Hypoglycemic mechanism of a novel proteoglycan, extracted from Ganoderma lucidum, in hepatocytes

Author’s Accepted Manuscript Hypoglycemic mechanism of a novel proteoglycan, extracted from Ganoderma lucidum, in hepatocytes Zhou Yang, Congheng Chen, Juan Zhao, Weijie Xu, Yanming He, Hongjie Yang, Ping Zhou www.elsevier.com/locate/ejphar

PII: DOI: Reference:

S0014-2999(17)30815-4 https://doi.org/10.1016/j.ejphar.2017.12.020 EJP71567

To appear in: European Journal of Pharmacology Received date: 10 September 2017 Revised date: 4 December 2017 Accepted date: 8 December 2017 Cite this article as: Zhou Yang, Congheng Chen, Juan Zhao, Weijie Xu, Yanming He, Hongjie Yang and Ping Zhou, Hypoglycemic mechanism of a novel proteoglycan, extracted from Ganoderma lucidum, in hepatocytes, European Journal of Pharmacology, https://doi.org/10.1016/j.ejphar.2017.12.020 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Hypoglycemic mechanism of a novel proteoglycan, extracted from Ganoderma lucidum, in hepatocytes Zhou Yanga, Congheng Chena, Juan Zhaoa, Weijie Xua, Yanming Heb, Hongjie Yangb, Ping Zhoua,* a. State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science, Fudan University, Shanghai 200433, P. R. China.

b. Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200437, P. R. China.

*Corresponding author: Tel/Fax: (+86) 21-55664038, E-mail: [email protected].

Abstract Protein tyrosine phosphatase 1 B (PTP1B) is one of main causes involved in type 2 diabetes, it dephosphorylates insulin receptor substrate (IRS) and dysregulates insulin signaling pathway, thus inducing insulin resistance. Our previous work first reported that FYGL, a neutral hyperbranched proteoglycan ingredient extracted from Ganoderma lucidum, has hypoglycemic activity in vivo and inhibitory potency on PTP1B in vitro, but the underlying mechanism was still unclear. In this study, we sought to investigate effects of FYGL on insulin signaling pathway involved with PTP1B as the targeting point in hepatocytes. We found that FYGL inhibited overexpression of PTP1B in liver tissues of ob/ob mice and HepG2 cells, significantly improved the phosphorylation of IRS1 on tyrosine residues, activated

phosphatidylinositol-3 kinase (PI3K)/protein kinase B (Akt) cascades and increased phosphorylation of glycogen synthesis kinase-3β (GSK3β), finally enhanced insulin-stimulated glycogen synthesis in HepG2 cells and decreased blood glucose in insulin resistance model mice. Our study clearly illustrated the hypoglycemic mechanism of a novel proteoglycan possibly used in type 2 diabetes management in vivo. Key words: PTP1B inhibitor, proteoglycan, hepatocytes, Ganoderma lucidum, GSK3β. 1. Introduction Type 2 diabetes is a chronic metabolism disorder disease characterizing high blood glucose. As a main metabolism organ in mammal, liver tissue plays an important role in glycogen synthesis and glucose utilization. Glycogen synthesis is directly modulated by glycogen synthesis kinase-3 (GSK3). GSK3 was originally isolated from rabbit skeletal muscle (Embi et al., 1980), and has two isoforms, GSK3α and GSK3β, and the latter is a key enzyme in regulation of hepatic glucose metabolism and glycogen synthesis (Hughes et al., 1992; Welsh and Proud, 1993). GSK3β can phosphorylate glycogen synthetase (GS) to make it inactive, thus negatively modulating the process of glycogen synthesis. In insulin signaling pathway, stimulation of insulin phosphorylates insulin receptor substrate-1 (IRS1), and activates phosphatidylinositol-3 kinase (PI3K)/protein kinase B (Akt) cascades. The phosphorylated Akt can inhibit activity of GSK3β by phosphorylating GSK3β on Ser9 (Sutherland et al., 1993; Kanno et al., 2016).

Type 2 diabetes is closely related to insulin resistance. A lot of studies have demonstrated that overexpression of protein tyrosine phosphatase 1 B (PTP1B) in vivo can lead insulin resistance by dephosphorylating insulin receptor (InR) and insulin receptor substrate (IRS), thus inactivate the whole insulin signaling (Johnson et al., 2002). Therefore, PTP1B has been regarded as an ideal therapeutic target in cure of type 2 diabetes and obesity in recent decades (Feldhammer et al., 2013). In the cascades of glycogen synthesis, PTP1B can dephosphorylate IRS1 on tyrosine residues and down-regulate phosphorylation of Akt, consequently decreasing phosphorylation of GSK3β and inhibiting glycogen synthesis (Johnson et al., 2002). Therefore, it is necessary to find effective PTP1B inhibitors to positively regulate glycogen synthesis and manage type 2 diabetes, while most of present small molecule PTP1B inhibitors have deficiency in cell permeability and oral bioavailability (Tamrakar et al., 2014; Combs, 2010). In our previous study, a novel hyperbranched proteoglycan named FYGL which was extracted from Ganoderma lucidum has good hypoglycemic effect in vivo and inhibitory potency on PTP1B in vitro (Teng et al., 2011; Pan et al., 2015). And we also demonstrated that FYGL can be absorbed by HepG2 cells (Yang et al., 2017). For understanding the action model of FYGL in detail, in the present work, we sought to investigate the underlying mechanism of FYGL on PTP1B-involved insulin signaling pathway both in vivo and in vitro in hepatocytes which engage into glycogen synthesis. Our work successfully revealed the effect of FYGL on glycogen synthesis

through the insulin signaling pathway from IRS1 to GSK3β, which is an alternative pathway in addition to glucose uptake and transportation. 2. Materials and methods 2.1. Materials. FYGL was extracted from Ganoderma lucidum in our laboratory according to our previous work (7). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), opti-minimal essential medium (opti-MEM) were purchased from Gibco Co. Ltd. (USA). Cell counting kit-8 (CCK-8) was purchased from Dojindo Co. Ltd. (Shanghai, China). Adiponectin ELISA kit was bought from Senbeijia Co. Ltd. (Nanjing, China). BCA (bicinchoninic acid) kit, phosphate buffer saline (PBS), 4% paraformaldehyde, penicillin and streptomycin were acquired from Sangon Co. Ltd. (Shanghai, China). Trizol, SYBR green I and glycogen stain kit were provided by Yeasen Co. Ltd. (Shanghai, China). Anthrone and sulfuric acid were bought from Sinopharm chemical reagent Co. Ltd. (Shanghai, China). RIPA lysis buffer, Bradford reagent and lipofectamine 6000 were bought from Beyotime Co. Ltd. (Shanghai, China). HepG2 cells were provided by Fuxiang Co. Ltd. (Shanghai, China). Ultrapure water was home-made. 2.2. Animal trials. All animal experiments were approved by the Ethics of Animal Experiments Committee of Medical College, Fudan University. 10 male eight-week-old wild type (WT) C57BL/6 mice and 50 male eight-week-old obese C57BL/6 (ob/ob) mice (from Chinese Academy of Sciences Shanghai Institute of Materia Medica) were housed at 22  2˚C and 45–75% relative humidity with a 12 h light/dark cycle. 10 WT mice and model group were treated with saline. 50 ob/ob

mice were randomly divided into 5 groups with 10 mice in each group, and fed with saline, FYGL (150, 300, 400 mg/kg) and metformin (250 mg/kg) once a day, respectively. Body weight was tested once a week. 4 weeks later, glucose tolerance test was done, after that all of mice were killed and liver tissues were homogenized, glycogen content was measured by anthrone reagent and calibrated by Bradford reagent. Meanwhile, serum was isolated, lipid and adiponectin content was tested and calibrated by Bradford reagent. 2.3. Histological analysis of liver, adipose and pancreas tissues. The liver, white adipose and pancreas tissues in mice were extracted and fixed with 4% paraformaldehyde as soon as possible after mice were killed. The liver and pancreas tissues were embedded in paraffin and cut into 5 μm-thick slices, and then stained with haematoxylin-eosin (H&E). Meanwhile, white adipose tissues were also cut by freezing microtome for H&E staining. Finally the slices were observed by microscope (37XB, Yuguang, Shanghai, China). 2.4. CCK-8 test. HepG2 cells were cultured in DMEM with 10% FBS and 1% penicillin-streptomycin at 37 °C in 5% CO2 atmosphere. The cells were transferred into 96-well plates with a density of 5 × 103 – 1 × 104 cells/well, then FYGL at different concentrations in DMEM with 2% FBS was added into wells and incubated for 24 h at 37 °C, solution including FYGL was removed and CCK-8 was added and cultured for another 0.5 h. Each sample was replicated six wells. The optical density (OD) was measured at 450 nm by microplate reader and the cell viability was calculated finally.

2.5. Transfection with PTP1B plasmid in HepG2 cells. HepG2 cells were seeded into 6-well plates with a density of 2.5 × 105 – 5 × 105 cells/well for 12 to 16 h. 2.5 μg PTP1B plasmid (synthesized by Xinjia Bio. Co) and 5 μl lipofectamine 6000 were premixed in opti-MEM, and then the mixture was added into the wells. 6 h later the opti-MEM was removed and the cells were washed with PBS three times. FYGL at the given concentrations in DMEM with 2% FBS was added into the wells and incubated for 24 h at 37 °C, followed by stimulation of 100 nM insulin for 10 min. 2.6. Glycogen synthesis assay by periodic acid-Schiff (PAS) method. Briefly, HepG2 cells were fixed and incubated with periodic acid for 10 min at room temperature, and then washed with PBS for three times. Afterwards, the cells were stained with Schiff reagent for 25 min, and then washed with distilled water three times, finally mounted on the glass slide for observation by confocal laser scanning microscope. The whole process was performed away from light. 2.7. RNA isolation and real time PCR analysis. RNA was released from HepG2 cells using trizol agent, and then reversely transcribed to complementary DNA (cDNA). SYBR Green I including Taq enzyme and the primers of β-actin and PTP1B (the primer sequences are shown in Table 1, synthesized by Sangon Co. Shanghai) were mixed with cDNA, proliferated on RT-PCR instrument (Bio-Rad, Germany), and then the melt and proliferation curves were analyzed. The relative expression of mRNA was determined by Eq. 1 (Erlich et al., 1988): CmRNA = 2-Δ(ΔCt)

Eq. 1

Where ΔCt is the difference of cycle time between target gene mRNA and β-actin mRNA, and Δ(ΔCt) is the difference of ΔCt between target sample and normalized sample. 2.8. Protein extraction and Western blot. Liver tissues of mice and HepG2 cells were lysed in RIPA lysis buffer and clarified by centrifugation (12,000 × g, 10 min, 4 °C). The lysates were separated by 8% SDS-PAGE and transferred to polyvinylidene fluoride membrane, and then immunoblotted with following primary antibodies: rabbit monoclonal anti-IRS1 antibody, anti-PI3K antibody, anti-Akt antibody, anti-Akt (phospho Ser473) antibody, anti-AMPK antibody, anti-AMPK (phospho Thr172) antibody and anti-GAPDH antibody (all of them are from Cell Signaling Technology, USA), rabbit monoclonal anti-PTP1B antibody, anti-IRS1 (phospho Tyr612) antibody and anti-GSK3β antibody (from ABCAM, UK), and then incubated with secondary goat anti-rabbit antibody. Bands were visualized with enhanced chemiluminescence solution (ECL, Biotanon) and detected by Image Lab camera (Bio-Rad, Germany), and then quantified by densitometry scanning with Image J software. 2.9. Statistical analysis. All data are presented as mean ± S.E.M. One-way ANOVA test was performed to analyze the statistical significance between two groups. A difference is considered to be statistically significant when the P value < 0.05.

3. Results

3.1. General signs of animals treated by FYGL. From Fig. 1A, blood glucose decreased after four weeks treatment with FYGL and metformin in ob/ob mice, and down to the level of WT mice in 2 h in glucose tolerance test. Compared with WT mice, the body weight of ob/ob mice was much higher, shown in Fig. 1B. Although the body weight of ob/ob mice treated with 150 mg/kg FYGL was decreased not significantly, it was done obviously with relatively high dose (300, 400 mg/kg) of FYGL after three weeks, similarly to the value with 250 mg/kg metformin treatment. And the serum lipid level was also reduced after treatment with FYGL four weeks as shown in Table 2. 3.2. Increase of hepatic glycogen by FYGL in vivo. From Fig. 2, hepatic glycogen content was decreased in ob/ob mice compared with that in WT mice. FYGL orally administrated significantly increased hepatic glycogen level in ob/ob mice, similar to the result of metformin. 3.3. Effects of FYGL on the pathomorphism of liver, adipose and pancreas tissues in ob/ob mice. As shown in Fig. 3A, lipid droplets (white) were accumulated in liver tissues more in ob/ob mice than in WT group, while they were decreased in a dose-dependent manner after FYGL treatment. Adipocyte hypertrophy (white) was also observed in ob/ob mice, but the size of adipocytes significantly diminished after FYGL treatment (Fig. 3B). From Fig. 3C, pancreatic islets (blue and pink) in ob/ob mice exhibited large and encapsulated by lipids (white), while they were recovered to normal after FYGL or metformin treatment. The results indicated that FYGL can

ameliorate fatty liver caused by insulin resistance and protect pancreatic islets against pathological hyperplasia. 3.4. Increase of adiponectin content by FYGL in ob/ob mice. In the light of the evidence that FYGL can decrease lipids in serum and liver tissues and reduce adipocyte size, we measured serum adiponectin content, an adipokine related to insulin sensitivity. As can be seen in Table 2, adiponectin content was lower in ob/ob mice than that in WT group, while FYGL or metformin orally administrated significantly increased adiponectin level. 3.5. Effects of FYGL on insulin signaling pathway in vivo. Fig. 4A shows Western blot bands of PTP1B-involved proteins in insulin signaling pathway regulated by FYGL. Overexpression of PTP1B was found in hepatic tissues of ob/ob mice, FYGL successfully inhibited the overexpression of PTP1B, consequently, impacting on the downstream pathway. As shown in Fig. 4B and 4C, FYGL remarkably enhanced the phosphorylation of IRS1 on Tyr612, activated PI3K/Akt cascades and up-regulated the phosphorylation of AMPKα on Thr172, finally promoted the phosphorylation of GSK3β on Ser9 as well as inhibited expression of GSK3β. 3.6. Safety of FYGL on HepG2 cells. Fig. 5 shows the viability of HepG2 cells influenced by FYGL, which demonstrated that FYGL was safe when the concentration was lower than 200 μg/ml. Even if the concentration of FYGL was higher than 300 μg/ml, the cell viability was still maintained more than 85% compared with that of control group, indicating that FYGL was safe for HepG2 cells in a wide concentration range.

3.7. Effect of FYGL on glycogen synthesis in vitro. Fig. 6 shows the glycogen images stained in the red by PAS in HepG2 cells. In PTP1B-transfected cells, almost no glycogen were synthesized (Fig. 6B) compared with that in normal cells (Fig. 6A), whereas with addition of FYGL from 25 to 150 μg/ml, the synthesized glycogen were increased considerably in a dose-dependent manner (from Fig. 6C to 6F), demonstrating that FYGL can promote glycogen synthesis in HepG2 cells. Therefore, it is meaningful to investigate the pathway involved with glycogen synthesis in HepG2 cells influenced by FYGL. 3.8. Effects of FYGL on insulin signaling pathway in vitro by RT-PCR and Western blot method. As shown in Table 3, the expression of PTP1B mRNA in transfected cells (control group) was nearly 54-fold higher than that in normal cells, indicating that PTP1B mRNA was overexpressed in transfected cells. FYGL significantly decreased the expression of PTP1B mRNA in a dose-dependent manner until to the saturation when concentration of FYGL was higher than 100 μg/ml. Fig. 7 shows the proteins in IRS1/PI3K/Akt/AMPK/GSK3β pathway were influenced by FYGL under insulin stimulation. In agreement with above RT-PCR results, overexpression of PTP1B existed in PTP1B-transfected cells, and FYGL markedly down-regulated PTP1B expression (Fig. 7B). From Fig. 7C, the phosphorylation of IRS1 on Tyr612 was significantly inhibited in PTP1B+ cells, but recovered by FYGL treatment in a dose-dependent manner until to the saturation when the concentration of FYGL was higher than 100 μg/ml. Similarly, as the downstream protein of IRS1, the expression of PI3K was also decreased by overexpression of

PTP1B, but increased by addition of FYGL in the same trend as IRS1 (Fig. 7D). As shown in Fig. 7E, Akt can be rapidly phosphorylated under the stimulation of insulin, but this process was significantly inhibited in PTP1B+ cells. Herein FYGL remarkably up-regulated the phosphorylation of Akt on Ser473, and the phosphorylation reached normal level when the concentration of FYGL was 150 μg/ml. In AMPK cascade, the phosphorylation of AMPKα on Thr172 was also inhibited by overexpression of PTP1B, while enhanced by FYGL until to the saturation when the concentration of FYGL was higher than 50 μg/ml (Fig. 7F). Both expression and phosphorylation of GSK3β are directly related to the glycogen synthesis. As can be seen in Fig. 7A, the expression of GSK3β was increased in PTP1B+ cells and decreased by FYGL, while the phosphorylation of GSK3β on Ser9 showed the reverse trend. From Fig. 7G, the phosphorylation level of GSK3β on Ser9 was quite low in PTP1B+ cells, but improved in a great extent by FYGL, and reached the saturation when the concentration of FYGL was higher than 100 μg/ml.

4. Discussion As a well-known traditional Chinese medicine, Ganoderma lucidum has been reported to have anti-diabetes or “Xiao Ke” effect for thousand years (Hikino et al., 1985). The effective components extracted from Ganoderma lucidum including polysaccharide, triterpenoid and protein have been reported (Choi et al., 2014). Although various mechanisms of hypoglycemic action of those components involved in anti-diabetes have been investigated (Ma et al., 2015; Hsu et al., 2003), they are

still quite unclear. Our previous work firstly extracted and isolated the proteoglycan named FYGL from Ganoderma lucidum. FYGL is composed of 17 amino acid residues and 4 monosaccharide residues (Pan et al., 2015). The hydrophobic amino acids including leucine, isoleucine and phenylalanine in FYGL may play an important role for cell permeability. The four monosaccharide residues are arabinose, galactose, rhamnose and glucose with a ratio of 0.08 : 0.21 : 0.24 : 0.47, they are all hydrophilic, and also benefic for the cell permeability. In this work, FYGL was found to promote glycogen synthesis and inhibit expression of GSK3β in liver tissues of ob/ob mice and HepG2 cells, which possibly resulted from FYGL positively modulating IRS1/PI3K/Akt/AMPK/GSK3β cascades. Similarly, Ma et al extracted a polysaccharide from Grifola frondosa (GFP), consisting of arabinose, galactose, glucose, rhamnose, demonstrating that the polysaccharide can relieve insulin resistance by enhancing glycogen content in HepG2 cells (Ma et al., 2014). IRS1, first isolated from rat liver cells, is located in a wide range of mammalian tissues (Sun et al., 1991). Insulin stimulates peripheral tissue cells and binds to insulin receptor (InR), then phosphorylates IRS1 and activates insulin signaling pathway (Sun et al., 1992; Hellerharrison et al., 1995). Overexpression of PTP1B is a key factor to turn off insulin signaling pathway and always found in hepatic tissues suffering from type 2 diabetes (Taghibiglou et al., 2002), which was also demonstrated in liver tissues of ob/ob mice herein. Insulin sensitivity is enhanced in PTP1B knockout mice along with the increasing phosphorylation of IRS1 (Elchebly et al., 1999). Our work demonstrated that FYGL can inhibit overexpression of PTP1B

and promote phosphorylation of IRS1 on Tyr612 in skeletal muscle tissues of ob/ob mice and L6 cells (data unpublished), and interestingly, also in hepatic tissues of ob/ob mice and HepG2 cells. Wu et al reported that Astragalus polysaccharide (APS) can decrease expression of PTP1B and increase phosphorylation of IRS1 on tyrosine residues in rat muscle tissues, but has no significant function in the hepatic tissues (Wu et al., 2005). PI3K plays an important role in control of glycogen synthase activity. PI3K inhibitors can block glycogen synthesis in 3T3-L1 adipocytes (Shepherd et al., 1995) and activate insulin-stimulated GSK3β in L6 myoblasts (Cross et al., 1994). Akt is regulated by PI3K through interaction with phosphorylated products of PI3K in its pleckstrin homology (PH) domain, and activated by phosphorylating on serine/threonine residues (Kohn et al., 1995; Burgering and Coffer, 1995). It has been found that Akt can phosphorylate and inhibit GSK3 in vitro (Cross et al., 1995), making insulin-stimulated GSK3 inactive, thus leading to the glycogen synthesis increasing in L6 myotubes (Ueki et al., 1998). As a modulator in multiple signaling pathways, AMPK in liver controls glucose homeostasis mainly through inhibition of gluconeogenic gene expression and hepatic glucose production (Zhang et al., 2009). AMPK can inhibit GSK3β through phosphorylating on Ser9 in hepatocytes (Park et al., 2012; Steinberg and Kemp, 2009). It has been reported that the phosphorylation levels of both Akt and AMPK are low in db/db diabetes mice, leading to the phosphorylation of GSK3β decreasing (Zheng et al., 2015). In the current study, PI3K/Akt/AMPKα cascades were inactivated in liver

tissues of ob/ob mice and overexpressed-PTP1B HepG2 cells, leading to the increase of GSK3β expression and the decrease of phosphorylation of GSK3β, thus the synthesized glycogen content was reduced. However, FYGL up-regulated expression of PI3K and phosphorylation of Akt and AMPKα, consequently inhibited expression of GSK3β and increased phosphorylation of GSK3β, finally enhanced glycogen synthesis in hepatic tissues of ob/ob mice and HepG2 cells. The results convincingly explained our above data that FYGL or metformin can increase hepatic glycogen content in ob/ob mice, while metformin can activate AMPK via suppressing hepatic glucose output (Zhang et al., 2009). It was reported that salidroside, an extract from Rhodiola rosea, can also enhance the phosphorylation of Akt and AMPK, therefore, increasing the phosphorylation of GSK3β as well as decreasing the expression of GSK3β (Zheng et al., 2015). The lipids in skeletal muscle and liver are accumulated significantly in insulin resistance models, associated with adipocyte hypertrophy (Trajkovski et al., 2011; Ye et al., 2001; Zheng et al., 2015). Reduction of lipid content in these peripheral tissues may be a key targeting point in improvement of insulin sensitivity. Adiponectin is released by adipose tissue and can influence glucose metabolism and insulin sensitivity (Karbowska and Kochan, 2006). In the current study, FYGL protected liver tissues against damage from diabetes and obesity, and improved insulin sensitivity by enhancing adiponectin level, associated with lowering adipocyte hypertrophy, thus up-regulating phosphorylation of Akt in insulin signaling pathway (Trajkovski et al., 2011). It was reported that the conjugated linoleic acid can also increase adiponectin

and decrease adipocyte size in fa/fa zucker rats, by inhibiting adipocyte differentiation (Noto et al., 2007). In addition, FYGL also protected pancreatic islets against severe damage in ob/ob mice, similar to salidroside as well (Zheng et al., 2015; Cai et al., 2017). Conclusively, FYGL was first isolated and demonstrated to be effective in hepatocytes. PTP1B was found to be the key targeting point in liver tissues suffering from insulin resistance. In this study, FYGL significantly inhibited the overexpression of PTP1B and protected liver tissues in insulin resistance animal models. Moreover, FYGL promoted glycogen synthesis through down-regulating expression of GSK3β and up-regulating phosphorylation of GSK3β on Ser9, thus ameliorating PTP1B involved IRS1/PI3K/Akt/AMPKα/GSK3β pathway. The results in liver tissues were perfectly consistent with those in HepG2 cells. Our work successfully provides an alternative mechanism of FYGL on insulin signaling pathway in addition to glucose uptake and transportation, and theoretical basis of FYGL to be a potential therapy for type 2 diabetes. Acknowledgments This work was supported by the Natural Science Foundation of China (Nos. 21374022 and 81374032), the Scientific Program of Shanghai Municipal Public Health Bureau (Nos. 2010231), Shanghai Municipal Science and Technology Commission of Chinese medicine modernization project (Nos. 11DZ1971802). Author contributions

Z. Y., W. X. and J. Z. performed the experiments. Z. Y. and Y. H. analyzed the data. Z. Y. and P. Z. designed the experiments. Z. Y., C. C. and P. Z. wrote the manuscript. H. Y. and P. Z. provided the funding. Conflict of interest The authors claim that the researchers in this study have no conflict of interest. References Burgering, B.M.T., Coffer, P.J., 1995. Protein-kinase-b (c-Akt) in phosphatidylinositol-3-oh inase signal-transduction. Nature 376, 599-602. Cai, L., Li, Y., Zhang, Q., Sun, H., Yan, X., Hua, T., Zhu, Q., Xu, H., Fu, H., 2017. Salidroside protects rat liver against ischemia/reperfusion injury by regulating the GSK-3beta/Nrf2-dependent antioxidant response and mitochondrial permeability transition. Eur J Pharmacol 806, 32-42. Combs, A.P., 2010. Recent advances in the discovery of competitive protein tyrosine phosphatase 1B inhibitors for the treatment of diabetes, obesity, and cancer. J. Med. Chem. 53, 2333-2344. Cross, D.A.E., Alessi, D.R., Cohen, P., Andjelkovich, M., Hemmings, B.A., 1995. Inhibition of glycogen-synthase kinase-3 by insulin-mediated by protein-kinase-B. Nature 378, 785-789. Cross, D.A.E., Alessi, D.R., Vandenheede, J.R., McDowell, H.E., Hundal, H.S., Cohen, P., 1994. The inhibition of glycogen-synthase kinase-3 by insulin or insulin-like growth-factor-1 in the rat skeletal-muscle cell-line-L6 is blocked by wortmannin, but not by rapamycin - evidence that wortmannin blocks activation of

the mitogen-activated protein-kinase pathway in L6-cells between ras and raf. Biochemical J 303, 21-26. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A.L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C.C., Ramachandran, C., Gresser, M.J., Tremblay, M.L., Kennedy, B.P., 1999. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544-1548. Embi, N., Rylatt, D.B., Cohen, P., 1980. Glycogen-synthase kinase-3 from rabbit skeletal-muscle - separation from cyclic-AMP-dependent protein-kinase and phosphorylase-kinase. Eur. J. Biochem. 107, 519-527. Erlich, H.A., Gelfand, D.H., Saiki, R.K., 1988. Specific DNA amplification. Nature 331, 461-462. Feldhammer, M., Uetani, N., Miranda-Saavedra, D., Tremblay, M.L., 2013. PTP1B: A simple enzyme for a complex world. Crit. Rev. Biochem. Mol. Biol. 48, 430-445. Hellerharrison, R.A., Morin, M., Czech, M.P., 1995. Insulin regulation of membrane-associated insulin-receptor substrate-1. J Biol Chem 270, 24442-24450. Hikino, H., Konno, C., Mirin, Y., Hayashi, T., 1985. Antidiabetes drugs .9. isolation and hypoglycemic activity of ganoderans-a and ganoderans-b, glycans of ganoderma-lucidum fruit bodies. Planta Med. 51, 339-340. Hsu, M.J., Lee, S.S., Lee, S.T., Lin, W.W., 2003. Signaling mechanisms of enhanced neutrophil phagocytosis and chemotaxis by the polysaccharide purified from Ganoderma lucidum. Br J Pharmacol 139, 289-298.

Hughes, K., Ramakrishna, S., Benjamin, W.B., Woodgett, J.R., 1992. Identification of multifunctional ATP-citrate lyase kinase as the alpha-isoform of glycogen-synthase kinase-3. Biochem J 288, 309-314. Johnson, T.O., Ermolieff, J., Jirousek, M.R., 2002. Protein tyrosine phosphatase 1B inhibitors for diabetes. Nat Rev Drug Discov 1, 696-709. Kanno, T., Tsuchiya, A., Tanaka, A., Nishizaki, T., 2016. Combination of PKCepsilon Activation and PTP1B Inhibition Effectively Suppresses Abeta-Induced GSK-3beta Activation and Tau Phosphorylation. Mol Neurobiol 53, 4787-4797. Karbowska, J., Kochan, Z., 2006. Role of adiponectin in the regulation of carbohydrate and lipid metabolism. J. Physiol. Pharmacol. 57, 103-113. Kohn, A.D., Kovacina, K.S., Roth, R.A., 1995. Insulin stimulates the kinase activity of RAC-PK, a pleckstrin homology domain-containing Ser/Thr kinase. EMBO J 14, 4288-4295. Ma, H.T., Hsieh, J.F., Chen, S.T., 2015. Anti-diabetic effects of Ganoderma lucidum. Phytochemistry 114, 109-113. Ma, X., Zhou, F., Chen, Y., Zhang, Y., Hou, L., Cao, X., Wang, C., 2014. A polysaccharide from Grifola frondosa relieves insulin resistance of HepG2 cell by Akt-GSK-3 pathway. Glycoconjugate J 31, 355-363. Noto, A., Zahradka, P., Yurkova, N., Xie, X., Truong, H., Nitschmann, E., Ogborn, M.R., Taylor, C.G., 2007. Dietary conjugated linoleic acid decreases adipocyte size and favorably modifies adipokine status and insulin sensitivity in obese, insulin-resistant rats. Metab., Clin. Exp. 56, 1601-1611.

Pan, D., Wang, L.Q., Chen, C.H., Hu, B.W., Zhou, P., 2015. Isolation and characterization of a hyperbranched proteoglycan from Ganoderma lucidum for anti-diabetes. Carbohydr Polym 117, 106-114. Park, H., Kam, T.I., Kim, Y., Choi, H., Gwon, Y., Kim, C., Koh, J.Y., Jung, Y.K., 2012. Neuropathogenic role of adenylate kinase-1 in Abeta-mediated tau phosphorylation via AMPK and GSK3beta. Human molecular genetics 21, 2725-2737. Shepherd, P.R., Nave, B.T., Siddle, K., 1995. Insulin stimulation of glycogen-synthesis and glycogen-synthase activity is blocked by wortmannin and rapamycin in 3T3-L1 adipocytes - evidence for the involvement of phosphoinositide 3-kinase and P70 ribosomal protein-S6 kinase. Biochemical J 305, 25-28. Steinberg, G.R., Kemp, B.E., 2009. AMPK in health and disease. Physiol Rev 89, 1025-1078. Sun, X.J., Miralpeix, M., Myers, M.G., Glasheen, E.M., Backer, J.M., Kahn, C.R., White, M.F., 1992. Expression and function of IRS-1 in insulin signal transmission. J Biol Chem 267, 22662-22672. Sun, X.J., Rothenberg, P., Kahn, C.R., Backer, J.M., Araki, E., Wilden, P.A., Cahill, D.A., Goldstein, B.J., White, M.F., 1991. Structure of the insulin-receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352, 73-77. Sutherland, C., Leighton, I.A., Cohen, P., 1993. Inactivation of glycogen-synthase kinase-3-beta by phosphorylation - new kinase connections in insulin and growth-factor signaling. Biochem J 296, 15-19.

Taghibiglou, C., Rashid-Kolvear, F., Van Iderstine, S.C., Le-Tien, H., Fantus, I.G., Lewis, G.F., Adeli, K., 2002. Hepatic very low density lipoprotein-ApoB overproduction is associated with attenuated hepatic insulin signaling and overexpression of protein-tyrosine phosphatase 1B in a fructose-fed hamster model of insulin resistance. J Biol Chem 277, 793-803. Tamrakar, A.K., Maurya, C.K., Rai, A.K., 2014. PTP1B inhibitors for type 2 diabetes treatment: a patent review (2011 - 2014). Expert Opin Ther Pat 24, 1101-1115. Teng, B.S., Wang, C.D., Yang, H.J., Wu, J.S., Zhang, D., Zheng, M., Fan, Z.H., Pan, D., Zhou, P., 2011. A protein tyrosine phosphatase 1B activity inhibitor from the fruiting bodies of Ganoderma lucidum (Fr.) Karst and its hypoglycemic potency on streptozotocin-induced type 2 diabetic mice. J Agric Food Chem 59, 6492-6500. Trajkovski, M., Hausser, J., Soutschek, J., Bhat, B., Akin, A., Zavolan, M., Heim, M.H., Stoffel, M., 2011. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature 474, 649-653. Ueki, K., Yamamoto-Honda, R., Kaburagi, Y., Yamauchi, T., Tobe, K., Burgering, B.M.T., Coffer, P.J., Komuro, I., Akanuma, Y., Yazaki, Y., Kadowaki, T., 1998. Potential role of protein kinase B in insulin-induced glucose transport, glycogen synthesis, and protein synthesis. J Biol Chem 273, 5315-5322. Welsh, G.I., Proud, C.G., 1993. Glycogen-synthase kinase-3 is rapidly inactivated in response to insulin and phosphorylates eukaryotic initiation-factor elF-2B. Biochem J 294, 625-629.

Wu, Y., Ou-Yang, J.P., Wu, K., Wang, Y., Zhou, Y.F., Wen, C.Y., 2005. Hypoglycemic effect of Astragalus polysaccharide and its effect on PTP1B. Acta Pharmacol Sin 26, 345-352. Yang, Z., Wu, F., Yang, H.J., Zhou, P., 2017. Endocytosis mechanism of a novel proteoglycan, extracted from Ganoderma lucidum, in HepG2 cells. RSC Adv. 7, 41779-41780. Ye, J.M., Doyle, P.J., Iglesias, M.A., Watson, D.G., Cooney, G.J., Kraegen, E.W., 2001. Peroxisome proliferator-activated receptor (PPAR)-alpha activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats - Comparison with PPAR-gamma activation. Diabetes 50, 411-417. Zhang, B.B., Zhou, G., Li, C., 2009. AMPK: an emerging drug target for diabetes and the metabolic syndrome. Cell metabolism 9, 407-416. Zheng, T., Yang, X., Wu, D., Xing, S., Bian, F., Li, W., Chi, J., Bai, X., Wu, G., Chen, X., Zhang, Y., Jin, S., 2015. Salidroside ameliorates insulin resistance through activation of a mitochondria-associated AMPK/PI3K/Akt/GSK3beta pathway. Br J Pharmacol 172, 3284-3301.

Table 1. The primer sequences Gene

Forward primer (5’to 3’)

Reverse primer (5’to 3’)

Human β-actin

TGACGTGGACATCCGCAAAG

CTGGAAGGTGGACAGCGAGG

Human PTP1B

AGCCAGTGACTTCCCATGTAG

TGTTGAGCATGACGACACCC

Table 2. Level of serum adiponectin in mice after 4 weeks parameter

Lipid (pg/ml)

Adiponectin (pg/ml)

WT

346.94 ± 22.87 a

493 ± 86

ob/ob

412.82 ± 5.16

440 ± 140 a

ob/ob + FYGL (150 mg/kg)

393.32 ± 0.59 a

438 ± 64

ob/ob + FYGL (300 mg/kg)

389.52 ± 8.37 a

583 ± 82 b

ob/ob + FYGL (400 mg/kg)

363.59 ± 0.36 b

610 ± 145 a

ob/ob + Met (250 mg/kg)

362.17 ± 22.21 a

544 ± 94 a

Data are expressed as means ± S.E.M. (n = 5). a, P < 0.05, b, P < 0.01 versus ob/ob mice group.

Table 3. Relative expression of PTP1B in HepG2 cell samples Transfected with

Relative expression of FYGL (μg/ml)

PTP1B

PTP1B mRNA

-

Normal

1.00 ± 0.08

+

Control

54 ± 13 b

+

25

13 ± 1 a, b

+

50

1.0 ± 0.1 a, c

+

100

0.20 ± 0.05 a, c

+

150

0.4 ± 0.1 a

The expression of PTP1B mRNA in the sample not transfected with PTP1B is normalized to 1.0. The group of HepG2 cells transfected with PTP1B and absent of FYGL is regarded as control. Data are expressed as mean ± S.E.M. (n = 5). a, P < 0.01 versus control group, and b, P < 0.01, c, P < 0.001 versus the former group.

Figure Legends Fig. 1. Glucose tolerance test (A) and body weight (B) of WT mice and ob/ob mice treated with FYGL and metformin (Met), respectively. Data are presented as means ± S.E.M. (n ≥ 6). * P < 0.05, ** P < 0.01, *** P < 0.001 versus ob/ob mice group. Fig. 2. Relative hepatic glycogen content characterized by anthrone-sulfuric acid assay. The hepatic glycogen content in WT mice is normalized to 1.0. Data are expressed as mean ± S.E.M. (n = 3). * P < 0.05, ** P < 0.01, *** P < 0.001 versus ob/ob mice group. Fig. 3. Effects of FYGL on the pathomorphism of liver (A), adipose (B) and pancreas tissues (C) in ob/ob mice. The blue, pink and colorless represent chromatin in cell stained by hematoxylin, intracellular and intercellular matrix stained by eosin, and lipid droplets, respectively. Scale bar = 500 μm. Fig. 4. Western blot analysis in liver tissues. (A) Band images of relevant proteins: IRS1, phosphorylation of IRS1 on Tyr612 [p-IRS1 (Y612)], PI3K, Akt, phosphorylation of Akt on Ser473 [p-Akt (S437)], AMPKα, phosphorylation of AMPKα on Thr172 [p-AMPKα (T172)], GSK3β and phosphorylation of GSK3β on Ser9 [p-GSK3β (S9)]. The bands were quantified by densitometric analysis, and GAPDH was used as quantitative reference. (B) The relative expression of PTP1B and PI3K. (C) The relative phosphorylation of IRS1 on Tyr612 [p-IRS1 (Y612)], Akt on Ser473 [p-Akt (S437)], AMPKα on Thr172 [p-AMPKα (T172)], GSK3β on Ser9 [p-GSK3β (S9)]. Expression in WT mice group is normalized to 1.0. Data are

expressed as mean ± S.E.M. (n = 5). * P < 0.05, ** P < 0.01, *** P < 0.001 versus ob/ob mice group. Fig. 5. In vitro cell viability of HepG2 cells incubated with different concentrations of FYGL for 24 h at 37 °C. Data are presented as mean ± S.E.M. (n = 6). * P < 0.05 versus control group. Fig. 6. Glycogen stained in the red by periodic acid-Schiff (PAS) in HepG2 cells. (A) normal cells without PTP1B transfection and FYGL. (B), (C), (D), (E), (F) PTP1B transfected cells incubated with FYGL at concentrations of 0, 25, 50, 100, 150 μg/ml, respectively. Fig. 7. Western blot analysis of proteins in insulin signaling pathway with 100 nM insulin stimulation for 10 min in PTP1B- cells (normal) and PTP1B+ cells (PTP1B transfected). (A) Band images of relevant proteins: IRS1, p-IRS1 (Y612), PI3K, Akt, p-Akt (S437), AMPKα, p-AMPKα (T172), GSK3β and p-GSK3β (S9). (B) The relative expression of PTP1B. (C) The relative phosphorylation of IRS1 on Tyr612 [p-IRS1 (Y612)]. (D) The relative expression of PI3K. (E) The relative phosphorylation of Akt on Ser473 [p-Akt (S437)]. (F) The relative phosphorylation of AMPKα on Thr172 [p-AMPKα (T172)]. (G) The relative phosphorylation of GSK3β on Ser9 [p-GSK3β (S9)]. The PTP1B+ sample absent of FYGL is regarded as control. Data are presented as mean ± S.E.M. (n = 5). * P < 0.05, ** P < 0.01 versus control group, and # P < 0.05 versus the given group.

Figures Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7