peroxidation levels were determined using C11-BODIPY (D3861, ThermoFisher Scientific), a lipid peroxidation probe, according to the manufacturer’s instructions as previously reported (Korytowski, 2015). A549 cells were seeded and treated with Hy, followed by hypoxia exposure for 48 h, then the culture medium was replaced with 2 μM C11-BODIPY for 30 min at 37℃. Later, the cells were harvested by trypsin and washed three times with ice-cold PBS. The amount of lipid peroxidation within cells was examined by flow cytometry analysis (BD Biosciences, C6 Plus, USA). Glutathione level assessment. A549 cells were seeded and treated with Hy, followed by hypoxia exposure for 48 h. The intracellular levels of Glutathione (GSH) were examined following the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Iron concentration assay 7

The iron concentration was assessed using an Iron Assay Kit (ab83366, Abcam, United Kingdom) following the manufacturer’s protocols as previously reported (Yoshida, 2019). Measurement of intracellular ROS A549 cells were seeded and treated with Hy, followed by hypoxia exposure for 48 h, then the culture medium was replaced with DCFH-DA (10 μM) for 30 min at 37℃ according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) as previously reported (Sun, 2019). Formation of the oxidized fluorescent derivative was monitored at excitation and emission wavelengths of 485 and 530 nm respectively, using a fluorescence spectrophotometer (Synergy H4, BioTek, Vermont, USA). Western blot analysis Samples were homogenized in lysis buffer. A protein assay kit (BCA; Pierce, Thermo Scientific, MA, USA) was used for measurement of total protein in the supernatant. Total protein was separated in SDS-PAGE, transferred to PVDF membranes in Tris-glycine methanol buffer, then incubated with the specific antibody (p-AMPK, T-AMPK, HO-1, FTH or GAPDH). The bands were visualized using enhanced chemiluminescence (Biorad, nr. 170-8265). GADPH was used as a loading control to normalize the data. qRT-PCR 8

Total RNA was isolated with Trizol reagent (Life Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instruction. Reverse transcriptase reactions were performed using the PrimeScript RT reagent Kits. RT-PCR was performed using Quantitative PCR with SYBR Premix Ex Taq TM (Takara, Otsu, Shiga, Japan) and LightCycler® 480 detection PCR system (Roche, Foster City, CA, USA). The expressions of mRNA were calculated using the comparative cycle threshold (Ct) method where the relative quantization of target transcript levels was determined by subtracting Ct values of target genes from Ct values of GAPDH. The sequences of primers for humans were listed in the Table 1. Statistical analysis Two-way ANOVA followed by post hoc Bonferroni test was used for multiple comparisons. All data were expressed as mean ± SE. A value of P˂0.05 was considered statistically significant. Results Prolonged hypoxia promoted proliferation and survival of A549 cells Uncontrollable survival is a pivotal feature in the process of tumor development. In order to identify the effect of hypoxia on A549 cells survival, cells were exposed to 21% or 1% O2 in different time. Results suggested that A549 cell proliferation was extremely higher after hypoxia for 48 and 72 h than normoxic cells (Fig 1A). A549 cells in hypoxic condition lost their polarity with the smooth cell contours destroyed (Fig 9

1B). Compared with that in 21% O2, the percentage of A549 cell death significantly reduced at 48 h and 72 h in hypoxia (1% O2) (Fig 1C and 1D). Hy decreased A549 cell viability in hypoxia condition Chemical structure of Hy was shown in Fig 2A. Following treatment with different doses of Hy for 24 h, cell viability was determined by CCK-8 assay. As shown in Fig 2B, Hy inhibited A549 cells viability in a dose-dependent manner. The IC50 of Hy was 256.8 μM using GarphPad Prism 7.0 software. Moreover, we found that Hy inhibited A549 cells viability in a time-dependent manner. A549 cell proliferation was markedly decreased after Hy exposure (Fig 2C). A549 cells treated with Hy (100 μM) showed a significant decrease in detached cells in culture medium and displayed a round shape (Fig 2D). Hy inhibited hypoxia-induced proliferation of A549 cells A549 cells proliferation was evaluated with CCK-8 test and EdU assay. CCK-8 assay showed that hypoxia stimulated A549 proliferation, and it was inhibited by Hy treatment (Figure 3A). EdU incorporation assay revealed that Hy decreased the number of EdU-positive cells caused by hypoxia stimuli in A549 cells (Figure 3B and 3C). Hy suppressed hypoxia-induced survival of A549 cells The cell death was measured by Annexin V/PI staining. A549 cells were pretreated with Hy for 6 h followed by normal (21% O2) or hypoxia (1% 10

O2) for 48 h. The representative images were shown in Fig 4A, Hy decreased hypoxia-induced survival in a dose-dependent manner. The quantified results of dead cells were shown in Fig 4B. Hy protected against hypoxia-induced proliferation and survival via activating AMPK AMP-activated protein kinase (AMPK) is an important energetic sensor that can be activated in response to a shortage of energy. It has also been considered as a target to treat various types of cancers, including NSCLC(Li et al., 2015). It has been reported that AMPK is inactivated in NSCLC cells during hypoxia (Shin et al., 2014). Here, we found the decreased p-AMPK (Thr-172) level under hypoxia stimuli, and reaching the lowest level at 72 hours (Fig 5A and 5B). In addition, we found that Hy improved hypoxia-induced decrease of AMPK phosphorylation in a concentration-dependent manner in A549 cells (Fig 5C and 5D). To confirm whether AMPK activation contributes to the protective role of Hy in A549 cells under hypoxia, we used AMPK inhibitor dorsomorphin (Compound C) to down-regulate the activity of AMPK. As expected, Compound C inhibited Hy-induced AMPK phosphorylation (Fig. 5E). Moreover, Compound C attenuated the cell damage caused by Hy under hypoxia stimuli in A549 cells (Fig. 5F and 5G). These results demonstrate that Hy protects against hypoxia-induced proliferation and survival via activating AMPK. 11

Hy induced heme oxygenase-1 expression dependent on AMPK activation AMPK plays a role in heme oxygenase-1(HO-1) induction(Campbell et al., 2019; Lee et al., 2018), and HO-1 exerts an important role in cancer cells(Chiang

et

al.,

2018).

We

proposed

a

possibility

that

AMPK-mediated HO-1 participated in the beneficial role of Hy against hypoxia-induced proliferation. As shown in Fig 6A and 6B, under hypoxia stimuli in A549 cells, the protein expression of HO-1 significantly decreased at 36 h, 48 h and 72 h. After treating with Hy, both the mRNA and protein levels of HO-1 increased in a dose-dependent manner (Fig 6C, 6D and 6E). The specific competitive HO-1 inhibitor, Zinc protoporphyrin IX (ZnPP), attenuated the cell survival and proliferation caused by Hy (Fig 6F and 6G). Then we focused on whether AMPK-dependent induction of HO-1 contributes to the beneficial role of Hy in A549 cells under hypoxia condition. We further found that the upregulated expression of HO-1 was abolished by AMPK inhibitor Compound C (Fig 6H). These results imply that Hy triggers A549 cell death via up-regulation HO-1 expression dependent on AMPK activation. Ferrous iron contributed to Hy-induced A549 cell death under hypoxia Considering that iron ions is one of the major products of heme degradation catalyzed by HO-1 and iron ions plays a key role in cell 12

death(Chen et al., 2017; Quan et al., 2016). Therefore, an assumption was reached that Hy-induced HO-1, through catalyzing heme degradation, provided iron ion to execute Fenton reaction, and thereby enhanced cell death under hypoxia. In order to verify this assumption, intracellular Fe2+ level was detected. As shown in Fig 7A, Hy significantly increased Fe2+ level under hypoxia condition. Considering that Fe2+ can trigger Fenton reaction and generate large amounts of toxic hydroxyl radicals. Fe2+ chelator (o-phenanthroline) was then used. As shown in Fig 7B, Hy-enhanced toxicity to A549 cells under hypoxia was diminished significantly by o-phenanthroline. In addition, we also examined the ROS generation and GSH content, and found that Hy significantly upregulated ROS generation and deteriorated GSH depletion (Fig 7C and 7D). These results indicated the involvement of iron and Fenton reaction. Moreover, the expression of ferritin heavy chain (FTH) was also detected by RT-PCR and western blotting. FTH is the major intracellular iron storage protein, which is known to sequestrate intracellular iron. As shown in Fig 7E and 7F, Hy increased both mRNA and protein levels of FTH in a dose dependent manner. Moreover, pretreated with HO-1 inhibitor ZnPP reduced FTH expression compared with Hy treatment alone (Fig 7G). These results suggest that in addition to heme degradation by HO-1, irons may also contribute to the cellular ferrous accumulation by Hy stimuli, leading to the death of A549 cells under hypoxia. 13

The suppression effect of Hy on hypoxia-induced A549 survival was independent of lipid peroxidation and ferroptosis-associated genes Iron plays a significant role in the progress of ferroptosis. Ferroptosis, identified in 2012, is characterized by ROS generation, lipid peroxidation and iron accumulation. It is a new form of cell death that is mechanistically different from necrosis/necroptosis and apoptosis (Dixon, 2012). Considering that Hy accelerated ferrous accumulation under hypoxia condition. Then we examined the effect of Hy on lipid peroxidation. Unexpectedly, Hy has no effects on lipid peroxidation generation (Fig 8A and 8B). In addition, we tested the mRNA expressions of Gpx4, SLC7A11 (which were known to be involved in the regulation of lipid peroxides), also the mRNA level of TFRC (encodes transferrin receptor). As shown in Fig 8C, no obvious changes of ferroptosis-related genes were found after Hy administration under hypoxia condition. These results imply that suppression effect of Hy on hypoxia-induced A549 survival is independent of lipid peroxidation and ferroptosis-associated genes. Discussion Lung cancer is the most common malignancy and the leading cause of cancer-related death worldwide. Different from other small cell carcinoma, NSCLC is relatively insensitive to chemotherapy and radiotherapy (Group., 2014). Hypoxia is a characteristic driver of solid 14

carcinoma including NSCLC and has been shown to be pivotal in tumor progression and chemo- or radio-resistance(Harrison and Blackwell, 2004). Hy is an active compound isolated and purified from natural plants(Saddiqe et al., 2016; Wang and Yue, 2016; Wen et al., 2017). The major novel findings in the present study are that Hy dose-dependently suppresses hypoxia-induced A549 survival and proliferation, ameliorates hypoxia-triggered decrease of AMPK phosphorylation and HO-1 expression. Blockade of AMPK/HO-1 pathway attenuates Hy-evoked A549 cell death under hypoxia. Moreover, we further demonstrate that HO-1 catalytic product (ferrous iron) contributes to Hy-induced A549 cell death. It has been reported that in primary NSCLC tumors, it shows a median pO2 of 13.5 mmHg (< 2% oxygen concentration)(Graves et al., 2010). Therefore we decided to use 1% oxygen in our study to mimic the in vivo conditions of NSCLC as previously reported(Wohlkoenig et al., 2017). In this study, we found that prolonged hypoxia (1% O2 for 48h) increased cell vitality and caused A549 cell survival. Compared with acute hypoxia, chronic and sustained hypoxia is more similar to the slowly progressive natural history of tumor. However, the regulatory mechanisms involved in hypoxia-induced A549 cell survival remain largely unknown. AMPK is a highly conserved serine/threonine protein kinase consisting of a catalytic subunit (α) and two regulatory subunits (β and γ). 15

Phosphorylation of the conserved threonine residue (Thr-172) plays a key role in AMPK activation (Willows et al., 2017). Once activated, AMPK can promote ATP production and regulate metabolic energy. AMPK negatively regulates aerobic glycolysis (the Warburg effect) in cancer cells and suppresses tumor growth in vivo (Faubert et al., 2013). Moreover, it has been reported that AMPK mediates hypoxia-induced resistance of NSCLC to chemotherapy (Shin et al., 2014). NSCLC patients with high AMPK activity showed better prognosis and significant increase in overall survival (William et al., 2012). Traditional chinese medicine targeting AMPK were thought to be the potential candidates for prevention and treatment of cancer(Jin et al., 2019; Wong et al., 2017). The clinically approved AMPK activator (metformin) has significant cancer-preventing properties(Pernicova and Korbonits, 2014). In our experiment, the decreased phosphorylated AMPK in A549 response to hypoxia were reversed by Hy pretreatment. AMPK inhibitor (Compound C) attenuated the cell damage caused by Hy under hypoxia stimuli. These results hinted that Hy-induced activation of AMPK phosphorylation contributed to its antagonistic effects on hypoxia-induced A549 proliferation and survival. HO-1 is the inducible form of heme oxygenase and is a rate-limiting enzyme catalyzing heme into biliverdin/bilirubin, carbon monoxide (CO) and Fe2+. HO-1 is induced in response to oxidative stimuli and is believed 16

to be antioxidant and anti-inflammatory enzyme in cardiovascular, renal, liver and lung disorders. Nowadays, HO-1 has become an important target for cancer treatment (Calay and Mason, 2014; Chau, 2015; Immenschuh et al., 2010; Lever et al., 2016; Raval and Lee, 2010). HO-1 is

highly

induced

in

various

human

malignancies

including

NSCLC(Degese et al., 2012). HO-1 overexpression has been considered to be involved in cancer cell survival, aggressiveness, resistance to chemotherapy and radiotherapy, as well as poor outcome(Degese et al., 2012; Tsai et al., 2012). Increasing studies have shown that augmented expression of HO-1 in cancer cells can promote cell death(Loboda et al., 2015). For example, overexpression of HO-1 in A549 NSCLC adenocarcinoma cells inhibited their proliferation(Loboda et al., 2016). Consistent with this, in our study, we also found the promoting cells death effects of HO-1 in A549 cells, since HO-1 expression increased, and meanwhile, the A549 cell viability decreased and cell death promoted after Hy administration. Moreover, treatment with ZnPP, a specific inhibitor of HO-1, effectively attenuated Hy-induced cell death. Of notes, pretreatment with Compound C decreased the expression of HO-1, indicating that up-regulation of HO-1 by Hy could be mediated through activation of AMPK phosphorylation in A549 cells. However, the mechanism that how HO-1 functions as cell death inducer in A549 cells under hypoxia condition is not completely understood. 17

Iron possesses various biological functions, such as DNA synthesis, oxygen transportation and detoxification that all contribute to metabolism, cell growth and proliferation(Thevenod, 2018). However, excessive iron, particularly Fe2+, may provoke cell death(Jomova and Valko, 2011; Valko et al., 2016). Our study revealed that ferrous accumulation was involved in Hy-induced A549 cell death under hypoxia. Induction of HO-1 decomposed heme to generate harmful Fe2+ as one of the by-products, which thereby induces deleterious to damage cells. In this paper, pretreated with Fe2+ chelator phenanthroline abolished Hy-induced A549 cell death under hypoxia. In addition, Hy increased both mRNA and protein levels of FTH (encodes ferritin heavy chain), which is known to be induced with the increase of cellular iron level (Andrews and Schmidt, 2007), thereby leading to cell damage. Moreover, pretreatment with ZnPP decreased the high level of FTH induced by Hy, similar result was found for the other study (Puri, 2017). Since Ferritin upregulation, in parallel to iron accumulation, act as the central to the sustenance of iron homeostasis (Ward, 2012). We also tested iron level, and found that Hy also increased intracellular Fe2+ level. Apart from keeping iron out of solution in the cytosol,

ferritin

also

possess

antioxidant

(Balla,

1992)

and

anti-inflammatory properties (Bolisetty, 2015). We also observed that the increased generation of ROS induced by Hy under hypoxia stimuli was abolished by ZnPP pretreatment (Supplementary Fig 1). The decreased 18

level of ROS may partially attribute to the reduced level of Ferritin. Ferroptosis, identified in 2012, is characterized by ROS generation, lipid peroxidation and iron accumulation. It is a new form of cell death that is mechanistically different from necrosis/necroptosis and apoptosis (Dixon, 2012). Unsurprisingly, ferroptosis also plays a role in the development of cancer, and ferroptosis induction has been regarded as a therapeutic strategy in cancer treatments (Lu, 2017). So far, it has been reported that erastin radio-sensitizes A549 NSCLC cells by inducing ferroptosis, which provides the therapeutic possibility of triggering ferroptosis in NSCLC (Lu, 2017). Intriguingly, HO-1 plays a dual role in the regulation of ferroptosis. Overexpression of HO-1 has been shown to exert pro-oxidant effects (Bansal, 2014) and HO-1 accelerated erastin-induced ferroptotic cell death in HT-1080 fibrosacoma cells (Kwon, 2015). While another study

suggested

that

HO-1

negatively

regulated

erastin-

or

sorafenib-induced ferroptosis in HCC cells (Sun, 2016). Our study showed that in anoxia environment, hyperoside upregulated intracellular reactive oxygen species (ROS) levels in a dose-dependent manner in A549 cells. This result is different from previous studies that hyperoside decreased the generation of ROS in renal, prostate and colorectal cancer cells (Li, 2014). For my part, the reasons for these differences are that all of their experiments were carried out in normal conditions, and the anti-oxidant effect of hyperoside may differ under different conditions 19

and in different types of tumors. Based on these results, we also proposed another possibility that hyperoside may be involved in regulating ferroptosis. To test the hypothesis, lipid peroxidation and the expressions of ferroptosis-related genes were detected. Interestingly, hyperoside had no effect on lipid peroxidation under hypoxia. Besides SLC7A11, hyperoside barely increased mRNA expressions of Gpx4 and TFRC under hypoxia condition. So we think the suppression effect of Hy on hypoxia-induced A549 survival was attributed to ferrous accumulation independent of lipid peroxidation and ferroptosis-associated genes. Further investigation is required to understand more about the relationship between hyperoside and ferroptosis in A549 cancer cells under normal and anoxic conditions. Taken together, this study at the first time shows that Hy protects against hypoxia-induced

A549

cells

proliferation

and

survival

through

AMPK/HO-1 pathway. Intracellular iron accumulation contributes to Hy-evoked A549 cell death. This discovery implies that Hy may offer as a potential useful and beneficial natural agent against lung cancer.

Conflict of interest The authors have no conflicts of interest to report.

Acknowledgement 20

This study was supported by National Natural Science Foundation of China (81871518; 81901522; 81702799). Wuxi health and family planning commission (Z201810); Public Health Research center at Jiangnan University (JUPH201805). Fundamental Research Funds for the Central Universities (JUSRP11955).

References Andrews, N.C., Schmidt, P.J., 2007. Iron homeostasis. Annual review of physiology 69, 69-85. Balla, G. Jacob, H. S. Balla, J. Rosenberg, M. Nath, K. Apple, F. Eaton, J. Vercellotti, G. M. 1997. Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem. 267 (25), 18148-53. Bansal, S. Biswas, G. Avadhani, N. G. 2014. Mitochondria-targeted heme oxygenase-1 induces oxidative stress and mitochondrial dysfunction in macrophages, kidney fibroblasts and in chronic alcohol hepatotoxicity. Redox Biol. 2, 273-83. Bolisetty, S. Zarjou, A. Hull, T. D. Traylor, A. M. Perianayagam, A. Joseph, R. Kamal, A. I. Arosio, P. Soares, M. P. Jeney, V. Balla, J. George, J. F. 2015. Macrophage and epithelial cell H-ferritin expression regulates renal inflammation. Kidney Int. 88 (1), 95-108. Calay, D., Mason, J.C., 2014. The multifunctional role and therapeutic potential of HO-1 in the vascular endothelium. Antioxidants & redox 21

signaling 20, 1789-1809. Campbell, N.K., Fitzgerald, H.K., Fletcher, J.M., Dunne, A., 2019. Plant-Derived Polyphenols Modulate Human Dendritic Cell Metabolism and Immune Function via AMPK-Dependent Induction of Heme Oxygenase-1. Frontiers in immunology 10, 345. Chau, L.Y., 2015. Heme oxygenase-1: emerging target of cancer therapy. Journal of biomedical science. 22:22. Chen, D., Zang, Y.H., Qiu, Y., Zhang, F., Chen, A.D., Wang, J.J., Chen, Q., Li, Y.H., Kang, Y.M., Zhu, G.Q., 2019. BCL6 Attenuates Proliferation and Oxidative Stress of Vascular Smooth Muscle Cells in Hypertension. Oxid Med Cell Longev. 2019, 5018410. Chen, Y., Li, J., Wei, J., Kawan, A., Wang, L., Zhang, X., 2017. Vitamin C modulates Microcystis aeruginosa death and toxin release by induced Fenton reaction. Journal of hazardous materials. 321, 888-895. Chiang, S.K., Chen, S.E., Chang, L.C., 2018. A Dual Role of Heme Oxygenase-1 in Cancer Cells. international journal of molecular sciences. 20(1). Degese, M.S., Mendizabal, J.E., Gandini, N.A., Gutkind, J.S., Molinolo, A., Hewitt, S.M., Curino, A.C., Coso, O.A., Facchinetti, M.M., 2012. Expression of heme oxygenase-1 in non-small cell lung cancer (NSCLC) and its correlation with clinical data. Lung cancer (Amsterdam, Netherlands) 77, 168-175. 22

Dixon, S. J. Lemberg, K. M. Lamprecht, M. R. Skouta, R. Zaitsev, E. M. Gleason, C. E. Patel, D. N. Bauer, A. J. Cantley, A. M. Yang, W. S. Morrison, B., 3rd Stockwell, B. R. 2012. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 149 (5), 1060-72. Faubert, B., Boily, G., Izreig, S., Griss, T., Samborska, B., Dong, Z., Dupuy, F., Chambers, C., Fuerth, B.J., Viollet, B., Mamer, O.A., Avizonis, D., DeBerardinis, R.J., Siegel, P.M., Jones, R.G., 2013. AMPK is a negative regulator of the Warburg effect and suppresses tumor growth in vivo. Cell metabolism 17, 113-124. Fu, X., Li, H., Liu, C., Hu, B., Li, T., Wang, Y., 2016. Long noncoding RNA AK126698 inhibits proliferation and migration of non-small cell lung

cancer

cells

by

targeting

Frizzled-8

and

suppressing

Wnt/beta-catenin signaling pathway. OncoTargets and therapy 9, 3815-3827. Graves, E.E., Vilalta, M., Cecic, I.K., Erler, J.T., Tran, P.T., Felsher, D., Sayles, L., Sweet-Cordero, A., Le, Q.T., Giaccia, A.J., 2010. Hypoxia in models of lung cancer: implications for targeted therapeutics. Clinical cancer research : an official journal of the American Association for Cancer Research 16, 4843-4852. Group., N.M.-a.C., 2014. Preoperative chemotherapy for non-small-cell lung cancer: a systematic review and meta-analysis of individual participant data. Lancet (London, England) 383, 1561-1571. 23

Harris, A.L., 2002. Hypoxia--a key regulatory factor in tumour growth. Nature reviews. Cancer 2, 38-47. Harrison, L., Blackwell, K., 2004. Hypoxia and anemia: factors in decreased sensitivity to radiation therapy and chemotherapy? The oncologist 9 Suppl 5, 31-40. Immenschuh, S., Baumgart-Vogt, E., Mueller, S., 2010. Heme oxygenase-1 and iron in liver inflammation: a complex alliance. Current drug targets 11, 1541-1550. Jin, H.R., Du, C.H., Wang, C.Z., Yuan, C.S., Du, W., 2019. Ginseng metabolite Protopanaxadiol induces Sestrin2 expression and AMPK activation through GCN2 and PERK. Cell death & disease 10, 311. Jomova, K., Valko, M., 2011. Advances in metal-induced oxidative stress and human disease. Toxicology 283, 65-87. Kim, S.J., Um, J.Y., Lee, J.Y., 2011. Anti-inflammatory activity of hyperoside through the suppression of nuclear factor-kappaB activation in mouse peritoneal macrophages. The American journal of Chinese medicine 39, 171-181. Korytowski, W. Wawak, K. Pabisz, P. Schmitt, J. C. Chadwick, A. C. Sahoo, D. Girotti, A. W. 2015. Impairment of Macrophage Cholesterol Efflux by Cholesterol Hydroperoxide Trafficking: Implications for Atherogenesis Under Oxidative Stress. Arterioscler Thromb Vasc Biol. 35 (10), 2104-13. 24

Kwon, M. Y. Park, E. Lee, S. J. Chung, S. W. 2015. Heme oxygenase-1 accelerates erastin-induced ferroptotic cell death. Oncotarget. 6 (27), 24393-403. Lee, J.A., Kim, H.R., Kim, J., Park, K.D., Kim, D.J., Hwang, O., 2018. The Novel Neuroprotective Compound KMS99220 Has an Early Anti-neuroinflammatory Effect via AMPK and HO-1, Independent of Nrf2. Experimental neurobiology 27, 408-418. Lee, T.C., Cheng, I.C., Shue, J.J., Wang, T.C., 2011. Cytotoxicity of arsenic trioxide is enhanced by (-)-epigallocatechin-3-gallate via suppression of ferritin in cancer cells. Toxicology and applied pharmacology 250, 69-77. Lever, J.M., Boddu, R., George, J.F., Agarwal, A., 2016. Heme Oxygenase-1 in Kidney Health and Disease. Antioxidants & redox signaling 25, 165-183. Li, W., Saud, S.M., Young, M.R., Chen, G., Hua, B., 2015. Targeting AMPK for cancer prevention and treatment. Oncotarget 6, 7365-7378. Liu, M., Zheng, M., Cai, D., Xie, J., Jin, Z., Liu, H., Liu, J., 2019a. Zeaxanthin promotes mitochondrial biogenesis and adipocyte browning via AMPKalpha1 activation. Food & function 10, 2221-2233. Liu, R.L., Xiong, Q.J., Shu, Q., Wu, W.N., Cheng, J., Fu, H., Wang, F., Chen, J.G., Hu, Z.L., 2012. Hyperoside protects cortical neurons from oxygen-glucose deprivation-reperfusion induced injury via nitric oxide 25

signal pathway. Brain research 1469, 164-173. Li, W. Liu, M.Xu, Y. F. Feng, Y. Che, J. P. Wang, G. C. Zheng, J. H. 2014. Combination of quercetin and hyperoside has anticancer effects on renal cancer cells through inhibition of oncogenic microRNA-27a. Oncol Rep.31(1). 117-24. Liu, Y., Deng, J., Fan, D., 2019b. Ginsenoside Rk3 ameliorates high-fat-diet/streptozocin induced type 2 diabetes mellitus in mice via the AMPK/Akt signaling pathway. Food & function 10, 2538-2551. Liu, Y.H., Liu, G.H., Mei, J.J., Wang, J., 2016. The preventive effects of hyperoside on lung cancer in vitro by inducing apoptosis and inhibiting proliferation through Caspase-3 and P53 signaling pathway. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 83, 381-391. Loboda, A., Damulewicz, M., Pyza, E., Jozkowicz, A., Dulak, J., 2016. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cellular and molecular life sciences : CMLS 73, 3221-3247. Loboda, A., Jozkowicz, A., Dulak, J., 2015. HO-1/CO system in tumor growth, angiogenesis and metabolism - Targeting HO-1 as an anti-tumor therapy. Vascular pharmacology 74, 11-22. Lu, B. Chen, X. B. Ying, M. D. He, Q. J. Cao, J. Yang, B. 2017. The Role of Ferroptosis in Cancer Development and Treatment Response. Front Pharmacol. 8, 992. 26

Pernicova, I., Korbonits, M., 2014. Metformin--mode of action and clinical

implications

for diabetes

and cancer. Nature reviews.

Endocrinology 10, 143-156. Puri, N. Arefiev, Y. Chao, R. Sacerdoti, D. Chaudry, H. Nichols, A. Srikanthan, K. Nawab, A. Sharma, D. Lakhani, V. H. Klug, R. Sodhi, K. 2017. Heme Oxygenase Induction Suppresses Hepatic Hepcidin and Rescues Ferroportin and Ferritin Expression in Obese Mice. J Nutr Metab. 2017, 4964571. Quan, Y.Y., Qin, G.Q., Huang, H., Liu, Y.H., Wang, X.P., Chen, T.S., 2016. Dominant roles of Fenton reaction in sodium nitroprusside-induced chondrocyte apoptosis. Free radical biology & medicine 94, 135-144. Raval, C.M., Lee, P.J., 2010. Heme oxygenase-1 in lung disease. Current drug targets 11, 1532-1540. Rodriguez, M., Potter, D.A., 2013. CYP1A1 regulates breast cancer proliferation and survival. Molecular cancer research : MCR 11, 780-792. Saddiqe, Z., Maimoona, A., Abbas, G., Naeem, I., Shahzad, M., 2016. Pharmacological screening of Hypericum androsaemum extracts for antioxidant, anti-lipid peroxidation, antiglycation and cytotoxicity activity. Pakistan journal of pharmaceutical sciences 29, 397-405. Salem, A., Asselin, M.C., Reymen, B., Jackson, A., Lambin, P., West, C.M.L., O'Connor, J.P.B., Faivre-Finn, C., 2018. Targeting Hypoxia to Improve Non-Small Cell Lung Cancer Outcome. Journal of the National 27

Cancer Institute 110(1). Shin, D.H., Choi, Y.J., Park, J.W., 2014. SIRT1 and AMPK mediate hypoxia-induced resistance of non-small cell lung cancers to cisplatin and doxorubicin. Cancer research 74, 298-308. Song, J., Li, T., Cheng, X., Ji, X., Gao, D., Du, M., Jiang, N., Liu, X., Mao, X., 2016. Sea cucumber peptides exert anti-inflammatory activity through suppressing NF-kappaB and MAPK and inducing HO-1 in RAW264.7 macrophages. Food & function 7, 2773-2779. Sun, X. Ou, Z. Chen, R. Niu, X. Chen, D. Kang, R. Tang, D. 2016. Activation of the p62-Keap1-NRF2 pathway protects against ferroptosis in hepatocellular carcinoma cells. Hepatology. 63 (1), 173-84. Sun, X. Q. Wu, C. Qiu, Y. B. Wu, Y. X. Chen, J. L. Huang, J. F. Chen, D. Pang,

Q.

F.

2019.

Heme

oxygenase-1

attenuates

seawater

drowning-induced acute lung injury through a reduction in inflammation and oxidative stress. Int Immunopharmacol. 74, 105634. Thevenod, F., 2018. Iron and Its Role in Cancer Defense: A Double-Edged

Sword.

Metal

ions

in

life

sciences

18. doi:

10.1515/9783110470734-021. Tsai, J.R., Wang, H.M., Liu, P.L., Chen, Y.H., Yang, M.C., Chou, S.H., Cheng, Y.J., Yin, W.H., Hwang, J.J., Chong, I.W., 2012. High expression of heme oxygenase-1 is associated with tumor invasiveness and poor clinical outcome in non-small cell lung cancer patients. Cellular oncology (Dordrecht) 35, 461-471. 28

Valko, M., Jomova, K., Rhodes, C.J., Kuca, K., Musilek, K., 2016. Redox- and non-redox-metal-induced formation of free radicals and their role in human disease. Archives of toxicology 90, 1-37. Wang, L., Yue, Z., 2016. Dietary Flavonoid Hyperoside Induces Apoptosis of Activated Human LX-2 Hepatic Stellate Cell by Suppressing

Canonical

NF-kappaB

Signaling.

BioMed

research

international 2016: 1068528. doi: 10.1155/2016/1068528. Ward, D. M. Kaplan, J. 2012. Ferroportin-mediated iron transport: expression and regulation. Biochim Biophys Acta. 1823 (9), 1426-33. Wen, L., Lin, Y., Lv, R., Yan, H., Yu, J., Zhao, H., Wang, X., Wang, D, 2017. An Efficient Method for the Preparative Isolation and Purification of Flavonoids from Leaves of Crataegus pinnatifida by HSCCC and Pre-HPLC. Molecules. 2017 May; 22(5): 767. William, W.N., Kim, J.S., Liu, D.D., Solis, L., Behrens, C., Lee, J.J., Lippman, S.M., Kim, E.S., Hong, W.K., Wistuba, II, Lee, H.Y., 2012. The impact of phosphorylated AMP-activated protein kinase expression on lung cancer survival. Annals of oncology : official journal of the European Society for Medical Oncology 23, 78-85. Willows, R., Sanders, M.J., Xiao, B., Patel, B.R., Martin, S.R., Read, J., Wilson, J.R., Hubbard, J., Gamblin, S.J., Carling, D., 2017. Phosphorylation of AMPK by upstream kinases is required for activity in mammalian cells. The Biochemical journal 474, 3059-3073. 29

Wohlkoenig, C., Leithner, K., Olschewski, A., Olschewski, H., Hrzenjak, A., 2017. TR3 is involved in hypoxia-induced apoptosis resistance in lung cancer cells downstream of HIF-1alpha. Lung cancer (Amsterdam, Netherlands) 111, 15-22. Wong, V.K.W., Zeng, W., Chen, J., Yao, X.J., Leung, E.L.H., Wang, Q.Q., Chiu, P., Ko, B.C.B., Law, B.Y.K., 2017. Tetrandrine, an Activator of Autophagy, Induces Autophagic Cell Death via PKC-alpha Inhibition and mTOR-Dependent Mechanisms. Frontiers in pharmacology 8, 351. Xiao, R., Xiang, A.L., Pang, H.B., Liu, K.Q., 2017. Hyperoside protects against hypoxia/reoxygenation induced injury in cardiomyocytes by suppressing the Bnip3 expression. Gene 629, 86-91. Yoshida, M. Minagawa, S. 2019. Involvement of cigarette smoke-induced epithelial cell ferroptosis in COPD pathogenesis. Nat Commun. 10 (1), 3145. Zhang, X.W., Liu, W., Jiang, H.L., Mao, B., 2018. Chinese Herbal Medicine for Advanced Non-Small-Cell Lung Cancer: A Systematic Review and Meta-Analysis. The American journal of Chinese medicine 46, 923-952. Zhu, X., Ji, M., Han, Y., Guo, Y., Zhu, W., Gao, F., Yang, X., Zhang, C., 2017. PGRMC1-dependent autophagy by hyperoside induces apoptosis and sensitizes ovarian cancer cells to cisplatin treatment. International journal of oncology 50, 835-846. 30

Zou, L., Chen, S., Li, L., Wu, T., 2017. The protective effect of hyperoside on carbon tetrachloride-induced chronic liver fibrosis in mice via upregulation of Nrf2. Experimental and toxicologic pathology : official journal of the Gesellschaft fur Toxikologische Pathologie 69, 451-460.

Table legends Table 1 Primers for real-time quantitative PCR analysis in humans

Figure legends

31

Fig 1. Prolonged hypoxia promoted proliferation and survival of A549 cells. (A) A549 cells were cultured under normoxic condition (21% O2) or hypoxic condition (1% O2) for 12, 24, 36, 48, 72 hours, and cell proliferation was determined by CCK-8 test. (B) Representative images showing cell morphology after hypoxia exposure for 48 and 72 h. (C) Typical dot plot of A549 cell death were shown using the Annexin V/PI assay via flow cytometry after hypoxia exposure for 48 and 72 h. (D) Analysis of cell death. Values are mean ± SE. *P<0.05 vs. 21% O2. ***P<0.001 vs. 21% O2. n = 4-6 per group.

Fig 2. Hyperoside decreased A549 cell viability. A549 cells were treated with different concentration of hyperoside for different times 32

followed in normal (21% O2) condition. (A) Chemical structure of hyperoside. (B) A549 cells were treated with hyperoside at different concentrations (0, 1, 5, 10, 50, 100, 500 and 1000 μM) for 24 h, and then the cell proliferation was determined by CCK-8 assay. (C) A549 cells were treated with hyperoside (0, 10, 50, 100 μM) for 6, 12, 24 and 48 h, and then the cell proliferation was determined by CCK-8 assay. (D) Representative images showing cell morphology after hyperoside (100μM) exposure for 24 h. Values are mean ± SE. *P<0.05 vs. the ctrl group; **P<0.01 vs. the ctrl group; ***P<0.001 vs. the ctrl group; n=3-5 per group.

33

Fig 3. Hyperoside inhibited hypoxia-induced cell proliferation in A549 cells. A549 were pretreated with different concentration of hyperoside (10, 50, 100 μM) for 6 h followed by normal (21% O 2) or hypoxia (1% O2) for 48 h. (A) A549 proliferation was determined with CCK-8 assay. (B) percentage of EdU-positive cells. (C) Representative images showing EdU-positive cells measured with EdU incorporation assay. Blue fluorescence shows cell nuclei and green fluorescence stands for cells with DNA synthesis. Values are mean ± SE. **P<0.01 vs. 21% O2; ***P<0.001 vs. 21% O2; †††P<0.001 vs. 1% O2. A. n = 4 per group. B. n = 6-11 per group.

34

Fig 4. Hyperoside inhibited hypoxia-induced cell survival in A549 cells. A549 were pretreated with different concentration of hyperoside (10, 50, 100 μM) for 6 h followed by normal (21% O 2) or hypoxia (1% O2) for 48 h. (A) A549 cell death was analyzed by Annexin V/PI staining via flow cytometry. (B) percentage of dead cells. Values are mean ± SE. *P<0.05 vs. 21% O2; †P<0.05 vs. 1% O2; ††P<0.01 vs. 1% O2. n=3 per group.

35

Fig

5.

Hyperoside

protected

against

hypoxia-induced

A549

proliferation and survival via activating phosphorylation of AMPK. A549 cells were pretreated with or without Compound C (10 μM) 1 h before hyperoside (100 μM) treatment under hypoxia stimuli. (A) & (C) & (E) Representative western blotting images of p-AMPK. (B) & (D) expression of p-AMPK. (F) Cell proliferation was measured by CCK-8 assay. (G) flow cytometry showed the cell death. Values are mean ± SE. 36

*P<0.05 vs. 21%O2; **P<0.01 vs. 21% O2 ***P<0.001 vs. 21% O2 ; †P<0.05 vs. 1% O2; ††P<0.01 vs. 1% O2; †††P<0.001 vs. 1% O2 ; ###

P<0.001 vs. the Ctrl group. n=3-4 per group.

Fig 6. Hyperoside induced HO-1 expression dependent on AMPK activation. A549 were pretreated with or without Compound C (10 μM) or ZnPP (10 μM) 1 h before hyperoside (100 μM) treatment under 37

hypoxia stimuli. (A) & (C) & (H) Representative western blotting images of HO-1. (B) & (D) expression of HO-1 protein. (E) expression of HO-1 mRNA. (F) Cell proliferation was measured by CCK-8 assay. (G) flow cytometry showed the cell death. Values are mean ± SE. *P<0.05 vs. 21% O2; ***P<0.001 vs. 21% O2; †P<0.05 vs. 1% O2; ††P<0.01 vs. 1% O2; †††P<0.001 vs. 1% O2; ###P<0.001 vs. the Ctrl group. n=4-6 per group.

Fig 7. Ferrous ion contributed to hyperoside-induced A549 cell death under hypoxia. (A), A549 were pretreated with different doses of 38

hyperoside (10, 50, 100 μM) for 6 h followed by normal (21% O 2) or 2+

hypoxia (1% O2) for 48 h. intracellular Fe level was detected. (B), A549 2+

cells pretreated with or without Fe chelation 0.4 μM phenanthroline 1 h before hyperoside (100 μM) exposure under hypoxia. Cell viability were determined by CCK-8 assay. (C), ROS generation was measured with DCFH-DA staining. (D), GSH content. (E) & (F), mRNA and protein levels of FTH. (G), protein level of FTH. A549 cells pretreated with or without ZnPP (10 μM) 1 h before hyperoside (100 μM) exposure under hypoxia. †P<0.05 vs. 1% O2 ††P<0.01 vs. 1% O2; †††P<0.001 vs. 1% O2 ; #

P<0.05 vs. the Ctrl group. Values are mean ± SE, n=3-7 per group.

Fig 8. Effects of hyperoside on ferroptosis-associated indexes under hypoxia condition in A549 cells. A549 were pretreated with different doses of hyperoside (10, 50, 100 μM) for 6 h followed by normal (21% 39

O2) or hypoxia (1% O2) for 48 h. (A), lipid peroxidation generation was examined with C11-BODIPY via flow cytometry. (B), Bar graph showing the relative fluorescence intensity of C11-BODIPY. (C) mRNA levels of ferroptosis-related genes (Gpx4, SLC7A11 and TFRC). Values are mean ± SE. ***P<0.001 vs. 21% O2; †P<0.05 vs. 1% O2. n = 4-6 per group.

40

Table legends Table 1 Primers for real-time quantitative PCR analysis in humans

HO-1

FTH

Gpx4

SLC7A11

TFRC

GAPDH

Primer

Sequence

Forward

TCCGATGGGTCCTTACACTC

Reverse

CCATAGGCTCCTTCCTCCTT

Forward

TCCTACGTTTACCTGTCCATGT

Reverse

GTTTGTGCAGTTCCAGTAGTGA

Forward

GAGGCAAGACCGAAGTAAACTAC

Reverse

CCGAACTGGTTACACGGGAA

Forward

TCTCCAAAGGAGGTTACCTGC

Reverse

AGACTCCCCTCAGTAAAGTGAC

Forward

ACCATTGTCATATACCCGGTTCA

Reverse

CAATAGCCCAAGTAGCCAATCAT

Forward

AACAGCGACACCCACTCCTC

Reverse

GGAGGGGAGATTCAGTGTG

41

GRAPHICAL ABSTRACT

42