Hypoxia and Heat Inhibit Inducible Nitric Oxide Synthase Gene Expression by Different Mechanisms in Rat Hepatocytes

Hypoxia and Heat Inhibit Inducible Nitric Oxide Synthase Gene Expression by Different Mechanisms in Rat Hepatocytes TOMOHISA INOUE,1 A-HON KWON,1 MICHIO ODA,1 MASAKI KAIBORI,1 YASUO KAMIYAMA,1 MIKIO NISHIZAWA,2 SEIJI ITO,2 AND TADAYOSHI OKUMURA2

Ischemia/reperfusion contributes to the hepatic injury in resection and transplantation of the liver. However, the precise mechanisms involved in hypoxia stress remain to be clarified. Pro-inflammatory cytokines including interleukin 1␤ (IL-1␤) induce a gene expression of inducible nitric oxide synthase (iNOS) and produce nitric oxide, which exerts either a cytoprotective or toxic effect. In this report, we found that hypoxia and heat markedly inhibited the induction of nitric oxide production stimulated by IL-1␤ in rat cultured hepatocytes. Both treatments also abolished the induction of iNOS protein and mRNA. However, hypoxia could not prevent either degradation of an inhibitory protein (I␬B␣) of nuclear factor-␬B (NF-␬B) or translocation of NF-␬B to the nucleus, whereas heat inhibited both of the I␬B␣ degradation and NF-␬B translocation. Transfection experiments with iNOS promoter construct revealed that hypoxia as well as heat significantly inhibited the transactivation of iNOS gene. Further, a hypoxia-response element located in the promoter was not involved in the inhibition of iNOS induction by hypoxia. These results indicate that hypoxia and heat suppress iNOS gene induction at the transcriptional level through different mechanisms. Reduction of nitric oxide production under hypoxic conditions may be implicated in the cellular damage or protection during hepatic ischemia/reperfusion. (HEPATOLOGY 2000;32:1037-1044.) During inflammation and infection, lipopolysaccharide and pro-inflammatory cytokines accelerate the induction of inducible nitric oxide synthase (iNOS), which can catalyze production of nitric oxide from L-arginine in various tissues and organs. In the liver, a relatively large amount of nitric oxide production influences various hepatic metabolism and func-

Abbreviations: iNOS, inducible nitric oxide synthase; ATP, adenosine triphosphate; IL-1␤, interleukin 1␤; NF-␬B, nuclear factor-␬B; HRE, hypoxia response element; SDSPAGE, sodium dodecylsulfate-polyacrylamide gel electrophoresis; RT-PCR, reverse transcription-polymerase chain reaction; mRNA, messenger RNA; EMSA, electrophoretic mobility shift assay. From the 1First Department of Surgery and the 2Department of Medical Chemistry, Kansai Medical University, Moriguchi, Osaka, Japan. Received January 7, 2000; accepted August 7, 2000. Supported in part by a grant-in-aid for Scientific Research (11470491, 09671345) from the Ministry of Education, Science, Culture, and Sports of Japan and by a grant from the Setsuro Fujii Memorial, the Osaka Foundation for the Promotion of Fundamental Medical Research. Address reprint requests to: Tadayoshi Okumura, Ph.D., Department of Medical Chemistry, Kansai Medical University, 10-15 Fumizonocho, Moriguchi, Osaka 5708506, Japan. E-mail: [email protected]; fax: (81) 6-6992-1781. Copyright © 2000 by the American Association for the Study of Liver Diseases. 0270-9139/00/3205-0021$3.00/0 doi:10.1053/jhep.2000.18715

tions. Nitric oxide has cytoprotective effects in the liver during endotoxemia and other fulminant hepatic failure,1,2,3 and is a potent antimalarial effector molecule in hepatocytes.4 Further, nitric oxide inhibits apoptosis by preventing caspase activation in hepatocytes,5,6 although nitric oxide induces apoptosis in a variety of other cell types. Experiments with iNOS knockout mice suggest that iNOS is involved in preventing apoptosis during liver regeneration.7 In contrast, Thiemerman et al.8 found that iNOS-selective inhibitor attenuated liver damage and dysfunction in lipopolysaccharidetreated rats. Nitric oxide inhibited mitochondria Krebs cycle enzyme9 and ATP synthesis.10,11 Thus, production of nitric oxide is implicated in diverse functions associated with cytoprotection or injury in the liver.12 Hepatic warm ischemia/reperfusion injury occurs in clinical situations including liver resection and transplantation. The duration of ischemia is the most important risk factor for postoperative complications in patients undergoing hepatic resection. It is an important cause in primary nonfunction of liver allograft.13,14,15 Pathways for the hepatic ischemia/reperfusion injury have been postulated, such as oxygen-derived free radicals,16 calcium influx,17 adenosine triphosphate depletion and mitochondrial dysfunction,18,19 activation of lysosomal enzymes,20 and disturbance of microcirculation.21,22,23 However, the precise mechanisms that are involved in the hepatic ischemic injury remain obscure. Protective effects of nitric oxide were shown in hepatic ischemia/reperfusion injury24 and during hemorrhagic shock.25 However, nitric oxide is also reported to be cytotoxic under conditions of such severe redox stress. Hierholzer et al.26 reported a marked reduction in hepatic injury produced by hemorrhagic shock in rats receiving iNOS-selective inhibitor, NG-iminoethyl-L-lysine, or in iNOS knockout mice. Induction of nitric oxide production and iNOS protein has been reported in the liver during ischemia/reperfusion injury in the perioperative period of partial hepatectomy with Pringle’s maneuver.27 Thus, nitric oxide is presumably associated with ischemic injury in the liver, but the role of nitric oxide, that is beneficial or detrimental, remains controversial. It is well-known that cells and tissues, which are exposed to toxic insults including heat, hypoxia, and heavy metals, cause a set of adaptive responses such as heat shock response by changing metabolism and gene expression. Heat shock response is associated in an acquisition of tolerance to various injuries.28 In the liver, ischemic or heat preconditioning of the liver in rats has a significant protective effect against warm ischemic liver injury.29,30 deVera et al.31,32 reported that treatment with sodium arsenite or heat-inhibited cytokineinduced nitric oxide synthase expression in human and rat

1037

1038 INOUE ET AL.

hepatocytes, implying that heat shock response confers the cytoprotective effect to injured cells, in part through the regulation of nitric oxide production. Thus, it is quite possible that hypoxic stress also could cause cytoprotection or injury by changing the induction of iNOS gene expression. However, little is known about the effect of hypoxia on nitric oxide production and iNOS induction in the liver. We recently developed an experimental model (the Anaeropack system), which provides a hypoxia atmosphere with 5% carbon dioxide and reflects the conditions of hepatocytes during ischemia and revascularization.33 In the present study, we investigated whether a hypoxic stress with the Anaeropack system influences the induction of nitric oxide production in cultured rat hepatocytes, and if so, what are mechanisms involved and the role in the regulation of iNOS expression. MATERIALS AND METHODS Materials. Recombinant human IL-1␤ (2 ⫻ 107 units/mg protein) was generously provided by Otsuka Pharmaceutical Co. (Tokushima, Japan). [␥-32P]Adenosine-5⬘-triphosphate (ATP, ⫺222 TBq/mmol/L) and [␣-32P] deoxycytidine-5⬘-triphosphate (dCTP, ⫺111 TBq/mmol/L) were from DuPont-New England Nuclear Japan (Tokyo). All other chemicals were of reagent grade. Cultures. Hepatocytes were isolated from male Wistar strain rats (200-250 g) by collagenase perfusion as described previously.34 All animal experiments were approved by the Animal Care Committee of Kansai Medical University. The isolated hepatocytes were suspended in culture medium at 5.5 to 6.0 ⫻ 105 cells/mL, seeded onto plastic dishes (2 mL/dish, 35 ⫻ 10 mm; 9 cm2, Falcon Plastic, Oxnard, CA) and then cultured as monolayers in a CO2 incubator (under a humidified atmosphere of 5% CO2 in air) at 37°C. The culture medium used was Williams’ medium E supplemented with 10% newborn calf serum, Hepes (5 mmol/L), penicillin (100 units/mL), streptomycin (0.1 mg/mL), dexamethasone (10 nmol/L), and insulin (10 nmol/L). After 6 hours, the medium was replaced by fresh serumand hormone-free medium (1.5 mL/dish), and the cells were cultured overnight and then used for the experiments. The purity of isolated hepatocytes was greater than 98% by microscopic observation.35 The number of cells attached to the dishes was calculated from the number of cell nuclei.36 The nucleus/cell ratio was 1.37 ⫾ 0.04 (mean ⫾ S.E., n ⫽ 7). Preparation of Hypoxic and Heat Conditions. The Anaeropack for cell culture (Mitsubishi Gas Chemicals, Tokyo, Japan) is the gas concentration controlling reagent for the hypoxic atmosphere. This reagent contains sodium ascorbate as the principal ingredient, which absorbs oxygen and generates carbon dioxide by oxidative degradation. The culture dishes were placed into an airtight jar with the Anaeropack and the lid was closed. The jar was then incubated at 37°C for the indicated time. The concentration of oxygen decreased to 2% to 3% and less than 1% within 0.5 hour and 1 hour, respectively, and the carbon dioxide concentration was maintained at about 5% as reported previously.33 The hypoxia was terminated by opening the jar and starting reoxygenation in a CO2 incubator. In the case of heat treatment, the culture dishes were incubated for 1 hour at 43°C and thereafter at 37°C in a CO2 incubator. Activity of lactate dehydrogenase in the culture medium was measured for assessment of cell viability by using a commercial kit (Wako Pure Chemicals, Osaka, Japan). Measurement of Nitric Oxide Production. On day 1, cultured hepatocytes were washed with fresh serum- and hormone-free medium (1 mL/dish) and then incubated with 1 mL of the same medium in the absence and presence of IL-1␤ (1 nmol/L, 347 units/mL) under control, hypoxic, and heat conditions. Cells were placed on ice after the indicated times and accumulation of nitrite (NO-2), which is a nitric oxide metabolite, in the medium was used as a measure of nitric oxide production. Nitrite was determined with the Griess reagent method,37 and sodium nitrite was used as the standard.

HEPATOLOGY November 2000 Western Blot Analysis. Cultured hepatocytes were placed on ice and were washed twice with cold phosphate-buffered saline before being solubilized in 125 mmol/L Tris-HCl buffer, pH 6.8, containing 5% glycerol, 2% SDS, and 1% 2-mercaptoethanol. The cell lysates were boiled at 100°C for 3 minutes and centrifuged at 16,500 g for 5 minutes. The supernatant was subjected to sodium dodecylsulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted onto a polyvinylidene difluoride (PVDF; Bio-Rad, Hercules, CA) membrane. Immunostaining was performed using an enhanced chemiluminescence (ECL) blotting detection agent (Amersham Co., Amersham, Bucks, UK) and rabbit polyclonal antibodies against the COOH-terminal fragments of mouse iNOS (Affinity-Bio Reagent, Neshanic station, NJ), human I␬B␣ (C-21) (Santa Cruz Biotech., Santa Cruz, CA) as the primary antibody. Northern Blot Analysis. Total RNA was extracted from cultured hepatocytes using the acid guanidinium-phenol-chloroform method.38 Ten micrograms of total RNA were fractionated by 1% agarose-formaldehyde gel electrophoresis, transferred to nylon membranes (Nytran, Schleider & Schuell, Dassel, Germany), and immobilized by baking (80°C, 2 hours) for hybridization with DNA probes. cDNA probe of iNOS (rat vascular smooth muscle cells; RT-PCR product (830 bp) amplified with YNO12 and YNO56 primers39) was provided by Dr. Y. Nunokawa (Suntory Institute for Biochemical Research, Osaka, Japan) and was radiolabeled with [␣-32P]dCTP by the random-primed labeling method. Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared according to Shreiber et al.40 at 4°C unless otherwise stated. Briefly, approximately 2 ⫻ 106 cells (2 dishes) were placed on ice, washed with Tris-buffered saline, harvested with the same buffer by a rubber policeman, and centrifuged at 1,840 g for 1 minute. The cells in a centrifuge tube were resuspended in 400 mL of lysis buffer (10 mmol/L Hepes, pH 7.9, 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 500 U/mL aprotinin, 0.5 mmol/L phenylmethylsulfonylfluoride [PMSF] and 1 mmol/L dithiothreitol), allowed to swell on ice for 15 minutes and 25 ␮L of 10% Nonident P-40 in the lysis buffer was added. Then the tube was vigorously vortexed for 1 minute at room temperature and centrifuged at 15,000 g for 1 minute. After removal of the supernatant, the nuclear pellet was resuspended in 75 ␮L of nuclear extraction buffer (20 mmol/L Hepes, pH 7.9, 0.4 mol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 500 U/mL aprotinin, 1 mM PMSF and 1 mM dithiothreitol). The tube was incubated on ice for 20 minutes with continuous mixing and centrifuged at 15,000 g for 5 minutes. Aliquots of the supernatant were frozen with liquid nitrogen and stored at ⫺80°C until use. Binding reactions (15 ␮L total) were performed by incubating 4 ␮g protein of the nuclear extract with reaction buffer (20 mmol/L Hepes, pH 7.9, 1 mmol/L EDTA, 60 mmol/L KCl, 10% glycerol, 1 ␮g of poly [dI-dC]) in the absence and presence of cold probe as competitor (500-fold excess) for 30 minutes, followed by a 20-minute incubation at room temperature with the probe (approximately 40,000 cpm). Products were electrophoresed at 100 V on a 4.8% polyacrylamide gel in high ionic strength buffer (50 mmol/L TrisHCl, 380 mmol/L glycine, 2 mmol/L EDTA, pH 8.5), and dried gels were analyzed by autoradiography. NF-␬B consensus oligonucleotide (5⬘-AGTTGAGGGGA-CTTTCCCAGGC) from mouse immunoglobulin ␬ light chain was purchased (Promega, Madison, WI) and labeled with [␥-32P]ATP and T4 polynucleotide kinase. The protein concentration was measured by the method of Bradford41 with a dye binding assay kit (Bio-Rad Lab., Hercules, CA) using bovine serum albumin as a standard. Construction of Reporter Plasmids Harboring Rat iNOS Gene Promoter and Mutagenesis of the Hypoxia Response Element (HRE) Site. The 5⬘-flanking

region including an HRE site (5⬘-TACGTGCA-3⬘) of rat iNOS gene was amplified by polymerase chain reaction (PCR) with rat genomic DNA and a pair of linker-primers based on the published sequence42: wtF: cgcggtaccTCAGTGGTACACATGTGGAGGTC (Kpn I site) wtR: GTCCACTCATCATCCCATGGTTC (Nco I site in the promoter). The product (about 400 base pairs [bp]) was digested with Kpn I and Nco I and cloned into the Kpn I and Nco I sites of pRNOS-

HEPATOLOGY Vol. 32, No. 5, 2000

INOUE ET AL.

1039

RESULTS Inhibition of Nitric Oxide Production by Hypoxia and Heat in Hepatocytes. Pro-inflammatory cytokine IL-1␤ induced a gene

FIG. 1. Effect of hypoxia and heat on the production of nitric oxide by interleukin 1␤ in hepatocytes. Cells were incubated in the presence of IL-1␤ (1 nmol/L) under hypoxic conditions with the Anaeropack system for 0 (E), 1 (■), 2 (F), and 3 hours (Œ), and then reoxygenated in a CO2 incubator (5% CO2 in air at 37°C). In the case of heat treatment (⫻), cells were incubated in the presence of IL-1␤ at 43°C for 1 hour and then at 37°C in a CO2 incubator. Control cells („) were incubated in the absence of IL-1␤ without hypoxia and heat in a CO2 incubator. Levels of nitrite (NO2⫺) released into the medium were measured as nitric oxide production at the indicated times. Data represent the mean ⫾ SD (n ⫽ 3). Standard deviations, which were within 11.2% for all points, are not shown to avoid crowding.

Luc43 to create pRNOS-Luc-H, a new reporter construct harboring the longer 5⬘-flanking region (about 1.4 kb) of rat iNOS gene. The HRE site was mutagenized by replacing by an Sal I site using 2 mutagenic primers including Sal I sites: muR: acgcgtcgacACAAGGACCTAAGTTCAAACGC muF: acgcgtcgacAAGGCAAGCACTTTGACGACT. The genomic fragment amplified by PCR with wtF and muR primers was digested with Kpn I and Sal I, and another fragment amplified with muF and wtR primers was digested with Sal I and Nco I. These 2 framgents were inserted into pRNOS-Luc to create a construct pRNOS-LucmuHRE, in which the HRE site was destroyed by an Sal I site as TgtcgaCA. Effector plasmids pCGp65 and pCG105NcoI encoding p65 (RelA) and p50, respectively, are gifts from Dr. J-I Fujisawa,44 Kansai Medical University. Transfection and Luciferase Assay. Hepatocytes were cultured at 4 ⫻ 105 cells per dish (35 ⫻ 10 mm) in Williams’ medium E supplemented with 10% serum, dexamethasone (10 nmol/L) and insulin (10 nmol/L) for 7 hours. Then cultured cells were replaced by the medium without serum and hormones and were subjected to transfection with 16 ␮g of LipofectAMINE (Life Technologies, Gaithersburg, MD) and 2 ␮g of plasmid DNA: 1.5 ␮g of pRNOS-Luc-H or pRNOS-Luc-muHRE; 0.25 ␮g of CMV enhancer/promoter-driven ␤-galactosidase expression plasmid pCMV-LacZ as an internal control and 0.25 ␮g of plasmid expressing NF-␬B (0.125 ␮g of each pCMV-p65 and pCMV-p105). After 5 hours of incubation at 37°C, the medium was replaced by fresh medium supplemented with 10% serum and insulin. Then the cells were cultured overnight and treated with or without IL-1␤ under various conditions as mentioned earlier. Activities of luciferase and ␤-galactosidase were measured as reported previously.45 The luciferase activity was normalized by dividing relative light units by ␤-galactosidase activity. Statistical Analysis of Data. Statistical significance was analyzed by Bonferroni/Dunn’s test and a P ⬍ .05 was considered to be statistically significant.

expression of iNOS and increased the production of nitric oxide in primary cultures of rat hepatocytes as reported previously.46,47 Under hypoxic conditions with an Anaeropack system, oxygen concentrations dropped to less than 1% within 1 hour after the introduction of hypoxia. Hypoxia inhibited levels of nitrite (nitric oxide metabolite) released into the medium (Fig. 1), where the maximal effect was found after 2 to 3 hours of hypoxia. However, hypoxia for more than 3 hours, which was followed by reoxygenation, increased the release of lactate dehydrogenase activity into the medium (Table 1), indicating the cytotoxic effect irrespective of the presence of IL-1␤. Thus, the hypoxia for 2 hours, which inhibited the nitrite levels by 80% to 90% and showed no release of lactate dehydrogenase activity, was used in the following experiments. In this report, we compared hypoxia with heat shock because heat is one of the typical insults causing heat shock response and was recently reported to affect the iNOS induction.31,32 Heat treatment (43°C for 1 hour) also inhibited the production of nitrite (Fig. 1). Neither hypoxia nor heat alone increased the nitric oxide production under conditions used (data not shown). We further investigated the mechanisms of hypoxia and heat effect on the production of nitric oxide. Inhibition of the Induction of iNOS Protein and its mRNA by Hypoxia and Heat. IL-1␤ induced the synthesis of iNOS protein,

which has a calculated molecular mass of 130 kd.39 iNOS protein appeared at 4 hours with a maximum at 8 to 12 hours following addition of IL-1␤.47,48 Hypoxia and heat markedly inhibited the induction of iNOS protein (Fig. 2). iNOS mRNA appeared after 3 hours and increased to a maximum at 6 to 8 hours. Hypoxia and heat were also found to inhibit mRNA induction (Fig. 3). Inhibitions of iNOS protein and its mRNA induction by hypoxia were gradually recovered during the later incubation time, which supported the observation of an increased nitrite with 2-hour hypoxia at 8 to 11 hours (Fig. 1). Results indicated that hypoxia and heat inhibited the produc-

TABLE 1. Effect of Hypoxia on Cellular Viability in Cultured Rat Hepatocytes Lactate Dehydrogenase Activity (mU/106 cells) Time After Reoxygenation

Hypoxia (h)

IL-1␤ (1 nmol/L)

2h

8h

0

⫺ ⫹ ⫺ ⫹ ⫺ ⫹ ⫺ ⫹

53.5 ⫾ 4.7 51.4 ⫾ 5.1 52.3 ⫾ 2.6 55.7 ⫾ 2.4 57.0 ⫾ 9.1 51.6 ⫾ 7.5 82.9 ⫾ 2.4* 95.9 ⫾ 8.9*

55.8 ⫾ 5.5 53.9 ⫾ 5.0 55.7 ⫾ 10.0 56.6 ⫾ 2.2 65.9 ⫾ 6.8 61.7 ⫾ 5.0 120.6 ⫾ 12.8* 109.4 ⫾ 8.1*

1 2 3

NOTE. Cells were incubated in the absence and presence of IL-1␤ (1 nmol/L) under hypoxic conditions with the Anaeropack system for 0, 1, 2, and 3 hours, and then reoxygenated in a CO2 incubator (5% CO2 in air at 37°C). Activities of lactate dehydrogenase in the medium were measured 2 and 8 hours after reoxygenation. The activity in cells was 1,765.6 ⫾ 140.2 mU/106 cells (n ⫽ 3) at 0 hours. Data represent the mean ⫾ SD (n ⫽ 3). * P ⬍ .05 vs. without hypoxia.

1040 INOUE ET AL.

HEPATOLOGY November 2000

FIG. 2. Effect of hypoxia and heat on the induction of iNOS protein in hepatocytes. Cells were treated in the presence of IL-1␤ (1 nmol/L) with (Hypo) or without (None) 2-hour hypoxia or heat at 43°C for 1 hour (Heat), and then incubated in a CO2 incubator. Control cells (C) were incubated in the absence of IL-1␤ without hypoxia and heat. After 5 and 8 hours, cells were lysed directly with SDS-PAGE sample buffer, boiled, electrophoresed in 7.5% gels, transferred onto PVDF membrane, and immunoblotted with antibody against iNOS protein. Molecular mass markers are shown in kilodaltons on the left. Data represent 1 of 3 independent experiments yielding similar results.

tion of nitric oxide stimulated by IL-1␤ at a transcriptional step.

Effects of Hypoxia and Heat on I␬B Degradation and NF-␬B Activation. The promoters of murine and human genes encoding

iNOS contain a consensus sequence for the binding of transcription factor NF-␬B,42,49,50 which is necessary to confer inducibility by cytokines. To induce iNOS mRNA, the activation of NF-␬B is essential, although not sufficient.45,51,52 NF-␬B is typically found in the form of p50/p65 heterodimers attached to the inhibitory molecule (I␬B) in the cytoplasm of cells.53 We found that IL-1␤ stimulated a rapid degradation of inhibitory subunit of NF-␬B, I␬B␣ protein (35-37kd), which disappeared at 15 to 30 minutes and then recovered 2 hours after the addition of IL-1␤. Hypoxia could not inhibit the degradation of I␬B␣, but rather accelerated its degradation (Fig. 4). In contrast, heat prevented the degradation of I␬B␣ at 1 hour. In support of the observation, experiments with electrophoretic mobility shift assay (EMSA) revealed that heat inhibited the NF-␬B activation, which means a blockade of the translocation of NF-␬B from the cytoplasm into the nucleus

FIG. 3. Effect of hypoxia and heat on the induction of iNOS mRNA in hepatocytes. Cells for controls (C and None), hypoxia (Hypo), or heat were prepared as described in the legend of Fig. 2. After 3 and 5 hours, total RNA was extracted and analyzed by Northern blot. The filter was probed with labeled inserts of iNOS cDNA. Data represent 1 of 3 independent experiments yielding similar results.

and its DNA binding (Fig. 5). However, hypoxia failed to inhibit the translocation of NF-␬B. Inhibition of the Transactivation of iNOS Promoter by Hypoxia and Heat. Because hypoxia markedly inhibited the increase of

iNOS mRNA by IL-1␤ (Fig. 3), we further investigated whether hypoxia affects the transactivation of iNOS promoter by using its promoter-luciferase constructs with or without the hypoxia response element (HRE). As shown in Fig. 6A, hypoxia and heat inhibited the transactivation activity of construct with the HRE stimulated by IL-1␤, although the former did to a lesser degree. Furthermore, hypoxia also inhibited the activity of construct without the HRE in a similar extent. Cotransfection experiments with p50/p65, subunits of NF-␬B, and the promoter constructs (with or without the HRE) revealed the same results (Fig. 6B). DISCUSSION

In this study, we found that hypoxia and heat inhibited the production of nitric oxide stimulated by IL-1␤ (Fig. 1). This inhibition is a result of the suppression at a step of transcrip-

HEPATOLOGY Vol. 32, No. 5, 2000

INOUE ET AL.

1041

FIG. 4. Effect of hypoxia and heat on the degradation of inhibitory subunit I␬B of NF-␬B in hepatocytes. Cells for controls (C and None), hypoxia (Hypo), or heat were prepared as described in the legend of Fig. 2. After 1 and 2 hours, cells were solubilized, subjected to SDS-PAGE, and immunoblotted with anti-I␬B␣ antibody. Data represent 1 of 2 independent experiments yielding similar results.

tion, because induction of iNOS protein and its mRNA was abolished by hypoxia as well as heat (Figs. 2 and 3). However, the mechanisms involved in hypoxia and heat inhibitions are different, which are supported by the observation as follows: (1) hypoxia had no effect on a rapid degradation of inhibitory subunit of NF-␬B, I␬B␣, stimulated by IL-1␤, whereas heat inhibited the degradation (Fig. 4) and (2) experiments with EMSA showed that hypoxia again had no effect on NF-␬B

translocation to the nucleus, but heat inhibited the NF-␬B translocation (Fig. 5). Transfection experiments showed that hypoxia and heat inhibited the iNOS promoter activity (Fig. 6). Hypoxia decreased activities of HRE (⫹) promoter induced by IL-1␤ or p50/p65 by 40% to 60%, whereas heat abolished the activities almost completely. Similar results were obtained when HRE (⫺) promoter construct was used. It indicates that hypoxia

FIG. 5. Effect of hypoxia and heat on NF-␬B activation induced by interleukin 1␤ in hepatocytes. Cells for controls (C and None), hypoxia (Hypo), or heat were prepared as described in the legend of Fig. 2. After 1, 2, and 4 hours, nuclear extracts (4 ␮g protein) were prepared and incubated with [32P]ATP-labeled NF-␬B consensus oligonucleotide, followed by electrophoresis and analysis by autoradiography.

1042 INOUE ET AL.

HEPATOLOGY November 2000

moter by heat was also reported in rat31 and human32 cultured hepatocytes and in murine cultured lung epithelium.56 It has been reported that iNOS is a hypoxia-inducible gene, and hypoxia in combination with interferon ␥ increases the iNOS promoter activity in murine macrophages57 because the iNOS promoter contains a sequence homology to the HRE. Yoshioka et al.58 reported that hypoxia upregulated iNOS gene expression in human hepatocellular carcinoma cells. The promoter region of rat iNOS gene also contains the HRE,59 suggesting that hypoxic stress could potentiate the induction of iNOS in rat cultured hepatocytes. Recently, Jung et al.60 reported that hypoxia caused an increase in iNOS gene expression via hypoxia inducible factor-1 in rat cardiac myocytes, where IL-1␤ stimulated the induction of iNOS gene with further augmentation under hypoxia.

FIG. 6. Effect of hypoxia and heat on the transactivation of iNOS promoter in hepatocytes. The 1.4 kb iNOS promoter construct (pRNOS-Luc-H, 䊐) and its hypoxia response element-mutation construct (pRNOS-Luc-muHRE, ■) were introduced to hepatocytes with or without effector plasmids encoding p50 and p65. Transfected cells without p50/p65 (A) were incubated in the presence of IL-1␤ (1 nmol/L) with or without hypoxia (2 hours) and heat (43°C for 1 hour), followed by incubation in a CO2 incubator at 37°C. After 8 hours, assays of luciferase activity were performed and were normalized by ␤-galactosidase activity. Cotransfected cells with pRNOS-Luc-H (or pRNOS-Luc-muHRE) and p50/p65 (B) were treated with or without hypoxia and heat in the absence of IL-1␤. Fold activation is calculated by dividing the normalized luciferase activity with effector plasmids under various conditions by that with reporter alone. Data represent the mean ⫾ SD (n ⫽ 4). *P ⬍ .05 and **P ⬍ .01 vs. IL-1␤ or p50/p65.

inhibits iNOS induction, in part by preventing the NF-␬B DNA binding and/or its transactivation ability, but not its translocation to the nucleus, in the HRE-independent mechanism. Bergmann et al.54 reported that I␬B␣ degradation and NF-␬B DNA binding are insufficient for NF-␬B-induced transcription in human type II pneumocyte cells, indicating requirement of an additional activation pathway. Beyaert et al.55 found that the mitogen-activated protein kinase, p38, has been implicated in NF-␬B activation. We reported that NF-␬B and CCAAT/enhancer-binding protein ␤ (C/EBP␤) synergistically activated the transcription of iNOS in hepatocytes.45 It seems likely that hypoxia affects one of these pathways, which have a crucial role for NF-␬B-induced transcription in addition to its DNA binding. In the case of heat, heat inhibited the iNOS induction by preventing the degradation of I␬B and the NF-␬B DNA binding. Inactivation of NF-␬B and iNOS pro-

FIG. 7. Effect of hypoxia on iNOS induction stimulated by a combination of lipopolysaccharide and cytokines. Cells were incubated in the absence (Control) and presence of lipopolysaccharide (LPS, 10 ␮g/mL) ⫹ tumor necrosis factor ␣ (TNF␣, 1 nmol), LPS ⫹ interferon ␥ (IFN␥, 500 units/mL), TNF␣ ⫹ IFN␥ or LPS ⫹ CM (cytokine mixture: TNF␣ ⫹ IFN␥ ⫹ IL-1␤[1 nmol]) under the normoxic and hypoxic conditions. Levels of nitrite (nitric oxide metabolite) released into medium (A) and intracellular iNOS protein (B) were measured by Griess-reagent method and Western blot analysis, respectively, at the indicated times.

HEPATOLOGY Vol. 32, No. 5, 2000

All of these reports contradict our finding. Hypoxia with the Anaeropack system caused no increase of nitric oxide production even in the presence of lipopolysaccharide and/or cytokines such as interferon ␥ and tumor necrosis factor ␣ (Fig. 7A and B). In contrast, hypoxia suppressed the production of nitric oxide stimulated by IL-1␤. Under the conditions used in the present study, we found that hypoxia exposure within 2 hours had no cytotoxic effect, but a longer exposure of more than 3 hours with hypoxia caused the cellular damage irrespective of the presence of IL-1␤ (Table 1). Thus, it is not certain that the inhibition of nitric oxide production by hypoxia is associated with hepatic injury. If nitric oxide is cytoprotective, it seems that hypoxic stress decreases the production of nitric oxide by preventing iNOS induction, resulting in ischemic damage during ischemia/reperfusion in the liver. On the other hand, if nitric oxide is toxic, the decrease of nitric oxide production presumably contributes to cytoprotective effect in injured cells. deVera et al.,31,32 showed that heat and sodium arsenite inhibited cytokine-induced iNOS expression through heat shock response, resulting in an acquisition of cytoprotective effect to heat preconditioning of the liver. The role of nitric oxide under ischemic conditions remains to be clarified at present, and our investigation is in progress to make it clear. In summary, our results show that hypoxia inhibits a gene expression of iNOS induced by pro-inflammatory cytokine IL-1␤ at a step of transcription, presumably by preventing the NF-␬B DNA binding or/and its transactivation ability in the HRE-independent mechanism. REFERENCES 1. Harbrecht BG, Billiar TR, Stadler J, Demetris AJ, Ochoa J, Curran RD, Simmons RL. Inhibition of nitric oxide synthesis during endotoxemia promotes intrahepatic thrombosis and an oxygen radical-mediated hepatic injury. Shock 1995;4:332-337. 2. Bohlinger I, Leist M, Barsig J, Uhlig S, Tiegs G, Wendel A. Interleukin-1 and nitric oxide protect against tumor necrosis factor ␣-induced liver injury through distinct pathways. HEPATOLOGY 1995;22:1829-1837. 3. Saavedra JE, Billiar TR, Williams DL, Kim YM, Watkins SC, Keefer LK. Targeting nitric oxide (NO) delivery in vivo. Design of a liver-selective NO donor prodrug that blocks tumor necrosis factor ␣-induced apoptosis and toxicity in the liver. J Med Chem 1997;40:1947-1954. 4. Mellouk S, Hoffman SL, Liu ZZ, de la Vega P, Billiar TR, Nussler AK. Nitric oxide-mediated antiplasmodial activity in human and murine hepatocytes induced by gamma interferon and the parasite itself: enhancement by exogenous tetrahydrobiopterin. Infect Immun 1994;62: 4043-4046. 5. Kim Y-M, Talanian RV, Billiar TR. Nitric oxide inhibits apoptosis by preventing increases in caspase-3-like activity via two distinct mechanisms. J Biol Chem 1997;272:31138-31148. 6. Li J, Bombeck CA, Yang S, Kim Y-M, Billiar TR. Nitric oxide suppresses apoptosis via interrupting caspase activation and mitochondrial dysfunction in cultured hepatocytes. J Biol Chem 1999;274:17325-17333. 7. Rai RM, Lee FYJ, Rosen A, Yang SQ, Lin HZ, Koteish A, Liew FY, et al. Impaired liver regeneration in inducible nitric oxide synthase-deficient mice. Proc Natl Acad Sci U S A 1998;95:13829-13834. 8. Thiemermann C, Ruetten H, Wu C, Vane JR. The multiple organ dysfunction syndrome caused by endotoxin in the rat: attenuation of liver dysfunction by inhibitors of nitric oxide synthase. Br J Pharmacol 1995; 116:2845-2851. 9. Stadler J, Billiar TR, Curran RD, Stuehr DJ, Ochao JB, Simmons RL. Effect of exogenous and endogenous nitric oxide on mitochondrial respiration of rat hepatocytes. Am J Physiol 1991;260:C910-C916. 10. Kitade H, Kanemaki T, Sakitani K, Inoue K, Kamiya T, Nakagawa M, Hiramatsu Y, et al. Regulation of energy metabolism by interleukin-1␤, but not by interleukin-6, is mediated by nitric oxide in primary cultured rat hepatocytes. Biochim Biophys Acta 1996;1311:20-26. 11. Tu W, Kitade H, Kaibori M, Nakagawa M, Inoue T, Kwon A-H, Okumura T, et al. An enhancement of nitric oxide production regulates energy

INOUE ET AL.

12. 13.

14.

15.

16. 17. 18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

1043

metabolism in rat hepatocytes after a partial hepatectomy. J Hepatol 1999;30:944-950. Li J, Billiar TR. Nitric oxide IV. Determinants of nitric oxide protection and toxicity in liver. Am J Physiol 1999;276:G1069-1073. Clavien PA, Harvey PRC, Strasberg SM. Preservation and reperfusion injuries in liver allografts: an overview and synthesis of current studies. Transplantation 1992;53:957-978. Cywes R, Greig PD, Morgan GR, Sanabria JR, Clavien PA, Harvey PRC, Strasberg SM. Rapid donor liver nutritional enhancement in a large animal model. HEPATOLOGY 1992;16:1271-1279. Ploeg RJ, D’Alessandro AM, Knechtle SJ, Stegall MD, Pirsch JD, Hoffmann RM, Sasaki T, et al. Risk factors for primary dysfunction after liver transplantation - a multivariate analysis. Transplantation 1993;55:807813. McCord JM. Oxygen-derived free radicals in postischemic tissue injury. N Engl J Med 1985;312:159-163. Cheung JY, Bonventre JV, Malis CD, Leaf A. Calcium and ischemic injury. N Engl J Med 1986;314:1670-1676. Marubayashi S, Takenaka M, Dohi K, Ezaki H, Kawasaki T. Adenine nucleotide metabolism during hepatic ischemia and subsequent blood reflow periods and its relation to organ viability. Transplantation 1980; 30:294-296. Marubayashi S, Dohi K, Ezaki H, Hayashi K, Kawasaki T. Preservation of ischemic rat liver mitochondrial functions and liver viability with CoQ10. Surgery 1982;91:631-637. Hayashi T, Nagasue N, Kohno H, Chang YC, Nakamura T. Beneficial effect of cyclosporine pretreatment in canine liver ischemia: enzymatic and electronmicroscopic studies. Transplantation 1991;52:116-121. Clemens MG, McDonagh PF, Chaudry IH, Baue AE. Hepatic microcirculatory failure after ischemia and reperfusion: improvement with ATPMgCl2 treatment. Am J Physiol 1985;248:H804-H811. Chazouilleres O, Ballet F, Chretien Y, Marteau P, Rey C, Maillard D, Poupon R. Protective effect of vasodilators on liver function after long hypothermic preservation: a study in the isolated perfused rat liver. HEPATOLOGY 1989;9:824-829. Chazouilleres O, Ballet F, Chretien Y, Marteau P, Rey C, Maillard D, Clavien PA, et al. Preservation and reperfusion injuries in liver allografts: an overview and synthesis of current studies. Transplantation 1992;53: 957-978. Kobayashi H, Nonami T, Kurokawa T, Takeuchi Y, Harada A, Nakao A, Takagi H. Role of endogenous nitric oxide in ischemia-reperfusion injury in rat liver. J Surg Res 1995;59:772-779. Harbrecht BG, Wu B, Watkins SC, Marshall Jr HP, Peitzman AB, Billiar TR. Inhibition of nitric oxide synthase during hemorrhagic shock increases hepatic injury. Shock 1995;4:332-337. Hierholzer C, Harbrecht B, Menezes JM, Kane J, MacMicking J, Nathan CF, Peitzman AB, et al. Essential role of induced nitric oxide in the initiation of the inflammatory response after hemorrhagic shock. J Exp Med 1998;187:917-928. Sugawara Y, Kubota K, Ogura T, Esumi H, Inoue K, Takayama T, Makuuchi M. Increased nitric oxide production in the liver in the perioperative period of partial hepatectomy with Pringle’s maneuver. J Hepatology 1999;28:212-220. Welch WJ. Mammalian stress response: cell physiology, structure/function of stress proteins and implication for medicine and disease. Physiol Rev 1992;72:1063-1081. Saad S, Kanai M, Awane M, Yamamoto Y, Morimoto T, Isselhard W, Minor T, et al. Protective effect of heat shock pretreatment with heat shock protein induction before hepatic warm ischemic injury caused by Pringle’s maneuver. Surgery 1995;118:510-516. Kume M, Yamamoto Y, Saad S, Gomi T, Kimoto S, Shimabukuro T, Yagi T, et al. Ischemic preconditioning of the liver in rats: implications of heat shock protein induction to increase tolerance of ischemia-reperfusion injury. J Lab Cli Med 1996;128:251-258. de Vera ME, Kim YM, Wong HR, Wang Q, Billiar TR, Geller DA. Heat shock response inhibits cytokine-inducible nitric oxide synthase expression in rat hepatocytes. HEPATOLOGY 1996;24:1238-1245. de Vera ME, Wong JM, Zhou J-Y, Tzeng E, Wong HR, Billiar TR, Geller DA. Cytokine-induced nitric oxide synthase gene transcription is blocked by the heat shock response in human liver cells. Surgery 1996; 120:144-149. Kamiya T, Kwon A-Hon, Kanemaki T, Matsui Y, Uetsuji S, Okumura T, Kamiyama Y. A simplified model of hypoxic injury in primary cultured rat hepatocytes. In Vitro Cell Dev Biol 1998;34A:131-137.

1044 INOUE ET AL. 34. Kanemaki T, Kitade H, Hiramatsu Y, Kamiyama Y, Okumura T. Stimulation of glycogen degradation by prostaglandin E2 in primary cultured rat hepatocytes. Prostaglandins 1993;45:459-474. 35. Seglen PO. Preparation of isolated rat liver cells. Methods in Cell Biology 1976;13:29-83. 36. Horiuti Y, Ogishima M, Yano K, Shibuya Y. Quantification of cell nuclei isolated from hepatocytes by cell lysis with nonionic detergent in citric acid. Cell Struct Funct 1991;16:203-207. 37. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite and [15N]nitrate in biological fluids. Anal Biochem 1982;126:131-138. 38. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. 39. Nunokawa Y, Ishida N, Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun 1993;191:89-94. 40. Schreiber E, Matthias P, Mu¨ller MM, Schaffner W. Rapid detection of octamer binding proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Res 1989;17:6419. 41. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254. 42. Eberhardt W, Kunz D, Hummel R, Pfeilschifter J. Molecular cloning of the rat inducible nitric oxide synthase gene promoter. Biochem Biophys Res Commun 1996;223:752-756. 43. Oda M, Sakitani K, Kaibori M, Inoue T, Kamiyama Y, Okumura T. Vicinal dithiol-binding agent, phenylarsine oxide, inhibits iNOS gene expression at a step of NF-␬B DNA binding in hepatocytes. J Biol Chem 2000;275: 4369-4373. 44. Hirai H, Suzuki T, Fujisawa J-I, Inoue J-I, Yoshida M. Tax protein of human T-cell leukemia virus type I binds to the ankyrin motifs of inhibitory factor ␬B and induces nuclear translocation of transcription factor NF-␬B proteins for transcriptional activation. Proc Natl Acad Sci U S A 1994;91:3584-3588. 45. Sakitani K, Nishizawa M, Inoue K, Masu Y, Okumura T, Ito S. Synergistic regulation of inducible nitric oxide synthase gene by CCAAT/enhancerbinding protein ␤ and nuclear factor-␬B in hepatocytes. Genes Cells 1998;3:321-330. 46. Kitade H, Sakitani K, Inoue K, Masu Y, Kawada N, Hiramatsu Y, Kamiyama Y, et al. Interleukin-1␤ markedly stimulates nitric oxide formation in the absence of other cytokines or lipopolysaccharide, in primary cultured rat hepatocytes, but not in Kupffer cells. HEPATOLOGY 1996;23:797-802. 47. Sakitani K, Kitade H, Inoue K, Kamiyama Y, Nishizawa M, Okumura T, Ito S. The anti-inflammatory drug sodium salicylate inhibits nitric oxide formation induced by interleukin 1␤ at a translational step, but not a transcriptional step, in hepatocytes. HEPATOLOGY 1997;25:416-420.

HEPATOLOGY November 2000 48. Kaibori M, Sakitani K, Oda M, Kamiyama Y, Masu Y, Nishizawa M, Ito S, et al. Immunosuppressant FK506 inhibits inducible nitric oxide synthase gene expression at a step of NF-␬B activation in rat hepatocytes. J Hepatol 1999;30:1138-1145. 49. Xie Q-W, Whisnant R, Nathan C. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon ␥ and bacterial lipopolysaccharide. J Exp Med 1993;177:17791784. 50. Nunokawa Y, Oikawa S, Tanaka S. Human inducible nitric oxide synthase gene is transcriptionally regulated by nuclear factor-␬B dependent mechanism. Biochem Biophys Res Commun 1996;223:347-352. 51. Beck KF, Sterzel RB. Cloning and sequencing of the proximal promoter of the rat iNOS gene: activation of NF-␬B is not sufficient for transcription of the iNOS gene in rat mesangial cells. FEBS Lett 1996;394:263-267. 52. Spitsin SV, Farber JL, Bertovich M, Moehren G, Koprowski H, Michaels FH. Human- and mouse-inducible nitric oxide synthase promoters require activation of phosphatidylcholine-specific phospolipase C and NF␬B. Mol Med 1997;3:315-526. 53. Akira S, Kishimoto T. NF-IL6 and NF-␬B in cytokine gene regulation. Adv Immunol 1997;65:1-46. 54. Bergmann M, Hart L, Lindsay M, Barnes PJ, Newton R. I␬B␣ degradation and nuclear factor-␬B DNA binding are insufficient for interleukin-1␤ and tumor necrosis factor-␣-induced ␬B-dependent transcription. Requirement for an additional activation pathway. J Biol Chem 1998 Mar 20;273(12):6607-6610. 55. Beyaert R, Cuenda A, Vanden Berghe W, Plaisance S, Lee JC, Haegeman G, Cohen P, et al. The p38/RK mitogen-activated protein kinase pathway regulates interleukin-6 synthesis response to tumor necrosis factor. EMBO J 1996;15:1914-1923. 56. Wong HR, Ryan M, Wispe JR. The heat shock response inhibits inducible nitric oxide synthase gene expression by blocking I␬-B degradation and NF-␬B nuclear translocation. Biochem Biophys Res Commun 1997;231: 257-263. 57. Melillo G, Musso T, Sica A, Taylor LS, Cox GW, Varesio L. A hypoxiaresponsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. J Exp Med 1995;182:1683-1693. 58. Yoshioka K, Thompson J, Miller MJS, Fisher JW. Inducible nitric oxide synthase expression and erythropoietin production in human hepatocellular carcinoma cells. Biochem Biophys Res Commun 1997;232:702-706. 59. Keinanen R, Vartiainen N, Koistinaho J. Molecular cloning and characterization of the rat inducible nitric oxide synthase (iNOS) gene. Gene 1999;234:297-305. 60. Jung F, Palmer LA, Zhou N, Johns RA. Hypoxic regulation of inducible nitric oxide synthase via hypoxia inducible factor-1 in cardiac myocytes. Circ Res 2000;86:319-325.