Hyperparasitism by the bacteriophage (Caudovirales) infecting Candidatus Xenohaliotis californiensis (Rickettsiales-like prokaryote) parasite of wild abalone Haliotis fulgens and Haliotis corrugata from the Peninsula of Baja California, Mexico

Journal of Invertebrate Pathology 140 (2016) 58–67

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip

Hyperparasitism by the bacteriophage (Caudovirales) infecting Candidatus Xenohaliotis californiensis (Rickettsiales-like prokaryote) parasite of wild abalone Haliotis fulgens and Haliotis corrugata from the Peninsula of Baja California, Mexico Roberto Cruz-Flores a, Jorge Cáceres-Martínez a,b,⇑, Monserrat Muñoz-Flores a, Rebeca Vásquez-Yeomans b, Mónica Hernández Rodriguez a, Miguel Ángel Del Río-Portilla a, Axayácatl Rocha-Olivares a, Ernestina Castro-Longoria a a b

Centro de Investigación Científica y de Educación Superior de Ensenada (CICESE), Carretera Ensenada-Tijuana No. 3918, Zona Playitas, 22860, Ensenada, Baja California, Mexico Instituto de Sanidad Acuícola, A.C. (ISA), Calle de la Marina S/N, esq. Caracoles, Fraccionamiento Playa Ensenada, 22880, Ensenada, Baja California, Mexico

a r t i c l e

i n f o

Article history: Received 15 July 2016 Revised 6 September 2016 Accepted 9 September 2016 Available online 10 September 2016 Keywords: Abalone Haliotis Withering syndrome Candidatus Xenohaliotis californiensis Hyperphage Hyperparasitism

a b s t r a c t Candidatus Xenohaliotis californiensis (CXc) is a Rickettsiales-like prokaryote that is considered the causal agent of Withering Syndrome (WS), a chronic disease of abalone, from the west coast of North America and it is listed by the International Organization for Animal Health (OIE) as a reportable agent due to its pathogenicity. This bacterium in red abalone Haliotis rufescens, black abalone Haliotis cracherodii, and yellow abalone Haliotis corrugata from California, US and Baja California, Mexico has been found to be infected by a bacteriophage. To date, there is no information on the epizootiology of CXc and its bacteriophage in natural populations of abalone; furthermore, it is unknown if the bacteriophage was also present in CXc infecting blue abalone Haliotis fulgens. The objective of this study was to determine the distribution, prevalence and intensity of CXc, as well as to determine the distribution and prevalence of the bacteriophage and to study interactions between host sex and hyperparasitism in blue abalone and yellow abalone. Tissue samples were obtained from seven localities where the commercial capture of wild abalone is carried out. Samplings were conducted throughout the 2012–2013 capture seasons and a total of 182 blue abalone and 170 yellow abalone were obtained. The prevalence and intensity of CXc and the prevalence of the bacteriophage were determined by histology. The identity of CXc was confirmed by PCR, product sequence analysis and in situ hybridization while the identity of the bacteriophage was corroborated by TEM. The prevalence of CXc infected and uninfected by the bacteriophage was 80% in blue abalone and 62% in yellow abalone. Low infection intensities were found in 86% of blue abalone and 82% of yellow abalone. Infection intensity was significantly higher in undifferentiated yellow abalone. The bacteriophage in CXc showed a prevalence of 22% and 31% in blue abalone and yellow abalone respectively. These results show that CXc and its bacteriophage are widely distributed in the peninsula of Baja California and that they are well established in natural populations of blue abalone and yellow abalone. Additionally, this data constitutes the first record of a bacteriophage in blue abalone. Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction Candidatus Xenohaliotis californiensis (CXc) is a marine rickettsial-like organism which causes Withering Syndrome (WS) a chronic, progressive wasting disease of several species of abalone ⇑ Corresponding author at: Centro de Investigación Científica y de Educación Superior de Ensenada (CICESE), Carretera Ensenada-Tijuana No. 3918, Zona Playitas, 22860, Ensenada, Baja California, Mexico. E-mail address: [email protected] (J. Cáceres-Martínez). http://dx.doi.org/10.1016/j.jip.2016.09.001 0022-2011/Ó 2016 Elsevier Inc. All rights reserved.

from the coastal waters of California, US and the peninsula of Baja California, Mexico (Gardner et al., 1995; Friedman et al., 2000; Braid et al., 2005; Moore et al., 2009; Cáceres-Martínez et al., 2011). This disease first appeared in the Channel Islands of Southern California in the mid-1980s and resulted in a decrease of 99% of black abalone H. cracherodii populations (Haaker et al., 1986, 1992; Gardner et al., 1995). Due to its impact on black abalone populations from the USA, CXc is considered by the International Organization for Animal Health (OIE) as reportable agent.

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

Candidatus Xenohaliotis californiensis infects the epithelial cells of the digestive tract of abalone, in particular the posterior esophagus although infection can spread to the stomach, digestive diverticula and in rare cases the intestine (Gardner et al., 1995; Friedman et al., 2000; Wetchateng et al., 2010). This prokaryote replicates and lives within spherical to oblong intracytoplasmatic membrane bound vacuoles (MBVs) (14.1–56.4 lm) that stain pink to purple with hematoxylin and eosin in histological slides and have a uniform appearance (Friedman et al., 2000; CáceresMartínez et al., 2011). Transmission electron microscopy (TEM) analysis have revealed that CXc in red abalone H. rufescens and black abalone can be infected by bacteriophage (Friedman and Crosson, 2012), further studies on yellow abalone H. corrugata and red abalone determined that this bacteriophage belongs to the order Caudovirales (Cruz-Flores and Cáceres-Martínez, 2016). This bacteriophage induces alterations to the morphology of the MBVs and individual bacteria causing the death of CXc (Friedman and Crosson, 2012; Cruz-Flores and Cáceres-Martínez, 2016). The bacteriophage infected MBVs (iMBVs) stain deep purple to navy blue with hematoxylin and eosin, are larger in size and have a granular appearance; individual infected bacteria within the iMBVs can be discerned by light microscopy (Friedman and Crosson, 2012; Cruz-Flores and Cáceres-Martínez, 2016). Experimental infection studies suggest that abalone infected with CXc and the bacteriophage have reduced disease (Friedman et al., 2014). In Mexico CXc has been detected in some parts of the peninsula of Baja California such as Isla de Cedros, Isla San Benito, Bahia Todos Santos and several abalone farms affecting black abalone (Valles-Ríos, 2000; Cáceres-Martínez et al., 2011), cultured red abalone (Cáceres-Martínez and Tinoco-Orta, 2001; CáceresMartínez et al., 2011), wild blue abalone H. fulgens (ÁlvarezTinajero et al., 2002; Cáceres-Martínez et al., 2011) and wild yellow abalone (Álvarez-Tinajero et al., 2002; Cáceres-Martínez et al., 2011). However, epizootiological information of the parasite and its hyperparasite such as prevalence, infection intensity and possible host-sex-hyperparasite interactions have not been studied. Additionally it is unknown if the bacteriophage also infects CXc hosted by the blue abalone. 2. Materials and methods 2.1. Sampling During the 2012–2013 capture season, 182 adult blue abalone and 170 yellow abalone were obtained from 7 localities where the capture of abalone is carried out (Fig. 1). Two samplings were carried out during the 2012–2013 capture season, the first one was conducted in April 2012 and a second sampling was conducted in November of 2012. Sample sizes, sampling date and locality information is presented in Table 1. All abalone were taken randomly from commercial captures and were of legal size established by Mexican authorities (14.8 ± 1.0–16.6 ± 1.2 cm in shell length). From each animal a sample from the posterior esophagus was preserved in 95% ethanol for PCR analysis while the rest digestive gland was fixed in 10% neutral buffered formalin for histological analysis. 2.2. Prevalence and intensity of Candidatus Xenohaliotis californiensis and its bacteriophage Histological processing was performed as previously described by Cáceres-Martínez et al. (2011). Formalin-fixed 5 lm tissue sections of the posterior esophagus, stomach and digestive diverticula were stained with hematoxylin and eosin (Shaw and Battle, 1957). To determine if CXc was infected by the bacteriophage the appear-

59

ance and staining characteristics of the MBVs that contained the bacteria were considered, uninfected MBVs of CXc stain pink to purple and have a uniform smooth appearance, while the iMBVs of CXc stain deep purple to navy blue and have a rough appearance and individual bacteria can be observed by light microscopy. Additionally, all histological slides were analyzed for the presence of a third type inclusion form by a rickettsiales-like marine bacteria tentatively described as stippled RLP which is not related to CXc (Crosson et al., 2014; Friedman et al., 2014; Cruz-Flores and Cáceres-Martínez unpublished data), these inclusions stain light blue and have a dotted appearance. The prevalence of CXc per abalone species was determined considering the presence of both the MBVs and the iMBVs. The prevalence of the bacteriophage in each abalone species was determined considering the presence exclusively of the iMBVs. Additionally the prevalence of the bacteriophage in CXc in each abalone species was determined by considering the presence of the iMBVs in abalone infected with CXc. The prevalence was determined per abalone specie and by sex in each specie considering both samplings. Additionally the prevalence was also calculate per specie by locality and by sampling date. A scale for intensity was created where infection intensity was determined counting and adding the total number of MBVs and iMBVs observed per histological slide corresponding to digestive epitheliums and the digestive gland of each organism: 1–500= (1), 501–1000= (2), >1001= (3). The infection intensity was determined per abalone specie and by sex in each specie considering both sampling. Additionally the infection intensity was also calculate per specie by locality and by sampling date. The MVBs and the iMBVs were measured to the nearest 0.0 lm (N = 40). The length was taken as the larger of the two axis of the MBVs, while the width take as the shortest of the axis. The prevalence of CXc was compared between the two abalone species, between sexes of each specie and the prevalence of the bacteriophage in CXc between abalone species were all compared through Fishers exact test. The length and width of the MBVs, iMBVs, uninfected CXc and infected CXc were compared by a student’s t-test. Additionally, an ANOVA was performed to determine if significant differences in infection intensities existed among sexes (male, female and undifferentiated) of the same species, Tukey’s Post-Hoc analysis was used to determine significant differences between sexes of the same species. 2.3. Identity confirmation of Candidatus Xenohaliotis californiensis 2.3.1. Polymerase chain reaction To corroborate the presences of CXc, PCR analysis were carried out. DNA was extracted from the abalone posterior esophagus using QIAGEN DNeasyÒ Blood and Tissue Kit (QIAGEN Inc., Valencia, CA) following the manufacturers ‘‘mouse tail protocol” instructions. DNA amplification was carried out using the pair of primers RA 5–1 (50 GTTGAACGTGCCTTCAGTTTAC30 )/RA 3–6 (50 ACTTGGACT CATTCAAAAGCGGA-30 ) that amplify a fragment of the 16S rRNA gene obtaining a product of 160 bp. PCR amplification was performed following the method of Andree et al. (2000). 2.3.2. DNA sequencing In order to confirm that the 160 bp fragment to be amplified corresponded to CXc, a PCR product from each species were purified using QIAquick PCR purification Kit following the manufacturer’s instructions and were sent to Quimera BIOLABS S. de R.L de C.V for sequencing. BLASTn search was employed to compare sequences obtained with published data in GenBank. The alignment of sequences was carried out employing Clustal W in MEGA 6 software.

60

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

Fig. 1. Main abalone capture zone of the peninsula of Baja California, México. The map shows the geographical distribution of the sampled areas.

Table 1 Sample sizes of blue and yellow abalone by date and locality. Blue abalone

Yellow abalone

Locality

Sampling date

Sample size

Locality

Sampling date

Sample size

La Purísima

April 2012 November 2012 November 2012 April 2012 November 2012 April 2012 November 2012 April 2012 November 2012 April 2012 November 2012

8 13 27 29 2 11 35 8 20 9 20

La Purísima

April 2012 November 2012 November 2012 November 2012 April 2012 April 2012 April 2012

20 17 31 12 30 30 30

Buzos y Pescadores Bahia Tortugas Emancipación Progreso Punta Abreojos

Buzos y Pescadores Emancipación Leyes de Reforma Progreso Punta Abreojos

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

61

Fig. 2. Candidatus Xenohaliotis californiensis (CXc) infecting the gastrointestinal epithelia of abalone. (A) Presence of spherical to oblong membrane bound vacuoles (MBVs) of CXc (⁄) in the stomach epitheliums of abalone causing alterations of the host cells, some vacuoles (+) can be observed extracellularly in the lumen of the stomach. (B) Heavy infection by CXc. (C and D) Presence of CXc and the bacteriophage infected MBVs (iMBVs) (arrows) in the posterior esophagus, note the clear difference in morphology and staining pattern between the two inclusions. (E and F) Several extracellular MBVs surrounded by mucus (+). (G) Rupture of iMBVs formed by CXc and expulsion of bacteriophage infected bacteria into the lumen of the esophagus (arrows).

2.3.3. In situ hybridization Histological blocks from two abalone of each species from each sampled area that tested positive for the MBVs and the iMBVs were

selected for In situ hybridization. All sections were dried onto positively charged microscopic slides, in situ hybridization was carried out following the protocol described by Antonio et al. (2000) with

Table 2 Comparison (student’s t-test) of the mean length and width (lm) of the membrane bound vacuoles (MBVs) and infected membrane bound vacuoles as well as uninfected Candidatus Xenohaliotis californiensis (CXc) and infected CXc.

MBV MBV CXc CXc

Un infected length

Infected length

19.14

29.53

0.55

Un infected width

Infected width

13.34

16.75

0.52

0.97

1.32

Significance of test (P) <0.001 0.003 <0.001 <0.001

B

30 80 20 29 66 17

A B

30 77 33 28 68 4

A B

30 40 20 0 0 0

A B

12 83 8 46 85 7

A B

0 0 0 31 97 39

A B

31 45 0 27 78 15

A B

37 62 27 21 86 38

Progreso Leyes de Reforma

A

The MBVs were observed within the gastrointestinal epithelial cells (Fig. 2A). These MBVs were abundant in the epithelial cells of the posterior esophagus, stomach and were commonly observed in the digestive diverticula. The bacterial colonies were usually found apical to the nucleus of the host cell and their shape was spherical to oblong (Fig. 2B). The MBV had an average length of 19.1 ± 4.6 lm and an average width of 13.3 ± 6.5 lm (N = 40). The iMBVs were observed in the proximity of the typical MBVs. These iMBVs had the same tissue distribution as the MBVs (Fig. 2C and D). The iMBVs varied greatly in size and shape. The average length of the iMBVs was 29.5 ± 11.7 lm with an average width of 16.7 ± 6.6 lm; colonies as large as 62.7 lm in length and 36.6 lm in width were observed (N = 40). A comparison of vacuole size is shown in Table 2. The iMBVs were found in blue abalone and yellow abalone from most studied areas. Both the MBVs and the iMBVs were observed being released from the host cells to the lumen of the digestive gland (Fig. 2E–G). In general the MBVs maintain their integrity in the lumen (Fig. 2E and F); however the iMBVs lost their integrity, they ruptured the host cell and the vacuole and individual bacteria were observed being released from the host cell (Fig. 2G).

N Prevalence (%) Phage prevalence (%)

3.1. Presence of Candidatus Xenohaliotis californiensis

Emancipación

3. Results

Bahía Tortugas

Additional parallel 1–2 mm2 tissue samples (extra pieces of tissue take from abalone that were also fix in formalin for histology) of the posterior esophagus from abalone from each species from the sampled area with advance signs of WS were fixed in 4% glutaraldehyde, 0.1 M sodium cacodylate, pH 7.4 for 4 h at 4 °C, washed once in 0.1 M sodium cacodylate for 12 h at 4 °C, postfixed in 1% OsO4, and stored at 4 °C in 0.1 M sodium cacodylate. To guarantee the possible observation of the bacteriophage due to their unknown prevalence, additional samples of 10 blue abalone and 2 yellow abalone from same capture area were used and processed as described by Cruz-Flores et al. (2015). Fixed samples were processed for TEM in the Microbiology department of the Centro de Investigación Científica y de Educación Superior de Ensenada.

Buzos y pescadores

2.4. Confirmation of the presence of the bacteriophage of Candidatus Xenohaliotis californiensis by Electron Microscopy

La Purísima

an equivolume mixture of four primers RA 5.1, RA 3–6, RA 3–8 (50 CCACTGTGAGTGGTTATCTCCTG-30 ), and RA 5–6 (50 GAAGCAATATT GTGAGAT-AAAGCA-30 ). These primers were tailed at 30 -end with digoxigenin-11-dUTP (Alpha DNA Montreal, Quebec). Tissue from known CXc infected blue abalone and yellow abalone served as positive controls. Abalone tissue sections without CXc were used as negative controls. Slides were examined by light microscopy for the presence or absence of CXc inclusions hybridizing with the DNA probe, those that showed blue to purple precipitates were considered positive to CXc.

Punta Abreojos

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67 Table 3 Prevalence of Candidatus Xenohaliotis californiensis and the bacteriophage infected Candidatus X. californiensis inclusions in blue and yellow abalone in the studied areas during the 2012–2013 capture season. A: Haliotis fulgens, B: H. corrugata.

62

Table 4 Infection intensity of Candidatus Xenohaliotis californiensis in blue and yellow abalone in the studied areas during the 2012–2013 capture season. The table shows the percentage of abalone from both species found in each degree of the intensity. A: Haliotis fulgens, B: H. corrugata. La Purísima

Buzos y pescadores

Bahía tortugas

Emancipación

Leyes de Reforma

Progreso

Punta Abreojos

A

B

A

B

A

B

A

B

A

B

A

B

A

B

1 2 3

94 6 0

91 9 0

95 5 0

93 0 7

90 3 7

0 0 0

64 15 21

70 20 10

0 0 0

92 0 8

63 16 21

74 13 13

100 0 0

92 8 0

Table 5 Prevalence and infection intensity of CXc and the bacteriophage in blue abalone and yellow abalone by locality and sample date. Only the infection intensity of CXc is shown. The infection intensity of the bacteriophage was a grade of 1 in all cases. Locality

Sampling date

Sample size

Specie

Prevalence of CXc (%)

Prevalence of the phage (%)

Infection intensity grade 1

Infection intensity grade 2

Infection intensity grade 3

La Purísima

April 2012 November 2012 November 2012 April 2012 November 2012 April 2012 November 2016 April 2012 November 2012 April 2012 November 2012 April 2012 November 2012 November 2012 November 2012 April 2012 April 2012 April 2012

8 13 27 29 2 11 35 8 20 9 20 20 17 31 12 30 30 30

Blue abalone

100 77 78 100 50 91 83 100 55 78 60 75 47 45 83 40 77 80

25 46 15 41 0 0 10 0 5 56 0 35 18 0 8 20 33 20

88 100 95 90 100 30 76 25 91 100 100 93 88 93 70 92 74 92

12 0 5 3 0 20 14 25 9 0 0 7 12 0 20 0 13 8

0 0 0 7 0 50 10 5 0 0 0 0 0 7 10 8 13 0

Buzos y Pescadores Bahia Tortugas Emancipación Progreso Punta Abreojos La Purísima Buzos y Pescadores Emancipación Leyes de Reforma Progreso Punta Abreojos

Blue abalone Blue abalone Blue abalone Blue abalone Blue abalone Yellow Abalone Yellow Yellow Yellow Yellow Yellow

abalone abalone abalone abalone abalone

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

Intensity

63

64

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

The stippled inclusions were not detected in blue abalone or yellow abalone from any of the sampled areas.

Candidatus Xenohaliotis californiensis was detected in both species of abalone in all the studied areas where samples were obtained. The prevalence of CXc in blue abalone was 80%, while in yellow abalone the prevalence was 62%; the difference in the prevalence was highly significant (P = 0.00). The bacteriophage was found in both species of abalone from localities where samples were taken with the exception of yellow abalone from Buzos y Pescadores. The bacteriophage showed a similar prevalence in both species of abalone (18% in blue abalone and 19% in yellow abalone) (P = 0.79). Table 3 shows the prevalence of CXc and the bacteriophage by locality. An infection intensity of 1 was found in 86% and 82% of blue abalone and yellow abalone respectively no significant differences were observed in infection intensities (P = 0.65). Table 4 shows the infection intensity of CXc by locality. Additionally Table 5 shows the prevalence and intensity by sampling date and locality of CXc and bacteriophage. 3.3. Prevalence of the bacteriophage in Candidatus Xenohaliotis californiensis per abalone species The prevalence of the bacteriophage was marginally higher in yellow abalone (31%) than in blue abalone (22%) (P = 0.05). 3.4. Host-Sex interaction of Candidatus Xenohaliotis californiensis and its bacteriophage The prevalence of CXc was statistically the same in male (80%) and female (82%) blue abalone (P = 0.85) (Fig. 3). Also in blue abalone the bacteriophage showed the same prevalence of 16% in males and females (P = 1.00). In yellow abalone the prevalence of CXc was identical in males (58%) and females (58) (P = 1.00) (Fig. 3). The bacteriophage in yellow abalone showed a similar prevalence in males (12%) and females (12%) (P = 0.81). No signif-

Prevalence (%)

90 80

Candidatus Xenohaliotis californiensis

70

Bacteriophage

60 50 40 30 20 10 0

Male

Female

Blue Abalone

Male

Female

Yellow Abalone

Fig. 3. Prevalence of Candidatus Xenohaliotis californiensis (CXc) and its bacteriophage hyperparasite between species and sexes. The figure shows differences in the prevalence of CXc between species of abalone, with blue abalone having a higher prevalence that yellow abalone. The hyperphage parasite showed a very similar prevalence between both species of abalone. The prevalence of CXc and it bacteriophage are also very similar in male and female abalone of the same species.

Infection Intensity

3.2. Distribution, prevalence and intensity of Candidatus Xenohaliotis californiensis and its bacteriophage

2.00

1.50

Male

1.00

Female Undifferenated Male Female Undifferenated

0.50

Blue Abalone

Yellow Abalone

Fig. 4. Average infection intensity of Candidatus Xenohaliotis californiensis in blue abalone and yellow abalone. No significant differences were found between sexes in blue abalone. Undifferentiated yellow abalone showed significantly higher infection intensity than males. Brackets represent a 95% confidence interval.

icant differences were observed between the infection intensity of male, female and undifferentiated blue abalone (P = 0.08). In yellow abalone no differences were observed between male and female abalone (P = 0.15), but undifferentiated organism showed a significantly higher infection intensity than male yellow abalone (P = 0.00) (Fig. 4).

3.5. Identity confirmation of Candidatus Xenohaliotis californiensis by PCR, sequence analysis and in situ hybridization A PCR product of 160 bp corresponding to CXc was detected in blue abalone and yellow abalone from all the studied areas. Further corroborating the presence and identity of the bacterium in the studied area. Sequence analysis revealed a 158 bp product with a cover of 100% and an identity of 100% with previously reported sequences of CXc from gene bank (AFI33090.2, AFO69062.1). In situ hybridization further corroborated that MBVs and the iMBVs observed in the gastrointestinal epithelial cells correspond to CXc. This confirms that the iMBVs that vary in morphology to the typical MBVs are also formed by the bacterium. No hybridization was observed in slides lacking MBVs and the iMBVs (Fig. 5).

3.6. Confirmation of the presence of the bacteriophage in Candidatus Xenohaliotis californiensis by TEM Examination by TEM revealed that CXc inside of the uninfected MBVs in both species of abalone had a spherical to coccobacillus form and had a mean length of 0.55 ± 0.07 lm and a mean width of 0.52 ± 0.06 lm (N = 30) (Fig. 6A and B). TEM examination also revealed CXc infected by a bacteriophage hyperparasite in blue abalone and yellow abalone (Fig. 6C and D). The infected CXc were greatly pleomorphic and had a mean length of 1.32 ± 0.49 lm and a mean width of 0.97 ± 0.27 lm (N = 30). A comparison of bacterial mean length and width is shown in Table 2. Within CXc the some bacteriophage were observed with a clear core, others were observed with an electron dense core and other bacteriophages were observed with a long and apparently flexible tail. The bacteriophages with a clear core had a mean diameter of 54 nm (N = 30), the bacteriophages with an electron dense core had a mean diameter of 56 nm (N = 30), and the length of the tail of complete bacteriophages measured a mean of 41 nm (Fig. 6E).

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

65

Fig. 5. In situ hybridization of Candidatus Xenohaliotis californiensis (CXc). (A) Typical membrane bound vacuoles (MBVs) formed by CXc in the gastro intestinal epithelium cells of blue abalone by H and E. (B) Specific CXc probes showing a positive hybridization to the MBVs observed in abalone gastrointestinal epitheliums. (C) Bacteriophage infected membrane bound vacuoles (iMBVs) of CXc, some individual bacteria infected by the phage can be observed extracellularly (arrow). (D) The iMBVs showing positive hybridization using specific probes for CXc, individual infected bacteria that ruptured the host cell and their MBV can be observed extracellularly and show hybridization (arrow).

Fig. 6. Transmission electron micrographs of Candidatus Xenohaliotis Californiensis (CXc) and CXc infected by the bacteriophage hyperparasite from Blue abalone. (A) A membrane bound vacuole with a large number large spherical to coccobacillus form CXc (Bar = 0.5 lm). (B) An individual uninfected CXc note the coccoid shape (Bar = 0.2 lm). (C) A large coccoid shaped CXc infected by the bacteriophage hyperparasite, note some phages have a clear capsid while other have a dark electron dense capsid (Bar = 0.5 lm). (D) A large and pleomorphic CXc infected by the bacteriophage, again some phage have a clear capsid while other have a dark electron dense capsid, additionally complete phages with a long and apparently flexible tail can be observed (Bar = 0.5 lm). (E) High magnification of to complete phages displaying a tail (Bar = 50 nm).

66

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

4. Discussion The parasite CXc and its bacteriophage hyperparasite were found to be widely distributed in natural populations of blue abalone and yellow abalone from the peninsula of Baja California, indicating that the parasite and the hyperparasite are well established in the studied areas and should be considered endemic to the region. These findings represent an increase in the range of the parasite from the more site specific and minor geographical scale studies of Valles-Ríos (2000) and Álvarez-Tinajero et al. (2002). Furthermore this is the only study that has shown the distribution of the bacteriophage in natural blue abalone and yellow abalone populations, in the past the studies of Friedman and Crosson (2012), Friedman et al. (2014) and Cruz-Flores and CáceresMartínez (2016) have been farm specific or site specific and did not show the distribution of the hyperparasite at a major larger scale. The high prevalence and low infection intensity found in blue abalone and yellow abalone in this study considering infected and uninfected CXc are very similar to the values reported by Álvarez-Tinajero et al. (2002) for the same species from Isla de Cedros and Isla San Benito during the 1996–1997 capture season, using the same target tissue and size. This suggest that there is a stable interaction between the parasite and the host indicating that sudden massive abalone die offs historically attributed to CXc and WS could be a result of other factors such as environmental changes (drastic temperature variations for example), that affect infected and uninfected animals. Evidently, abalone with severe infections by CXc would be more vulnerable, but this highly infected group represents a small percentage. The prevalence of the CXc can vary considerably depending on the host species, in Mexican cultured red abalone populations a prevalence of 84–100% is common (Cáceres-Martínez and Tinoco-Orta, 2001). In wild red abalone from California the prevalence may go from 1–75%, while a higher prevalence of 74–98% may be found in wild black abalone (OIE, 2012). Other abalone species not native to the western coast of North America such as the small abalone Haliotis diversicolor supertexta and european abalone Haliotis tuberculata have been found to have a moderate to high prevalence ranging from 61–53% and 1–38% in cultured populations respectively (Balseiro et al., 2006; Wetchateng et al., 2010). Archived blue, yellow, red and black abalone histological slides have shown since 1996 the presence of two types of CXc inclusions. One that meets the classical description by Friedman et al. (2000) of the MBVs of CXc and a second inclusion that meets the description of the iMBVs described by Friedman and Crosson (2012), however the cause of this variation was unknown. The iMBVs in the proximity of the MBVs found in this study have the same tissue distribution and a very similar morphology to the iMBVs found in red abalone and black abalone from California (Friedman and Crosson, 2012; Friedman et al., 2014; Crosson et al., 2014). Our TEM observations revealed the presence of phage particles in CXc, confirming that morphological variation observed at a histological level is induced by infection with the bacteriophage hyperparasite as reported by Friedman and Crosson (2012) and CruzFlores and Cáceres-Martínez (2016). A bacteriophage with the morphological characteristics of a Caudovirus infecting CXc in cultured red abalone and wild yellow abalone was recently described by Cruz-Flores and Cáceres-Martínez (2016). This description suggest that the bacteriophage could belong to the family Siphoviridae, however more detailed morphological studies are needed to have a definitive conclusion. The bacteriophage observed in this study resembles the phage described by Cruz-Flores and CáceresMartínez (2016). This constitutes the second report of a bacteriophage in wild yellow abalone and the first report in wild blue

abalone. The third type of inclusion termed the stippled RLP was not detected in blue abalone or yellow abalone from the studied areas. Apart from being detected in the western coast of Mexico and the US, this hyperparasite has also been detected in South America in Chile in red abalone and hybrid abalone (González et al., 2014). In black abalone experimentally infected by the CXc and the bacteriophage a prevalence of 100% of the bacteriophage was observed with >50% of the MBVs of CXc being infected (Friedman et al., 2014). In red abalone and hybrid abalone from Chile experimentally infected by CXc and the bacteriophage, showed a lower prevalence of 30% and 13% respectively. The prevalence of the bacteriophage in blue abalone (19%) and yellow abalone (18%) in wild populations appear to be more similar to prevalence levels in Chilean abalone. The differences locally observed in prevalence and infection intensity in this study are difficult to explain due to discrepancies in sample sizes; which were a result of the availability of abalone. For a more detailed comparison a broader sampling is needed in terms of time and space which is of course is limited by the enormous costs it would entail. However, in general there is an concordance in the results of Álvarez-Tinajero et al. (2002) with the results of this study; that there is a higher prevalence in blue abalone than in yellow abalone which could represent differences in the susceptibility between these two species. This difference could be associated with the bathymetric distribution of blue abalone and yellow abalone. Blue abalone is distributed at a depth of 3– 6 m, while yellow abalone is found at depths of 6–24 m (Cox, 1960). The differences in their distribution are therefore not only associated with hydrostatic pressure, but also with, temperature changes and food availability. Hyperparasitism follows the same distribution of CXc and its abalone host and in both cases remain under 20%. However CXc in yellow abalone showed a significantly higher prevalence of the bacteriophage than CXc in blue abalone. It is interesting to remark that the prevalence of CXc in yellow abalone found in this study is lower that the prevalence of CXc in blue abalone which could be a result of the bacteriophage interaction in combination with the previously mention factors. This could indicate a distinct susceptibility of CXc to the bacteriophage depending on the host abalone species. It is also unknown to why the hyperparasitism is not extended to all abalone infected with CXc. The association between the prevalence of CXc and sex, showed no differential pattern, the prevalence of CXc in blue abalone and yellow abalone was the same between sexes in each species; however, in yellow abalone species higher values of infection intensity were observed in undifferentiated organisms but the sample size for undifferentiated organism was very small. It is possible that severe infections could impair gonadal development in abalone; studies conducted by Haaker et al. (1992) suggest that gonadal development is compromised due to the inability of the affected abalone to obtain energy for reproduction. The bacteriophage was found indistinctly at a low prevalence and low infection intensities in males and females of both abalone species suggesting an independence of interactions between host sex and hyperparasitism. The irregular appearance of the iMBVs and the irregular shape of individual bacteria demonstrate alteration of the normal life cycle of the bacterium. This is closely related to the loss of integrity of the iMBVs and the host cell which release the infected individual bacteria as reported by Cruz-Flores and Cáceres-Martínez (2016). The large iMBVs infected by the phage can be observed in a ruptured state and liberate phage particles and infected bacteria, this could act as a possible route of propagation for the bacteriophage, this was also observed by Cruz-Flores and Cáceres-Martínez (2016).

R. Cruz-Flores et al. / Journal of Invertebrate Pathology 140 (2016) 58–67

In conclusion these findings confirm that CXc and its bacteriophage are present in blue abalone and yellow abalone species and are distributed throughout the Baja California peninsula; thus proving the endemism of this pathogen and its bacteriophage. The association between the prevalence of CXc, its bacteriophage and sex, shows no differential pattern in either species. The prevalence of the bacteriophage was higher in CXc in yellow abalone than in blue abalone possibly suggesting a distinct susceptibility of CXc depending on the host specie of abalone. Acknowledgements This project was funded by SAGARPA-CONACYT under the name ¨ Diagnóstico sobre la disminución de las poblaciones de abulón en la costa occidental de la Península de Baja California y estrategias para atenuar los impactos negativos¨ and project number 623294 from CICESE and by ISA. We would also like to thank the Mexican abalone industry and all the people from the Social Cooperatives that participated in this study. We are grateful to Dr. Carmen Paniagua-Chávez for her valuable comments and support. A special thanks to Yanet Guerrero for technical assistance with sample processing and to and to Francisco Ponce Isguerra for support with figures. References Álvarez-Tinajero, M. del C., Cáceres-Martínez, J., Avilés, J.G.G., 2002. Histopathological evaluation of the yellow abalone Haliotis corrugata and the blue abalone Haliotis fulgens from Baja California, Mexico. J. Shellfish. Res. 21, 825–830. Andree, K.B., Friedman, C.S., Moore, J.D., Hedrick, R.P., 2000. A polymerase chain reaction for detection of genomic DNA of a Rickettsiales-like prokaryote associated with withering syndrome in black abalone (Haliotis cracherodii). J. Shellfish. Res. 19, 213–218. Antonio, D.B., Andree, K.B., Friedman, C.S., Hedrick, R.P., 2000. Detection of Rickettsiales-like prokaryotes (RLPs) by in situ hybridization in black abalone Haliotis cracherodii with withering syndrome. J. Invertebr. Pathol. 75, 180–182. Balseiro, P., Aranguren, R., Gestal, C., Novoa, B., Figueras, A., 2006. Candidatus Xenohaliotis californiensis and Haplosporidium montforti associated with mortalities of abalone Haliotis tuberculata cultured in Europe. Aquaculture 258, 63–72. Braid, B.A., Moore, J.D., Robbins, T.T., Hedrick, R.P., Tjeerdema, R.S., Friedman, C.S., 2005. Health and survival of red abalone, Haliotis rufescens, under varying temperature, food supply, and exposure to the agent of withering syndrome. J. Invertebr. Pathol. 89, 219–231. Cáceres-Martínez, J., Tinoco-Orta, G.D., 2001. Symbionts of cultured red abalone Haliotis rufescens from Baja California, Mexico. J. Shellfish. Res. 20, 875–881.

67

Cáceres-Martínez, J., Vásquez-Yeomans, R., Flores-Saaib, R.D., 2011. Intracellular prokaryote Xenohaliotis californiensis in abalone Haliotis spp. from Baja California, México. Cienc. Pes. 19, 5–11. Cox, K.W., 1960. Review of the abalone in California. Cal. Fish. Game. 46, 381–406. Crosson, L.M., Wight, N., VanBlaricom, G.R., Kiryu, I., Moore, J.D., Friedman, C.S., 2014. Abalone withering syndrome: distribution, impacts, current diagnostic methods and new findings. Dis. Aquat. Org. 108, 261–270. Cruz-Flores, R., Cáceres-Martínez, J., 2016. The hyperparasite of the rickettsialeslike prokaryote, Candidatus Xenohaliotis californiensis has morphological characteristics of a Siphoviridae (Caudovirales). J. Invertebr. Pathol. 133, 8–11. Cruz-Flores, R., Cáceres-Martínez, J., Vásquez-Yeomans, R., 2015. A novel method for separation of Rickettsiales-like organism ‘‘Candidatus Xenohaliotis californiensis” from host abalone tissue. J. Microbiol. Methods 115, 79–82. Friedman, C.S., Andree, K.B., Beauchamp, K., Moore, J.D., Robbins, T.T., Shields, J.D., Hedrick, R.P., 2000. ‘Candidatus Xenohaliotis californiensis’, a newly described pathogen of abalone, Haliotis spp., along the west coast of North America. Int. J. Syst. Evol. Microbiol. 50, 847–855. Friedman, C.S., Crosson, L.M., 2012. Putative phage hyperparasite in the rickettsial pathogen of abalone, ‘Candidatus Xenohaliotis californiensis’. Microbiol. Ecol. 64, 1064–1072. Friedman, C.S., Wight, N., Crosson, L.M., VanBlaricom, G.R., Lafferty, K.D., 2014. Reduced disease in black abalone following mass mortality: phage therapy and natural selection. Front. Microbiol. 5, 1–10. Gardner, G.R., Harshbarger, J.C., Lake, J., Sawyer, T.K., Price, K.L., Stephenson, M.D., Haaker, P.L., Togstad, H.A., 1995. Association of prokaryotes with symptomatic appearance of withering syndrome in black abalone Haliotis cracherodii. J. Invertebr. Pathol. 66, 111–120. González, R., Lohrmann, K.B., Pizarro, J., Brokordt, K., 2014. Differential susceptibility to the Withering Syndrome agent and renal coccidia in juvenile Haliotis rufescens, Haliotis discus hannai and the interspecific hybrid. J. Invertebr. Pathol. 116, 13–17. Haaker, P.L., Henderson, K.C., Parker, D.O., 1986. California Abalone. Marine Resources Leaflet No. 11. State of California, The Resources Agency, Department of Fish and Game, Marine Resources Division, Long Beach, CA. Haaker, P.L., Richards, D.V., Friedman, C.S., Davis, G., Parker, D.O., Togstad, H., 1992. Abalone withering syndrome and mass mortality of black abalone, Haliotis cracherodii in California. In: Shephard, S.A., Tegner, M., Guzmán del Próo, S. (Eds.), Abalone of the World: Biology, Fisheries and Culture. Fishing News Books, Cambridge, MA, pp. 214–224. Moore, J.D., Juhasz, C.I., Robbins, T.T., Vilchis, L.I., 2009. Green abalone, Haliotis fulgens infected with the agent of withering syndrome do not express disease signs under a temperature regime permissive for red abalone, Haliotis rufescens. Mar. Biol. 156, 2325–2330. OIE (World Organization for Animal Health), 2012. Infection with Xenohaliotis Californiensis in: Manual of Diagnostic Tests for Aquatic Animals. OIE, Paris. . Shaw, B.L., Battle, H.I., 1957. The gross microscopic anatomy of the digestive gland of the oyster Crassostrea virginica (Gmelin). Can. J. Zool. 35 (3), 325–346. Valles-Ríos, H., 2000. Análisis histopatológico del abulón negro Haliotis cracherodii afectado por el síndrome de deterioro. Cienc. Pes. 14, 5–17. Wetchateng, T., Friedman, C.S., White, N.A., Lee, P.Y., 2010. Withering syndrome in the abalone Haliotis diversicolor supertexta. Dis. Aquat. Org. 90, 69–76.