- Email: [email protected]
Hypodermin C improves the survival of kidney allografts
Transplant Immunology 51 (2018) 45–49
Contents lists available at ScienceDirect
Transplant Immunology journal homepage: www.elsevier.com/locate/trim
Hypodermin C improves the survival of kidney allografts Ankang Hu
a,c,1
a,1
, Yan Wang
b
a
, Honghua Yuan , Lianlian Wu , Kuiyang Zheng
c,⁎
T
a
Laboratory Animal Center, Xuzhou Medical University, Xuzhou, Jiangsu, China Department of Neurobiology, Xuzhou Medical University, Xuzhou, Jiangsu, China Jiangsu Key Laboratory of Immunity and Metabolism, Laboratory of Infection and Immunity, Department of Pathogenic Biology and Immunology, Laboratory of Infection and Immunity, Xuzhou Medical University, Xuzhou, China
b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Hypodermin C Immunosuppression Kidney allograft Graft rejection
Although immunosuppressive therapies have made organ transplantation a common medical procedure worldwide, chronic toxicity is a major issue of long-term treatment. One method to improve such therapies is the application of immunomodulatory agents from parasites, such as Hypoderma lineatum (Diptera: Oestridae). Hypodermin C (HC) is an enzyme secreted by H. lineatum larvae, and our previous study showed that recombinant HC could degrade guinea pig C3 and inhibit the complement pathway in vitro, suggesting potential activity for inhibiting transplant rejection. However, such properties have not been fully demonstrated in vivo. In this study, we investigated the impact of HC on a fully MHC-mismatched, life-sustaining, murine model of kidney allograft rejection using B6 donors and BABL/c (HC transgenic or wild-type) recipients. Kidney grafts were analyzed by histology, immunohistochemistry and western blotting. The results suggested that HC could effectively inhibit kidney allograft rejection. These findings suggest HC is a promising strategy to improve the survival of human implants.
1. Introduction Organ transplantation is one of the most effective treatments for patients with end-stage organ disease; however, current strategies of immunosuppression are not only incompletely effective at preventing allograft rejection, but can also lead to the development of allograft dysfunction after prolonged therapy and promote the risk of death due to organ dysfunction after prolonged therapy [1–3]. Acute rejection is a major hurdle that needs to be overcome in allotransplantation. The recipient's endogenous antibodies, complement system and cytokines play important roles in regulating immunity, and all of these molecules participate in acute rejection [4,5]. For example, interleukin (IL)-2, which is produced by activated T cells and plays a pivotal role in the proliferation of T lymphocytes, is associated with transplant rejection [6]. Numerous studies have shown that parasite-derived immune modulators are a potential means of inhibiting transplant rejection. For example, Hypoderma lineatum (Diptera: Oestridae) is an endoparasite of cattle and occasionally humans [7], the larvae of which invade into the deep connective tissue of the host by secreting proteases to diminish host immune regulation and evade immune responses [8]. Hypodermin is a protease secreted by the first-instar larvae of H. lineatum that is
composed of three main components: Hypodermin A (HA), B (HB), and C (HC) [9]. Several studies have demonstrated that HA plays an important role in regulating inflammation and specific immune responses, and avoiding host immune responses. Chen et al. demonstrated that HA can improve the survival of skin allografts [10]; however, there have been limited studies on the immunological activity of HC. Our previous study showed that HC could degrade guinea pig C3 in vitro, inhibiting the in vitro complement pathway [11]. To further investigate the feasibility of HC as an immunosuppressant after allograft surgery, this study used transgenic HC mice to construct a kidney transplantation model. We found that HC overexpression prevented rejection and prolonged survival. Protection was associated with the spontaneous diminution of graft-infiltrating effector cells, including CD8+ and CD4+ T cells, and reduced cytokine and chemokine expression. 2. Objective Parasites escape immune surveillance by downregulating host immunity. This mechanism maybe a potential method used to inhibit graft rejection. Our previous study demonstrated the immunosuppressive role of HC in vitro. In this study, through constructing transgenic mice,
⁎
Corresponding author. E-mail address: [email protected] (K. Zheng). 1 These authors made equal contributions to the work. https://doi.org/10.1016/j.trim.2018.09.001 Received 23 June 2018; Received in revised form 31 August 2018; Accepted 1 September 2018 Available online 02 September 2018 0966-3274/ © 2018 Published by Elsevier B.V.
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
we demonstrated the immunosuppressive activity of HC in vivo, and found that HC can improve the survival of kidney allografts.
Table 1 Primer used in this study.
3. Materials and methods 3.1. Animals B6 and BALB/c mice were purchased from the Animal Center of Xuzhou Medical University (Xuzhou, China). BALB/c transgenic mice overexpressing HC were generated by Cyagen Biosciences Inc. (Guangzhou, China). The normal female mice (6–8-weeks-old, 20–25 g) used in the experiments were housed in a specific pathogen-free facility at Xuzhou Medical University and maintained under clean conditions. Experiments were conducted using established animal care guidelines and were approved by the Animal Ethics Committee of Xuzhou Medical University.
Primers
Sequence 5′ → 3′
CCL2-F CCL2-R CCL5-F CCL5-R CXCL9-F CXCL9-R GAPDH-F GAPDH-R
GATGCAGTTAACGCCCCACT ACCCATTCCTTCTTGGGGTC GCTCCAATCTTGCAGTCGTG GAGCAGCTGAGATGCCCATT ATCCCAGGCCTGTCTGTTTG CGAAAGCTACGTGGGAGGTT GGCAAATTCAACGGCACAGT TAGGGCCTCTCTTGCTCAGT
3.5. Enzyme-linked immunosorbent assay (ELISA) HC transgenic and control (WT) mice (6–8-weeks-old, 20–25 g) were used to collect blood by retro-orbital bleeding, and serum was obtained by centrifuging blood samples for 5 min at 1000 rpm. The concentrations of IL-2, Interferon (IFN)-γ, Tumor Necrosis Factor (TNF)-α, and IL-6 were quantified using specific ELISA kits (R&D Systems, Minneapolis, MN, USA) and following the manufacturer's instructions.
3.2. Kidney transplantation Kidneys of B6 donor mice were removed together with the ureter and vessels en mass, including a small (1–2 mm) bladder cuff attached to the distal ureter. Kidneys were transplanted into the left iliac fossa of BALB/c wild-type (WT) and transgenic mice, which underwent a leftsided native nephrectomy. Briefly, a segment of the abdominal aorta, which was connected with the donor's renal artery, and the recipient abdominal aorta end-to-side anastomosis, the donor vein and the recipient inferior vena cava end-to side anastomosis, and the ureter was reconstructed with an improved method and anastomosed to the recipient's bladder. After revascularization, the native right kidney was removed; therefore, the recipients' survival depended solely on the transplanted kidney. Mice received a single intraperitoneal injection of ampicillin prior to wound closure. No immunosuppressive medication was administered.
3.6. RNA isolation and real-time reverse transcription PCR (RT-qPCR) Three kidneys were selected per group, and samples of the same weight were taken from positive and negative kidneys. The samples were homogenized with a tissue homogenizer, and TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA, which was converted to cDNA using reverse transcriptase (Roche, Basel, Switzerland). cDNA samples were standardized based on GAPDH cDNA levels. The primers used in this study were designed with Primer Premier 5.0 (Premier BioSoft, Palo Alto, CA, USA) and are listed in Table 1.
3.3. Western blot
3.7. Statistical analysis
Proteins (30–50 mg protein/lane) were separated using 10% SDSPAGE and transferred to nitrocellulose membranes, which were then blocked for 30 min in 5% bovine serum albumen containing 0.1% Tween-20. Membranes were then incubated with the following primary antibodies: anti-HC (mouse polyclonal, 1:1000; Abcam, Cambridge, UK), anti-C3 (goat polyclonal, 1:1000; Thermo Fisher Scientific, Waltham, MA, USA) and anti-β-actin (mouse monoclonal, 1:1000; Santa Cruz Biotechnology, Dallas, TX, USA). After washing in buffer, the membranes were incubated with corresponding horseradish peroxidase-conjugated secondary antibodies (anti-mouse, 1:1000; antigoat, 1:1000; Gene Company Ltd., Hong Kong, China) at room temperature for 2 h. Immunoreactive bands were detected using Odyssey (Gene Company Ltd.), and signal intensities were quantified by densitometry using Image J software. Protein levels were normalized to βactin.
All data are presented as mean ± standard error (SEM) and were analyzed with one-way analysis of variance using SPSS v.16.0 (IBM, Armonk, NY, USA). Mean separation was investigated using a least significant difference procedure multiple comparison test. P-values < .05 were considered significant. 4. Results 4.1. HC degraded C3 in adult transgenic mice Our previous in vitro study showed that HC induced a large amount of C3 chain degradation [11]. To extend our study in vivo, we constructed BABL/c transgenic mice that overexpressed HC; western blot results indicated that HC was successfully expressed in the kidneys of transgenic mice compared with wild-type mice and H. lineatum first instar larvae (Fig. 1A). Next, serum samples were collected, and C3 immunodetection showed a fading in transgenic mice (Fig. 1B). These results suggested that HA degraded murine C3 in vivo.
3.4. Histology and immunohistochemistry Kidney samples were taken 14 d after transplantation. Tissue samples were fixed with 10% neutral-buffered formalin, and then hematoxylin and eosin staining was performed on 5-μm paraffin sections. Additional graft tissue was snap frozen in optimal cutting temperature compound with liquid nitrogen. Sections were probed with anti-mouse CD4, anti-mouse CD8, or anti-mouse CD86 antibodies, and then stained with biotinylated secondary antibodies. The number of positivelystained cells in each section was counted in 10 microscope fields (200 × magnification) in identical regions of the studied kidney grafts to calculate the mean percentage per visual field. All sections were reviewed by one operator.
4.2. HC expression in recipients protected full MHC-mismatched kidney allografts To test whether HC inhibited allograft rejection, we used a lifesupporting kidney transplant model, in which B6 kidneys were transplanted into BABL/c WT (control group) or transgenic mice. We found that a majority of WT mice rejected transplants, with a median survival of 21.5 days. In contrast, fewer transgenic recipients experienced graft failure, with a median survival of 63 days (Fig. 2A). Meanwhile, we conducted sequential analyses of allograft kidney function. The results 46
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Fig. 1. Overexpressed HC degraded C3 in vivo. A. HC transgenic mice or WT mice were used in the experiments, protein was isolated from mice tail. HC protein levels were detected by western blot (1: kidneys of control mice, 2: kidneys of transgenic mice, 3: H. lineatum first instar larvae). B. Blood was obtained from the eyeballs of the mice, and serum was obtained by centrifuging blood samples for 5 min at 1000 rpm, C3 expression was detected by western blot.
such as cyclosporine A, can efficiently suppress graft-rejection, but are limited by the toxicity, as they lead to chronic nephrotoxicity. Parasites, such as H. lineatum, evade immunological surveillance by downregulating host immunity. These parasites' immunosuppressive mechanisms may be a potential method of suppressing graft-rejection. More specifically, H. lineatum larvae secrete substances, such as HA, HB and HC, that weaken host defenses. Most previously studies have focused on the immunosuppressive mechanism of HA. For example, Baron et al. showed that prior to H. lineatum infection, cattle diminished antigen-induced peripheral blood mononuclear cell proliferation [12]. Our college demonstrated that HA reduces inflammation by cleaving complement component C3 in bovine, rats and humans [10]. Malassagne et al. found that HA prevented hyperacute rejection by degrading C3, and that guinea-pig hearts transplanted into HA-treated rats survived longer than those in controls [13]. However, there has been little research into HC. Indeed, HC is the most antigenic and can be detected first after infection [14]. Additionally, HC suppresses lymphocyte responses to mitogens and antigens during larval migration [15]. Our previous study demonstrated that HC can play immunosuppressive roles by cleaving C3 in vitro. C3 plays a vital role in pathogenesis; the antigen–antibody complex induces a C3-dependent cascade that leads to the formation of the membrane attack complex, which disrupts the integrity of the phospholipid bilayer, leading to graft failure. To examine the effect of HC in vivo, we constructed HC transgenic mice and demonstrated the cleavage effect of HC on C3 in vivo. Next, using the full MHC-mismatched mouse transplantation model, we demonstrated that HC overexpression was associated with prolonged graft survival and reduced organ dysfunction. T cell-mediated immune responses to grafted tissues are the major reason for failed organ transplantation. For example, activated CD8+ T cells are essential for graft-rejection [16]. Intriguingly, effector T cells, particularly CD4+ T cells, are both necessary and sufficient to mediate allograft rejection [17,18]. In the current study, we found that HC overexpression resulted in a diminishment of allograft-infiltrating effector T cells. Additionally, CD68+ monocytes/macrophage, which also play important roles in graft rejection, were also downregulated in HC
indicated that WT allografts incurred significant dysfunction at 2 weeks posttransplantation as reflected by a 2.5-fold elevates in serum creatinine compared to transgenic mice (Fig. 2B). 4.3. HC reduced the infiltration of inflammatory cells into renal allografts Parallel to the functional analyses, we also analyzed allograft kidney morphology. Histopathological examination showed consistent results with the kidney function analyses, including enhanced focal interstitial inflammatory cell infiltrates, and peritubular capillary dilation after transplantation in WT recipients, while HC overexpression significantly diminished these phenotypes (Fig. 3A). Furthermore, we also characterized the other graft-infiltrating inflammatory cells (CD4+, CD8+ T cells and CD68+ macrophages) by immunohistochemistry. There were many infiltrating CD4+, CD8+ T cells and CD68+ macrophages into WT allografts; however, numbers of these graft-infiltrating cells were significantly decreased in transgenic mice (Fig. 3B). 4.4. HC overexpression impaired chemokine and cytokine generation The differences in the numbers of graft-infiltrating inflammatory cells between WT and HC transgenic recipients prompted us to investigate whether there were any differences in chemokine gene expression between the two groups. We found that compared with the WT group, the chemokines CCL2, CCL5 and CXCL9 showed significantly reduced expression in the transgenic group (Fig. 4A-C). Furthermore, when we detected cytokine expression in recipients, we found that IL-2 and IFN-γ expression were dramatically reduced, while the inflammatory cytokines TNF-α and IL-6 showed a modest downregulation (Fig. 4D-G). 5. Discussion New immunosuppressive agents and advanced surgical techniques have been developed for organ transplantation; however, many issues remain with this method. For instance, immunosuppressive agents,
Fig. 2. Prolonged allograft survival in HC transgenic mice. (A) Survival was measured in all allografts (BABL/c wild-type or transgenic recipients receiving B6). Fifteen mice were tested in each group; the median survival for WT allografts was 21.5 d, which was significantly different than the HC transgenic group (63 d) (P < .001). (B) Serum creatinine levels were detected using ELISA to evaluate renal function at day 14 posttransplantation. Values are means ± SD; **P < .01. 47
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Fig. 3. Transgenic recipients had significantly reduced cellular infiltration compared with controls. (A) Representative hematoxylin and eosin-stained graft kidneys were harvested 14 days after grafting (scale bar: 50 μm). (B) WT and HC transgenic allografts were harvested 14 d after transplantation, and representative CD4+, CD8+ or CD68+ immunohistochemistry in allografts are shown.
mice. In summary, HC is immunosuppressive and inhibits cell-mediated transplant rejection. Our results suggest that HC plays important roles in kidney transplantation using HC transgenic mouse models. This suggests that HC may improve the survival of human graft recipients and provide new options for inhibiting immune rejection in humans. However, the inferred results between mice and humans have limitations, which require us to conduct more in-depth studies so that these results can be better applied to human clinical trials.
transgenic recipients. The recruitment and retention of effector T cells into transplanted organs is regulated in a complex manner by chemokine expression [19], and the concentrations of Th1 cytokines (such as IL-2 and IFN-γ) increase during acute rejection and are highly correlated with the severity of rejection [20]. Thus, we detected the expression of chemokines and Th1 cytokines and found that the reduced numbers of inflammatory cells coincided with a lack of chemokine and Th1 cytokine expression. Additionally, lower levels of TNF-α and IL-6 revealed inhibition of the graft rejection response in HC transgenic
Fig. 4. Transgenic mice showed diminished chemokine and cytokine expression after grafting. (A-C) Graft kidneys were harvested 16 d after grafting, and RT-qPCR was performed to detected CCL2, CCL5 and CXCL9 expression. (D-G) Blood was obtained by trans-orbital bleeding, and IL-2, IFN-γ, TNF-α and IL-6 concentrations were evaluated with ELISA. The results are representative of three independent experiments; *P < .05, **P < .01. 48
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Conflict of interest
261–267. [9] R. Panadero, V. Dacal, C. Lopez, L. Vazquez, S. Cienfuegos, P. Diaz, P. Morrondo, P. Diez-Banos, Immunomodulatory effect of Hypoderma lineatum antigens: in vitro effect on bovine lymphocyte proliferation and cytokine production, Parasite Immunol. 31 (2009) 72–77. [10] R.J. Chen, A.K. Hu, H.H. Yuan, Z.Z. Wang, D.J. Ji, L.L. Wu, T.Y. Zhang, Y.H. Zhu, W. Sun, X.R. Zhu, The immunosuppression mechanism of hypodermin a on complement, Parasitol. Int. 63 (2014) 392–396. [11] A.K. Hu, R.J. Chen, X.R. Zhu, J.H. Gu, Z.P. Liu, Immunosuppressive effect of Hypodermin C on Complement Component 3 in Vitro, Cell Biochem. Biophys. 72 (2015) 93–98. [12] R.W. Baron, J. Weintraub, Lymphocyte responsiveness in cattle previously infested and uninfested with Hypoderma lineatum (de Vill.) and H. bovis (L.) (Diptera: Oestridae), Vet. Parasitol. 24 (1987) 285–296. [13] B. Malassagne, J.M. Regimbeau, F. Taboit, F. Troalen, C. Chereau, N. Moire, J. Attal, F. Batteux, F. Conti, Y. Calmus, D. Houssin, C. Boulard, L.M. Houdebine, B. Weill, Hypodermin A, a new inhibitor of human complement for the prevention of xenogeneic hyperacute rejection, Xenotransplantation 10 (2003) 267–277. [14] R. Panadero, C. Lopez, D. Carballo, R. Casais, A. Paz, P. Morrondo, P. Diez-Banos, Assessment of a recombinant antigen versus natural hypodermin C for the serodiagnosis of hypodermosis in cattle, Parasitol. Res. 86 (2000) 67–68. [15] N. Silva, W.C. Smith, Inverse correlation of population similarity and introduction date for invasive ascidians, PLoS One 3 (2008) e2552. [16] N.M. Lerret, T. Li, J.J. Wang, H.K. Kang, S. Wang, X. Wang, C. Jie, Y.S. Kanwar, M.M. Abecassis, X. Luo, Z. Zhang, Recipient Myd88 deficiency promotes spontaneous resolution of kidney allograft rejection, J. Am. Soc. Nephrol. 26 (2015) 2753–2764. [17] B.A. Pietra, A. Wiseman, A. Bolwerk, M. Rizeq, R.G. Gill, CD4 T cell-mediated cardiac allograft rejection requires donor but not host MHC class II, J. Clin. Invest. 106 (2000) 1003–1010. [18] T.J. Grazia, B.A. Pietra, Z.A. Johnson, B.P. Kelly, R.J. Plenter, R.G. Gill, A two-step model of acute CD4 T-cell mediated cardiac allograft rejection, J. Immunol. 172 (2004) 7451–7458. [19] S.K. Bromley, T.R. Mempel, A.D. Luster, Orchestrating the orchestrators: chemokines in control of T cell traffic, Nat. Immunol. 9 (2008) 970–980. [20] F. Cottrez, S.D. Hurst, R.L. Coffman, H. Groux, T regulatory cells 1 inhibit a Th2specific response in vivo, J. Immunol. 165 (2000) 4848–4853.
The authors declare no financial or commercial conflict of interest. Acknowledgments All the experiments in this article were completed in Research Center for Neurobiology of Xuzhou Medical University, and thank the teachers for their support and help during the experiments. This work was funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) of 2018. References [1] B.J. Nankivell, S.I. Alexander, Rejection of the kidney allograft, N. Engl. J. Med. 363 (2010) 1451–1462. [2] E.M. Briganti, G.R. Russ, J.J. McNeil, R.C. Atkins, S.J. Chadban, Risk of renal allograft loss from recurrent glomerulonephritis, N. Engl. J. Med. 347 (2002) 103–109. [3] S. McDonald, G. Russ, S. Campbell, S. Chadban, Kidney transplant rejection in Australia and New Zealand: relationships between rejection and graft outcome, Am. J. Transplant. 7 (2007) 1201–1208. [4] J.A. Bradley, Overcoming the immunological barriers to xenotransplantation, Transplantation 68 (1999) 9–11. [5] B. Soin, C.M. Vial, P.J. Friend, Xenotransplantation, Br. J. Surg. 87 (2000) 138–148. [6] S. Lundberg, J. Lundahl, I. Gunnarsson, B. Sundelin, S.H. Jacobson, Soluble interleukin-2 receptor alfa predicts renal outcome in IgA nephropathy, Nephrol. Dial. Transplant. 27 (2012) 1916–1923. [7] R. Casais, J.M. Martin Alonso, J.A. Boga, F. Parra, Hypoderma lineatum: expression of enzymatically active hypodermin C in Escherichia coli and its use for the immunodiagnosis of hypodermosis, Exp. Parasitol. 90 (1998) 14–19. [8] A. Lecroisey, N.T. Tong, B. Keil, Hypodermin B, a trypsin-related enzyme from the insect Hypoderma lineatum. Comparison with hypodermin a and Hypoderma collagenase, two serine proteinases from the same source, Eur. J. Biochem. 134 (1983)
49
Contents lists available at ScienceDirect
Transplant Immunology journal homepage: www.elsevier.com/locate/trim
Hypodermin C improves the survival of kidney allografts Ankang Hu
a,c,1
a,1
, Yan Wang
b
a
, Honghua Yuan , Lianlian Wu , Kuiyang Zheng
c,⁎
T
a
Laboratory Animal Center, Xuzhou Medical University, Xuzhou, Jiangsu, China Department of Neurobiology, Xuzhou Medical University, Xuzhou, Jiangsu, China Jiangsu Key Laboratory of Immunity and Metabolism, Laboratory of Infection and Immunity, Department of Pathogenic Biology and Immunology, Laboratory of Infection and Immunity, Xuzhou Medical University, Xuzhou, China
b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Hypodermin C Immunosuppression Kidney allograft Graft rejection
Although immunosuppressive therapies have made organ transplantation a common medical procedure worldwide, chronic toxicity is a major issue of long-term treatment. One method to improve such therapies is the application of immunomodulatory agents from parasites, such as Hypoderma lineatum (Diptera: Oestridae). Hypodermin C (HC) is an enzyme secreted by H. lineatum larvae, and our previous study showed that recombinant HC could degrade guinea pig C3 and inhibit the complement pathway in vitro, suggesting potential activity for inhibiting transplant rejection. However, such properties have not been fully demonstrated in vivo. In this study, we investigated the impact of HC on a fully MHC-mismatched, life-sustaining, murine model of kidney allograft rejection using B6 donors and BABL/c (HC transgenic or wild-type) recipients. Kidney grafts were analyzed by histology, immunohistochemistry and western blotting. The results suggested that HC could effectively inhibit kidney allograft rejection. These findings suggest HC is a promising strategy to improve the survival of human implants.
1. Introduction Organ transplantation is one of the most effective treatments for patients with end-stage organ disease; however, current strategies of immunosuppression are not only incompletely effective at preventing allograft rejection, but can also lead to the development of allograft dysfunction after prolonged therapy and promote the risk of death due to organ dysfunction after prolonged therapy [1–3]. Acute rejection is a major hurdle that needs to be overcome in allotransplantation. The recipient's endogenous antibodies, complement system and cytokines play important roles in regulating immunity, and all of these molecules participate in acute rejection [4,5]. For example, interleukin (IL)-2, which is produced by activated T cells and plays a pivotal role in the proliferation of T lymphocytes, is associated with transplant rejection [6]. Numerous studies have shown that parasite-derived immune modulators are a potential means of inhibiting transplant rejection. For example, Hypoderma lineatum (Diptera: Oestridae) is an endoparasite of cattle and occasionally humans [7], the larvae of which invade into the deep connective tissue of the host by secreting proteases to diminish host immune regulation and evade immune responses [8]. Hypodermin is a protease secreted by the first-instar larvae of H. lineatum that is
composed of three main components: Hypodermin A (HA), B (HB), and C (HC) [9]. Several studies have demonstrated that HA plays an important role in regulating inflammation and specific immune responses, and avoiding host immune responses. Chen et al. demonstrated that HA can improve the survival of skin allografts [10]; however, there have been limited studies on the immunological activity of HC. Our previous study showed that HC could degrade guinea pig C3 in vitro, inhibiting the in vitro complement pathway [11]. To further investigate the feasibility of HC as an immunosuppressant after allograft surgery, this study used transgenic HC mice to construct a kidney transplantation model. We found that HC overexpression prevented rejection and prolonged survival. Protection was associated with the spontaneous diminution of graft-infiltrating effector cells, including CD8+ and CD4+ T cells, and reduced cytokine and chemokine expression. 2. Objective Parasites escape immune surveillance by downregulating host immunity. This mechanism maybe a potential method used to inhibit graft rejection. Our previous study demonstrated the immunosuppressive role of HC in vitro. In this study, through constructing transgenic mice,
⁎
Corresponding author. E-mail address: [email protected] (K. Zheng). 1 These authors made equal contributions to the work. https://doi.org/10.1016/j.trim.2018.09.001 Received 23 June 2018; Received in revised form 31 August 2018; Accepted 1 September 2018 Available online 02 September 2018 0966-3274/ © 2018 Published by Elsevier B.V.
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
we demonstrated the immunosuppressive activity of HC in vivo, and found that HC can improve the survival of kidney allografts.
Table 1 Primer used in this study.
3. Materials and methods 3.1. Animals B6 and BALB/c mice were purchased from the Animal Center of Xuzhou Medical University (Xuzhou, China). BALB/c transgenic mice overexpressing HC were generated by Cyagen Biosciences Inc. (Guangzhou, China). The normal female mice (6–8-weeks-old, 20–25 g) used in the experiments were housed in a specific pathogen-free facility at Xuzhou Medical University and maintained under clean conditions. Experiments were conducted using established animal care guidelines and were approved by the Animal Ethics Committee of Xuzhou Medical University.
Primers
Sequence 5′ → 3′
CCL2-F CCL2-R CCL5-F CCL5-R CXCL9-F CXCL9-R GAPDH-F GAPDH-R
GATGCAGTTAACGCCCCACT ACCCATTCCTTCTTGGGGTC GCTCCAATCTTGCAGTCGTG GAGCAGCTGAGATGCCCATT ATCCCAGGCCTGTCTGTTTG CGAAAGCTACGTGGGAGGTT GGCAAATTCAACGGCACAGT TAGGGCCTCTCTTGCTCAGT
3.5. Enzyme-linked immunosorbent assay (ELISA) HC transgenic and control (WT) mice (6–8-weeks-old, 20–25 g) were used to collect blood by retro-orbital bleeding, and serum was obtained by centrifuging blood samples for 5 min at 1000 rpm. The concentrations of IL-2, Interferon (IFN)-γ, Tumor Necrosis Factor (TNF)-α, and IL-6 were quantified using specific ELISA kits (R&D Systems, Minneapolis, MN, USA) and following the manufacturer's instructions.
3.2. Kidney transplantation Kidneys of B6 donor mice were removed together with the ureter and vessels en mass, including a small (1–2 mm) bladder cuff attached to the distal ureter. Kidneys were transplanted into the left iliac fossa of BALB/c wild-type (WT) and transgenic mice, which underwent a leftsided native nephrectomy. Briefly, a segment of the abdominal aorta, which was connected with the donor's renal artery, and the recipient abdominal aorta end-to-side anastomosis, the donor vein and the recipient inferior vena cava end-to side anastomosis, and the ureter was reconstructed with an improved method and anastomosed to the recipient's bladder. After revascularization, the native right kidney was removed; therefore, the recipients' survival depended solely on the transplanted kidney. Mice received a single intraperitoneal injection of ampicillin prior to wound closure. No immunosuppressive medication was administered.
3.6. RNA isolation and real-time reverse transcription PCR (RT-qPCR) Three kidneys were selected per group, and samples of the same weight were taken from positive and negative kidneys. The samples were homogenized with a tissue homogenizer, and TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA, which was converted to cDNA using reverse transcriptase (Roche, Basel, Switzerland). cDNA samples were standardized based on GAPDH cDNA levels. The primers used in this study were designed with Primer Premier 5.0 (Premier BioSoft, Palo Alto, CA, USA) and are listed in Table 1.
3.3. Western blot
3.7. Statistical analysis
Proteins (30–50 mg protein/lane) were separated using 10% SDSPAGE and transferred to nitrocellulose membranes, which were then blocked for 30 min in 5% bovine serum albumen containing 0.1% Tween-20. Membranes were then incubated with the following primary antibodies: anti-HC (mouse polyclonal, 1:1000; Abcam, Cambridge, UK), anti-C3 (goat polyclonal, 1:1000; Thermo Fisher Scientific, Waltham, MA, USA) and anti-β-actin (mouse monoclonal, 1:1000; Santa Cruz Biotechnology, Dallas, TX, USA). After washing in buffer, the membranes were incubated with corresponding horseradish peroxidase-conjugated secondary antibodies (anti-mouse, 1:1000; antigoat, 1:1000; Gene Company Ltd., Hong Kong, China) at room temperature for 2 h. Immunoreactive bands were detected using Odyssey (Gene Company Ltd.), and signal intensities were quantified by densitometry using Image J software. Protein levels were normalized to βactin.
All data are presented as mean ± standard error (SEM) and were analyzed with one-way analysis of variance using SPSS v.16.0 (IBM, Armonk, NY, USA). Mean separation was investigated using a least significant difference procedure multiple comparison test. P-values < .05 were considered significant. 4. Results 4.1. HC degraded C3 in adult transgenic mice Our previous in vitro study showed that HC induced a large amount of C3 chain degradation [11]. To extend our study in vivo, we constructed BABL/c transgenic mice that overexpressed HC; western blot results indicated that HC was successfully expressed in the kidneys of transgenic mice compared with wild-type mice and H. lineatum first instar larvae (Fig. 1A). Next, serum samples were collected, and C3 immunodetection showed a fading in transgenic mice (Fig. 1B). These results suggested that HA degraded murine C3 in vivo.
3.4. Histology and immunohistochemistry Kidney samples were taken 14 d after transplantation. Tissue samples were fixed with 10% neutral-buffered formalin, and then hematoxylin and eosin staining was performed on 5-μm paraffin sections. Additional graft tissue was snap frozen in optimal cutting temperature compound with liquid nitrogen. Sections were probed with anti-mouse CD4, anti-mouse CD8, or anti-mouse CD86 antibodies, and then stained with biotinylated secondary antibodies. The number of positivelystained cells in each section was counted in 10 microscope fields (200 × magnification) in identical regions of the studied kidney grafts to calculate the mean percentage per visual field. All sections were reviewed by one operator.
4.2. HC expression in recipients protected full MHC-mismatched kidney allografts To test whether HC inhibited allograft rejection, we used a lifesupporting kidney transplant model, in which B6 kidneys were transplanted into BABL/c WT (control group) or transgenic mice. We found that a majority of WT mice rejected transplants, with a median survival of 21.5 days. In contrast, fewer transgenic recipients experienced graft failure, with a median survival of 63 days (Fig. 2A). Meanwhile, we conducted sequential analyses of allograft kidney function. The results 46
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Fig. 1. Overexpressed HC degraded C3 in vivo. A. HC transgenic mice or WT mice were used in the experiments, protein was isolated from mice tail. HC protein levels were detected by western blot (1: kidneys of control mice, 2: kidneys of transgenic mice, 3: H. lineatum first instar larvae). B. Blood was obtained from the eyeballs of the mice, and serum was obtained by centrifuging blood samples for 5 min at 1000 rpm, C3 expression was detected by western blot.
such as cyclosporine A, can efficiently suppress graft-rejection, but are limited by the toxicity, as they lead to chronic nephrotoxicity. Parasites, such as H. lineatum, evade immunological surveillance by downregulating host immunity. These parasites' immunosuppressive mechanisms may be a potential method of suppressing graft-rejection. More specifically, H. lineatum larvae secrete substances, such as HA, HB and HC, that weaken host defenses. Most previously studies have focused on the immunosuppressive mechanism of HA. For example, Baron et al. showed that prior to H. lineatum infection, cattle diminished antigen-induced peripheral blood mononuclear cell proliferation [12]. Our college demonstrated that HA reduces inflammation by cleaving complement component C3 in bovine, rats and humans [10]. Malassagne et al. found that HA prevented hyperacute rejection by degrading C3, and that guinea-pig hearts transplanted into HA-treated rats survived longer than those in controls [13]. However, there has been little research into HC. Indeed, HC is the most antigenic and can be detected first after infection [14]. Additionally, HC suppresses lymphocyte responses to mitogens and antigens during larval migration [15]. Our previous study demonstrated that HC can play immunosuppressive roles by cleaving C3 in vitro. C3 plays a vital role in pathogenesis; the antigen–antibody complex induces a C3-dependent cascade that leads to the formation of the membrane attack complex, which disrupts the integrity of the phospholipid bilayer, leading to graft failure. To examine the effect of HC in vivo, we constructed HC transgenic mice and demonstrated the cleavage effect of HC on C3 in vivo. Next, using the full MHC-mismatched mouse transplantation model, we demonstrated that HC overexpression was associated with prolonged graft survival and reduced organ dysfunction. T cell-mediated immune responses to grafted tissues are the major reason for failed organ transplantation. For example, activated CD8+ T cells are essential for graft-rejection [16]. Intriguingly, effector T cells, particularly CD4+ T cells, are both necessary and sufficient to mediate allograft rejection [17,18]. In the current study, we found that HC overexpression resulted in a diminishment of allograft-infiltrating effector T cells. Additionally, CD68+ monocytes/macrophage, which also play important roles in graft rejection, were also downregulated in HC
indicated that WT allografts incurred significant dysfunction at 2 weeks posttransplantation as reflected by a 2.5-fold elevates in serum creatinine compared to transgenic mice (Fig. 2B). 4.3. HC reduced the infiltration of inflammatory cells into renal allografts Parallel to the functional analyses, we also analyzed allograft kidney morphology. Histopathological examination showed consistent results with the kidney function analyses, including enhanced focal interstitial inflammatory cell infiltrates, and peritubular capillary dilation after transplantation in WT recipients, while HC overexpression significantly diminished these phenotypes (Fig. 3A). Furthermore, we also characterized the other graft-infiltrating inflammatory cells (CD4+, CD8+ T cells and CD68+ macrophages) by immunohistochemistry. There were many infiltrating CD4+, CD8+ T cells and CD68+ macrophages into WT allografts; however, numbers of these graft-infiltrating cells were significantly decreased in transgenic mice (Fig. 3B). 4.4. HC overexpression impaired chemokine and cytokine generation The differences in the numbers of graft-infiltrating inflammatory cells between WT and HC transgenic recipients prompted us to investigate whether there were any differences in chemokine gene expression between the two groups. We found that compared with the WT group, the chemokines CCL2, CCL5 and CXCL9 showed significantly reduced expression in the transgenic group (Fig. 4A-C). Furthermore, when we detected cytokine expression in recipients, we found that IL-2 and IFN-γ expression were dramatically reduced, while the inflammatory cytokines TNF-α and IL-6 showed a modest downregulation (Fig. 4D-G). 5. Discussion New immunosuppressive agents and advanced surgical techniques have been developed for organ transplantation; however, many issues remain with this method. For instance, immunosuppressive agents,
Fig. 2. Prolonged allograft survival in HC transgenic mice. (A) Survival was measured in all allografts (BABL/c wild-type or transgenic recipients receiving B6). Fifteen mice were tested in each group; the median survival for WT allografts was 21.5 d, which was significantly different than the HC transgenic group (63 d) (P < .001). (B) Serum creatinine levels were detected using ELISA to evaluate renal function at day 14 posttransplantation. Values are means ± SD; **P < .01. 47
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Fig. 3. Transgenic recipients had significantly reduced cellular infiltration compared with controls. (A) Representative hematoxylin and eosin-stained graft kidneys were harvested 14 days after grafting (scale bar: 50 μm). (B) WT and HC transgenic allografts were harvested 14 d after transplantation, and representative CD4+, CD8+ or CD68+ immunohistochemistry in allografts are shown.
mice. In summary, HC is immunosuppressive and inhibits cell-mediated transplant rejection. Our results suggest that HC plays important roles in kidney transplantation using HC transgenic mouse models. This suggests that HC may improve the survival of human graft recipients and provide new options for inhibiting immune rejection in humans. However, the inferred results between mice and humans have limitations, which require us to conduct more in-depth studies so that these results can be better applied to human clinical trials.
transgenic recipients. The recruitment and retention of effector T cells into transplanted organs is regulated in a complex manner by chemokine expression [19], and the concentrations of Th1 cytokines (such as IL-2 and IFN-γ) increase during acute rejection and are highly correlated with the severity of rejection [20]. Thus, we detected the expression of chemokines and Th1 cytokines and found that the reduced numbers of inflammatory cells coincided with a lack of chemokine and Th1 cytokine expression. Additionally, lower levels of TNF-α and IL-6 revealed inhibition of the graft rejection response in HC transgenic
Fig. 4. Transgenic mice showed diminished chemokine and cytokine expression after grafting. (A-C) Graft kidneys were harvested 16 d after grafting, and RT-qPCR was performed to detected CCL2, CCL5 and CXCL9 expression. (D-G) Blood was obtained by trans-orbital bleeding, and IL-2, IFN-γ, TNF-α and IL-6 concentrations were evaluated with ELISA. The results are representative of three independent experiments; *P < .05, **P < .01. 48
Transplant Immunology 51 (2018) 45–49
A. Hu et al.
Conflict of interest
261–267. [9] R. Panadero, V. Dacal, C. Lopez, L. Vazquez, S. Cienfuegos, P. Diaz, P. Morrondo, P. Diez-Banos, Immunomodulatory effect of Hypoderma lineatum antigens: in vitro effect on bovine lymphocyte proliferation and cytokine production, Parasite Immunol. 31 (2009) 72–77. [10] R.J. Chen, A.K. Hu, H.H. Yuan, Z.Z. Wang, D.J. Ji, L.L. Wu, T.Y. Zhang, Y.H. Zhu, W. Sun, X.R. Zhu, The immunosuppression mechanism of hypodermin a on complement, Parasitol. Int. 63 (2014) 392–396. [11] A.K. Hu, R.J. Chen, X.R. Zhu, J.H. Gu, Z.P. Liu, Immunosuppressive effect of Hypodermin C on Complement Component 3 in Vitro, Cell Biochem. Biophys. 72 (2015) 93–98. [12] R.W. Baron, J. Weintraub, Lymphocyte responsiveness in cattle previously infested and uninfested with Hypoderma lineatum (de Vill.) and H. bovis (L.) (Diptera: Oestridae), Vet. Parasitol. 24 (1987) 285–296. [13] B. Malassagne, J.M. Regimbeau, F. Taboit, F. Troalen, C. Chereau, N. Moire, J. Attal, F. Batteux, F. Conti, Y. Calmus, D. Houssin, C. Boulard, L.M. Houdebine, B. Weill, Hypodermin A, a new inhibitor of human complement for the prevention of xenogeneic hyperacute rejection, Xenotransplantation 10 (2003) 267–277. [14] R. Panadero, C. Lopez, D. Carballo, R. Casais, A. Paz, P. Morrondo, P. Diez-Banos, Assessment of a recombinant antigen versus natural hypodermin C for the serodiagnosis of hypodermosis in cattle, Parasitol. Res. 86 (2000) 67–68. [15] N. Silva, W.C. Smith, Inverse correlation of population similarity and introduction date for invasive ascidians, PLoS One 3 (2008) e2552. [16] N.M. Lerret, T. Li, J.J. Wang, H.K. Kang, S. Wang, X. Wang, C. Jie, Y.S. Kanwar, M.M. Abecassis, X. Luo, Z. Zhang, Recipient Myd88 deficiency promotes spontaneous resolution of kidney allograft rejection, J. Am. Soc. Nephrol. 26 (2015) 2753–2764. [17] B.A. Pietra, A. Wiseman, A. Bolwerk, M. Rizeq, R.G. Gill, CD4 T cell-mediated cardiac allograft rejection requires donor but not host MHC class II, J. Clin. Invest. 106 (2000) 1003–1010. [18] T.J. Grazia, B.A. Pietra, Z.A. Johnson, B.P. Kelly, R.J. Plenter, R.G. Gill, A two-step model of acute CD4 T-cell mediated cardiac allograft rejection, J. Immunol. 172 (2004) 7451–7458. [19] S.K. Bromley, T.R. Mempel, A.D. Luster, Orchestrating the orchestrators: chemokines in control of T cell traffic, Nat. Immunol. 9 (2008) 970–980. [20] F. Cottrez, S.D. Hurst, R.L. Coffman, H. Groux, T regulatory cells 1 inhibit a Th2specific response in vivo, J. Immunol. 165 (2000) 4848–4853.
The authors declare no financial or commercial conflict of interest. Acknowledgments All the experiments in this article were completed in Research Center for Neurobiology of Xuzhou Medical University, and thank the teachers for their support and help during the experiments. This work was funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) of 2018. References [1] B.J. Nankivell, S.I. Alexander, Rejection of the kidney allograft, N. Engl. J. Med. 363 (2010) 1451–1462. [2] E.M. Briganti, G.R. Russ, J.J. McNeil, R.C. Atkins, S.J. Chadban, Risk of renal allograft loss from recurrent glomerulonephritis, N. Engl. J. Med. 347 (2002) 103–109. [3] S. McDonald, G. Russ, S. Campbell, S. Chadban, Kidney transplant rejection in Australia and New Zealand: relationships between rejection and graft outcome, Am. J. Transplant. 7 (2007) 1201–1208. [4] J.A. Bradley, Overcoming the immunological barriers to xenotransplantation, Transplantation 68 (1999) 9–11. [5] B. Soin, C.M. Vial, P.J. Friend, Xenotransplantation, Br. J. Surg. 87 (2000) 138–148. [6] S. Lundberg, J. Lundahl, I. Gunnarsson, B. Sundelin, S.H. Jacobson, Soluble interleukin-2 receptor alfa predicts renal outcome in IgA nephropathy, Nephrol. Dial. Transplant. 27 (2012) 1916–1923. [7] R. Casais, J.M. Martin Alonso, J.A. Boga, F. Parra, Hypoderma lineatum: expression of enzymatically active hypodermin C in Escherichia coli and its use for the immunodiagnosis of hypodermosis, Exp. Parasitol. 90 (1998) 14–19. [8] A. Lecroisey, N.T. Tong, B. Keil, Hypodermin B, a trypsin-related enzyme from the insect Hypoderma lineatum. Comparison with hypodermin a and Hypoderma collagenase, two serine proteinases from the same source, Eur. J. Biochem. 134 (1983)
49