Hypoxia-mediated downregulation of human chorionic gonadotropin subunit mRNA expression in cytotrophoblastic JAr cells

Trophoblast Research 12:387-402, 1998

HYPOXIA-MEDIATED D O W N R E G U L A T I O N OF H U M A N CHORIONIC GONADOTROPIN SUBUNIT mRNA EXPRESSION IN CYTOTROPHOBLASTIC JAr CELLS Martin Kn6fler 1, Martin Stenzel, Barbara M6sl, Heinz Strohmer and Peter Husslein Department of Obstetrics and Gynecology, AKH-5Q University of Vienna W~lringer G~irtfl 18-20 A-1090 Vienna, Austria

INTRODUCTION During recent years evidence has accumulated that oxygen tension plays a role in modulating differentiation and function of cytotrophoblasts along their invasive pathway as well as during syncytialization. Before the 8th week of pregnancy cytotrophoblast cells develop in an hypoxic environment due to a low rate of blood flow to the intervillous space. Between 8 and 13 weeks of gestation, when invasive cytotrophoblast cells penetrate the uterine spiral arterioles, the oxygen partial pressure (pO2) in the intervillous space increases from 17.9 to 60.7 mmHg (Rodesch et al., 1992) indicating remodeling of these arterioles. As a consequence, enhanced perfusion of the placenta occurs, allowing efficient transport of oxygen into the intervillous space. In the gestational disease pre-eclampsia, however, this endovascular cytotrophoblast invasion remains superficial (Zhou et al., 1993) and placental hypoxia as a result of reduced utero-placental blood flow has been observed. The coincidence between increasing oxygen levels and the developmental changes of the cytotrophoblast during the first trimester has led to the idea that differentiation might be governed by oxygen. Indeed, it was shown that early cytotrophoblast stem ceils cultured under hypoxic conditions enhance their growth rates, but poorly invade extracellular matrix substrates compared to cells grown in an atmosphere of 20% O~ (Genbacev et al., 1996). These cells also failed to up-regulate a differentiationspecific ceil receptor, cd[~l integrin. Interestingly, developmental expression of this surface protein has been detected in the normal but not in the pre-eclamptic placenta (Zhou et al., 1993) suggesting that unbalanced oxygen levels could play a role in the pathogenesis of this gestational disease. Subsequently, the effects of hypoxia on cytotophoblasts isolated from term placenta were demonstrated. Under low oxygen pressure these trophoblast cells changed their morphology and glucose transport/metabolism. Although low oxygen tension did not affect viability, ceils displayed less microviili on their surface and increased glucose consumption despite a reduction of glucose uptake (Esterman et al., 1997).

1ToWhomCorrespondenceShould Be Addressed. 387 9

of Rochester

388

Kni~fler et al.

With respect to hormone synthesis, some authors have suggested a relation between pO 2 in the intervillous space and human chorionic gonadotropin (hCG) expression during early gestation (Meuris et al., 1995). They reported that intervillous blood flow was consistently found by color Doppler imaging from 11 weeks, coinciding with hCG and [5hCG peaks between 10 and 11 weeks of pregnancy. In hypertensive pregnancies, [ShCG levels were found to rise before the clinical signs of pre-eclampsia appeared (Said et al., 1984). In some of these patients, however, ~hCG serum concentrations decreased, indicating that the practical usefulness of the hormone as a diagnostic marker is limited. In hypoxic villi, degeneration of the syncytiurn seemed to be repaired by hyperplasia of cytotrophoblasts and enhanced syncytia formation (Fox and Path, 1970). Therefore, variations in hCG levels of pre-eclaraptic pregnancies might be explained by different degrees of de novo syncytialization. To evaluate the relation between oxygen concentration and hCG expression, the influence of hypoxia on hormone secretion is now being studied in different trophoblast model systems. In vitro, term cytotrophoblasts were shown to suppress hormone synthesis and release when cultured in an hypoxic environment (Esterman et al., 1996). These cells, which fuse to form a multinucleated syncytinm, did not secrete progesterone and hCG when cultured at a pC): of 14-18 mmI-Ig over a period of 72 hours. Steady state [ShCG mRNA levels were greatly reduced, demonstrating that [ShCG synthesis was affected. Furthermore, hypoxia was suggested to interfere with in vitro syncytialization, since hCG release was not suppressed in fully differentiated cells cultured under low oxygen tension. The authors also showed that dibutyryl cAMP enhanced hCG release from freshly isolated term cytotrophoblasts. Interestingly, however, the inducible secretion of hCG was completely blocked in the hypoxic environment. In a previous study we investigated the properties of different cytotrophoblastic cell lines under hypoxia and provided evidence that these choriocarcinoma cells might be suitable systems to study hypoxia-mediated effects at the molecular level (Strohmer et al., 1997). Our results indicated that tumor cells can be cultured for 48 hours under hypoxic conditions without changes in viability, growth rate or cell cycle distribution. However, hypoxia caused a specific reduction in hCG release and 15hCG mRNA concentration in both proliferating and growth-arrested cells, while expression of a house keeping gene ([5-actin) was not affected. Here, we more closely inspect the molecular mechansim of hCG repression under hypoxia. Using JAr cells as a model we were able to evaluate constitutive and inducible regulation of both (x and [3hCG mRNA in the hypoxic environment. We tested signal transduction pathways which might be involved in the regulation at low oxygen tension and analyzed the hypoxic expression of both mRNAs during biochemical differentiation. Finally, we present data on (x and [~hCG mRNA stabilities and suggest that hCG scretion at low oxygen pressure is mainly govemed by the transcriptional control of its subunit genes. MATERIALS A N D M E T H O D S Cell Culture

JAr choriocarcinoma cells (ATCC HTB-144) were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, and 100 m g / m l

Hypoxia - Regulation of hCG m R N A s

389

streptomycin. All cell culture components were obtained from GibcoBRL (Life Technologies Inc., Gaithersburg, MD). Under standard tissue culture conditions, cells were maintained in a humidified incubator with 5% CO 2and 95% air. Under hypoxic conditions, cells were grown in an incubator equilibrated with 5% CO 2 and N 2 to obtain a final O 2 concentration of 3.5%, as described recently (Strohrner et al., 1997). O2 concentration was controlled by an oxygen electrode (Heraeus Instruments) placed inside the incubator, maintaining a constant oxygen level by continuous regulation of CO 2 and N 2 influx. To achieve growth arrest, cells were treated with 1 mM methotrexate (Sigma Chemical Co., St. Louis, MO, USA) in growth medium. Induction of hCG expression was achieved by addition of 2.5 n g / m l interleukin-l[3 (R&D Systems, Abingdon, UK) or 10 ~VI forskolin (Sigma Chemical Co., St. Louis, MO, USA). Quantitation of hCG Secretion

Ceils were seeded in T25 flasks at a density of 40,000 per cm 2. After two days in culture, i.e., before reaching confluence, medium was changed and cells were transferred to an environment of 20% or 3.5% 02. After indicated times supernatants were aspirated and frozen immediately on dry ice. hCG concentrations in the supernatants were determined by radio-immunoassay (RIA), using the Amerlex-M [~hCG RIA kit according to the instructions of the manufacturer (Johnson & Johnson Clinical Diagnostics Ltd., Amersham, UK). Each hCG value represents the mean of two independent measurements of the same aliquot of supernatant. As specified by the supplier, the sensitivity of the assay is 0.65 rnIU/ml and percentage cross-reactivity, measured at 1 lag/ml of purified hormone, is 1.58% for LH, 0.71% for FSH and 0.44% for TSH. Intra- and interassay coefficients of variance are 2.9% (4 samples, 10 replicates) and 5.1% (20 assays, each probe in duplicate) at a mean value of 55.0 mIU/ml and 52.9 mIU/ml, respectively. Isolation and Hybridization of R N A

Total RNA was isolated from cells by direct lysis within the culture flask using TRI Reagent (Molecular Research Center Inc., Cincinnati, OH) according to the manufacturer's instructions. Total RNA yield was 200 to 280 lag per 10~ cells. For Northern blot analyses, 20 lag of total RNA were glyoxylated and separated by electrophoresis on agarose gels (McMaster and Carmichael, 1977). The fractionated RNA was transferred from gels to nylon membranes (Gene Screen, DuPont NEN) in 10 x SSC using a pressure blotter, crosslinked to the membrane by UV irradiation, hybridized to 32P-labeled cDNA probes, washed and exposed to films (X-Omat AR, Kodak). Autoradiographs were densitometrically scanned and quantification of mRNA signals was done by using Pdi Analysis Software for Biological Data. The 496 bp ~hCG cDNA fragment used in the hybridization was obtained by RTPCR, as previously described (Strohmer et al., 1997). The (zhCG cDNA (547 bp) fragment was isolated after RT-PCR from total JAr RNA. Sequences of ~ C G mRNA-specific oligonucleotides used in the PCR reaction were as follows: sense oligonucleotide: 5 "AGCGCCATGGATTACTACAG3", antisense oligonucleotide: 5"GCTTAATGCTGTATTCATTCC3,. The c~hCG cDNA-fragment was subcloned into the vector pCR~2.1 (Invitrogen) and sequenced on both strands. Radiolabeling of cDNAfragments was performed using Megaprime DNA labeling system according to the instructions of the manufacturer (Amersham, Buckinghamshire, UK). All hybridizations were performed in 50% formamide, 5 x SSC, lx Denhardt's solution, 50 mM sodium

390

KnSfler et al.

phosphate (pH 6.5) and 200 ~ g / m l single-stranded salmon sperm DNA for 24 hours at 42~ The last postwashes were in 0.2 x SSC/0.1% SDS at 65~ Filters were stripped and rehybridized with a aP-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA-fragment. Individual hybridization signals were normalized to the amount of 18S ribosomal RNA, obtained by methylene blue staining of the nylon membranes. mRNA Stability Assay For measurement of the mRNA half-life, subconfluent cells were incubated for 24 hours under hypoxia or standard culture conditions. After addition of 3pg/ml actinomycin-D (Boehringer Mannheim, D) into the medium, cells were further incubated in the hypoxic or normoxic environment. After 0, 3, 6 and 9 hours total RNA was isolated and (z, [3hCG and GAPDH mRNA were hybridized and quantitated as described above. Cellular cAMP Concentration To determine cAMP levels, ceils were cultured on 6 well plates and subjected to 20% or 3.5% O2before reaching confluence. After 24 and 48 hours medium was aspirated and cells were then lysed in lml 0.1N HC1. The cAMP concentration of 100 ~l aliquots was determined by commercially available RIA (cAMP lZ~Iassay system) according to the instructions of the manufacturer (Biotrak, Amersham, Buckinghamshire, UK). Each value represents the mean of two independent measurements of the same aliquot of supernatant. As indicated by the supplier, cross-reactivity with cIMP, cGMP, cTMP and AMP are below 0.004%. The interassay coefficient of variance was 9.7% (27 samples) at a mean of 371

fmolllOO ~1. Release of Interleukin-6 Cells were seeded in T25 flasks as described above. After indicated times under hypoxia or standard culture conditions, supernatants were aspirated and frozen immediately on dry ice. Human IL-6 concentrations in the medium were determined from 50 pl of each sample by an in vitro enzyme-linked immunosorbent assay (ELISA) according to the instructions of the supplier (Endogen Inc., Cambridge, MA). Each IL-6 value represents the mean of two independent measurements of the same aliquot of supernatant. As specified by the manufacturer, no cross-reactivity with other cytokines occurs. Sensitivity is less than I p g / m l human IL-6. Intra- and interassay coefficients of variance are below 10%. RESULTS Downregulation of hCG Subunit mRNAs and Continuous hCG Release Under Hypoxia We previously showed that ~hCG mRNA levels were specifically downregulated to almost undetectable levels after 48 hours of hypoxia. Expression, however, could be partially reverted upon reoxygenation (Strohmer et al., 1997). Here, we show that changes of both c~ and ~ hCG mRNA abundancies can already be detected after 12 hours of incubation in the hypoxic environment (Figure 1A). Compared to the normoxic controls, ~ and ~ hCG mRNA steady-state levels decreased to 50% and 32%, respectively,

391

Hypoxia - Regulation of hCG mRNAs

N

H

N

H

12 24 time (hours)

(1)

o o

Lt3

E (.9 Ot -

24

48 72 time (hours)

Figure 1. Expression of hCG subunit genes and hCG secretion during hypoxia. A) (upper) Autoradiograph of (zhCG, 13hCG and GAPDH mRNAs during different times of hypoxia. Total RNA was isolated from cells after 12 and 24 hours of incubation at 3.5% (H) or 20% (N) oxygen and separated on Northern gels. Subsequent hybridizations and quantitation of mRNA signals were done as described in Materials and Methods. Specific bands and ribosomal RNAs (28S, 18S) are indicated by arrows. B) (lower) Reduction in continuous hCG release during hypoxia. Cells were grown under normoxic (open bars) or hypoxic (hatched bars) conditions, supematants were collected after 24, 48, and 72 hours, and hCG levels were determined by RIA. Bars represent the mean calculated from values of three different experiments, error bars indicate S.D. hCG values were normalized to cell numbers. Asterisks denote significant differences at p<0.02 (t-test) between values from normoxic and hypoxic cultures, respectively, ns denotes not significantly different.

392

Kn6fler et al.

during 24 hours at low-oxygen tension. In agreement with that, we detect a reduction of continuous hCG release in hypoxia (Figure 1B). With respect to cells grown under standard conditions, hCG concentration in the supernatant of hypoxic cells declined to 44% after 48 hours of incubation. However, mRNA expression of the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was found to be 2.5-fold upregulated after 24 hours of hypoxia suggesting adaptation to the anaerobic environment (Figure 1A). Repression of Inducible Synthesis of hCG mRNAs in Hypoxic Cells Interleukin-1 (IL-1) stimulates hCG secretion from early cytotrophoblast cells by an IL-6/IL-6 receptor-mediated signal transduction pathway (Masuhiro et al., 1991). Recently, we demonstrated that inducible, IL-l-mediated hCG secretion was completely abolished in the hypoxic atmosphere in both proliferating and growth-arrested choriocarcinoma cells (Strohmer et al., 1997). To further investigate the underlying mechanism, we performed Northern analyses of total RNA from cells which had been cultured for 24 hours either at 20% or 3.5% O 2 in the presence or absence of methotrexate (MTX) and were then treated with IL-I~ (Figure 2A). After 12 hours of incubation with the cytokine, c~ and [~ hCG mRNAs were 5.5- and 2.5-fold elevated in growing cultures, respectively. In resting cells 4.4-fold (~-subunit) and 2.2-fold (0~-subunit) induction of mRNA expression was observed. Both transcripts, however, were downregulated in the hypoxic atmosphere in proliferating as well as growth-arrested cells and could not be induced upon addition of the cytokine. Compared to levels at 24 hours of hypoxia, (~hCG mRNA decreased to 98% (-MTX) and 84% (+MTX) after an additional 12 hours of incubation while, ~hCG mRNA declined to undetectable levels. Under these conditions we did not notice differences in (z and [~hCG mRNA expression between IL-1B-stimulated or non-treated cells (not shown). GAPDH mRNA production, however, was upregulated at low oxygen pressure in MTX-treated and non-treated cells, hCG concentration quantitated from supernatants of the same experiment revealed that hormone secretion could not be induced in the hypoxic atmosphere (Figure 2B). Hypoxic Suppression of hCG subunit mRNAs Under Elevated cAMP Levels Inducers of enhanced cAMP synthesis and cAMP analogues were shown to stimulate hCG expression in various trophoblast ceils (Huot et al., 1987, Otani et al., 1989). Culturing of cells at low-oxygen tension may alter production of high-energy phosphates and the second messenger cAMP due to reduced oxidative phosphorylation. Therefore, we tested whether downregulation of hCG expression might be caused by decreasing cAMP concentration. First, we studied the effect of elevated cAMP levels on hCG mRNA expression in the hypoxic em;ironment. In the presence of forskolin, an activator of adenylate cyclase, we detected a 9-fold increase of ~hCG mRNA and a 3.5fold increase of c~hCG mRNA after 24 hours of culture in standard conditions (Figure 3A). However, when cells were grown at 3.5% 02, both transcripts were downregulated, in the presence of forskolin to a similar extent as in non-treated ceils. Compared to the normoxic, forskolin-treated controls, (x and ~hCG mRNA declined to 19% and 12%, respectively, in the hypoxic environment. A similar result was obtained in the MTXtreated cells: low-oxygen abolished the effect of the inducer. Next, we investigated cellular cAMP concentration in cells cultured at 3.5% or 20% oxygen (Figure 3B). Compared to controls, cAMP quantitated from hypoxic cells did not significantly decrease after 24 and 48 hours of incubation. In the presence of forskolin, a 6.9-fold and 9.3-fold induction of cAMP

H y p o x i a - R e g u l a t i o n of h C G m R N A s

393

levels was observed after 24 and 48 hours under standard culture conditions. Compared to non-treated cells the amount of the signal transducer was still 4.1- and 6-fold elevated after 24 and 48 hours of incubation, respectively, in the hypoxic atmosphere.

-MTX

+MTX

,_ehCG mRNA

~ o l m i l l l 4 B i m -- ~, ..,.' ~ :

~GAPDH mRNA *--28S

*--18S 0 6 12 0 6 12 0 6 12 0 6 12

N

H

time

N

H

(hours)

,ooo -MTX

~

4c~

o

0

6

12

time (hours)

Figure 2. Interleukin-l-mediated accumulation of hCG mRNAs and hormone release in proliferating and growth-arrested cells during hypoxia. A) Autoradiograph of inducible (~, ~hCG and GAPDH mRNA expression in growing and resting cells. Cells were cultured for 24 hours at 3.5% (H) or 20% O2(N) in the presence or absence of l m M MTX. To induce hCG expression, cells were then treated with 2.5 n g / m l interleukin-l~ and further incubated for 0, 6, or 12 hours under standard or hypoxic culture conditions. Total RNA was isolated, separated on Northern gels and further processed as described above. Numbers indicate hours of incubation in the presence of IL-I~, specific bands and ribosomal RNAs are indicated. B) Supernatants from the same experiment were collected after indicated times of IL-1 induction and amount of hCG was determined by RIA. Open and hatched bars indicate values from normoxic and hypoxic cultures, respectively. Each value was normalized to cell number and represents the mean from three different measurements, error bars indicate S.D. Asterisks denote significant differences at p<0.05 (t-test) between normoxic and hypoxic conditions.

394

Kn6fler et al.

_BhCG mRNA

othCG

mRNA ~-28S

~-18S N H no ind.

N

H F

300 t 270

N H MTX

24 hours

E O_ 0

--

+MTX

+F

Figure 3. cAMP and the influence on hCG subunit mRNA expression during hypoxia. A) (upper) Autoradiograph of hypoxic hCG mRNA expression in the presence of forskolin. Cells were grown for 24 hours at 3.5% (H) or 20% 02 (N) either in the presence (F) or absence (no inducer) of 10 laM forskolin or 1 mM methotrexate (MTX). Total RNA isolation, Northern analysis and quantification of (x and ~hCG mRNA signals were done as described above. Specific bands and ribosomal RNAs (28S, 18S) are indicated by arrows. B) (lower) cAMP concentration in normal and hypoxic cells under methotrexate or forskolin. Cells were oaltured for 24 and 48 hours at 3.5% (hatched bars) or 20% 02 (open bars) in the absence or presence of MTX or forskolin. Cell lysis and determination of cAMP levels were performed as described in Materials and Methods. Bars represent values calculated from three experiments, error bars indicate S.D. Each value was normalized to cell number. Asterisks denote significant differences at p = 0.001 (t-test) between values from normoxic and hypoxic cultures, ns indicates not significantly different.

Hypoxia - Regulation of hCG mRNAs

395

Regulation of IL-6 Expression in the Hypoxic Atmosphere The IL-6/IL-6 receptor pathway mediates IL-l-dependent hCG expression independently from the cAMP/protein kinase A-mediated signal transduction cascade (Taniguchi et al., 1992). We previously suggested that downregulation of IL-l-stimulated hCG secretion under hypoxia might be accomplished by changes in this particular signaling pathway (Strohmer et al., 1997). Therefore, we investigated IL-6 mRNA expression and IL-6 release from cells cultured under normoxia or low oxygen concentration and in the presence of IL-I~. When cells were treated with the cytokine, we detected a specific IL-6 transcript after 6 but not 12 hours of stimulation suggesting transient IL-6 mRNA induction (Figure 4A). In hypoxic cells IL-6 mRNA was more abundantly expressed after 6 hours of IL-1 stimulation. A similar result was obtained in growth-arrested, MTX-treated ceils (not shown). Concomitant with the induction of the mRNA, we observed an IL-l-dependent increase of IL-6 release into the cell culture supernatant (Figure 4B). After 6 hours in the normoxic atmosphere, IL-6 secretion was 17-fold elevated compared to non-stimulated cells. However, under hypoxia IL-6 concentration raised only 4.6-fold compared to the non-induced cells indicating downregulation of IL-6 release at low-oxygen tension. In non-proliferating cells we obtained very similar data on IL-6 secretion in the normoxic and hypoxic atmosphere, respectively.

hCG mRNA Stabilities During Hypoxia Downregulation of hCG subunit mRNAs may occur by a decrease in transcriptional activities of the genes or at a posttranscriptional level. To further investigate the regulatory mechanism, we performed mRNA stability assays. Cells were grown for 24 hours in the normoxic or hypoxic environment and treated with the RNA polymerase inhibitor actinomycin-D. After further incubation in the normoxic or hypoxic atmosphere, RNA was isolated and subsequently hybridized to cDNA fragments of c~, ~hCG (Figure 5A) and GAPDH (not shown). Quantitation of mRNA signals are presented in Figure 5B. Calculated half-lives of ~ and ~hCG mRNA were 11 hours and 8.1 hours in the normoxic environment. Similarly, t1,5 for degradation of ~- and ~-hCG transcripts were 10.3 hours and 7.8 hours, respectively, under hypoxia. GAPDH mRNA was found to be more stable under these experimental conditions and decreased to 72% and 74%, respectively, after 9 hours of actinomycin-D chase in the normoxic and hypoxic atmosphere. DISCUSSION Low oxygen supply has been shown to regulate gene expression in various cellular systems, thereby influencing cell growth and metabolism. Low oxygen tension may inhibit DNA and protein synthesis (Heacock and Sutherland, 1990) but may also enhance proliferation of cells (Falanga and Kirsner, 1993). Hypoxia was shown to induce as well as downregulate mRNA expression, depending on the gene's function in the particular cell type. For example, in endothelial cells hypoxia upregulates interleukins (Yan et al., 1995; Shreeniwas et al., 1992) and angiogenic growth factors (Gleadle et al., 1995) and represses endothelial nitric oxide synthase (Liao et al., 1995, Ziesche et al., 1996), resulting in changes of the vascular tone.

396

Kn6fler et al.

N

H |A

0 6

12

6 12

0

6 12 6 12

-IL-1 +IL-1

-IL-1 +IL-1

time (hours) ,,~

-MTX

,~

1~o

~e

o.

0

6 -IL-1

12

6 12 +IL-1

time(hours) Figure 4. K-l-induced IL-6 release and IL-6 mRNA expression during hypoxia. A) (upper) Autoradiograph of IL-6 mRNA expression under hypoxia. Cells were cultured for 24 hours either at 3.5% (H) or 20% (N) oxygen. After addition of 2.5 ng IL-I~ cells were further grown for indicated times either in the normoxic or hypoxic environment. Total RNA was isolated, and Northern blot and hybridization with an IL-6 cDNA probe were done as described in Materials and Methods. The specific IL-6 band and ribosomal RNAs are indicated. B) (lower) Quantification of IL-6 release from cell culture supernatants. Cells were grown for 24 hours at 3.5% (bold bars) or 20% 02 (open bars) in the presence or absence of MTX. Next, cells were stimulated with 2.5 ng IL-I~ and further incubated in the hypoxic or normoxic environment for indicated times. H u m a n IL-6 concentration from supernatants was determined by ELISA. Bars represent the mean of the values measured in three independent experiments, error bars indicate S.D. Asterisks indicate significant differences at p<0.05 (t-test) between normoxic and hypoxic values, respectively, ns denotes not significantly different.

397

H y p o x i a - R e g u l a t i o n of h C G m R N A s

N

H ,,._B h C G ....

mRNA

,,.._~ h C G mRNA ~28S

~18S

036

9

03

69

time (hours)

80"

6(}

.~

40"

~. 2O -Q

0

a

I

=

a

~iooo~ ~ H

8~

4C, 20i

0

/

i

i

3 6 9 time (hours)

Figure 5. (x and ~hCG rnRNA stabilities during hypoxia. Subconfluent cells were cultured for 24 hours at 3.5% (H) or 20% 02 (N) and then treated with actinomycin-D. After 0, 3, 6 and 9 hours of further incubation in the normoxic or hypoxic atmosphere, total RNA was isolated, separated on denaturing gels, transferred to nylon membranes and subsequently hybridized with (~ and ~hCG cDNA fragments as described above. (A) (upper) Autoradiographs of (x and ~ hCG mRNA stabilities. Specific transcripts and 28S and 18S ribosomal RNAs are indicated by arrows. (B) (lower) Quantitation of c~, ~hCG and GAPDH mRNA degradation in the normoxic (N) and hypoxic (H) environment. Specific bands in (A) were densitometrically scanned and normalized to the 18 S signal. Open and filled circles indicate values of ~ and (x hCG mRNA, respectively, while data of GAPDH mRNA are represented by squares, t89 - degradation was calculated by extrapolation of normalized values. Values at 0 hours of actinomycin-D chase (normoxia and hypoxia) were arbitrarily set to 100 percent.

398

Kn/~fler et al.

Although alterations in gene expression under hypoxia are documented, the underlying molecular mechansims in many cases remain unclear. Genes which are induced in the hypoxic atmosphere, e.g. the erythropoietin gene, have been studied in greatest detail: interaction of hypoxia-inducible factor 1 (HIF-1) with a specific DNA-enhancer element located within the regulatory flanking regions results in transcriptional activation (Semenza and Wang, 1992; Wang et al., 1995). Furthermore, distinct cis-acting DNAsequences regulating the hypoxia-mediated induction of vascular endothelial growth factor (Liu et al., 1995) and inducible nitric oxide synthase (Melillo et al., 1995) have been identified. In primary cytotrophoblasts of the first trimester, hypoxia was shown to downregulate invasion and enhance proliferation (Genbacev et al., 1996). In cytotrophoblast isolated from term placentae, low oxygen tension suppresses hormone secretion and syncytium formation and alters glucose transport/metabolism (Esterman et al., 1996; Esterman et al., 1997). Furthermore, hypoxia stimulates the production of inflammatory cytokines by villous explants (Fairchild-Benyo et al., 1997), which might complicate pre-eclamptic pregnancies. In summary, these data suggest that an appropriate oxygen supply is crucial to trophoblast/placental differentiation. Hypoxia may therefore contribute to the pathophysiology of gestational disease by changing trophoblast function. Despite these facts, the molecular mechanisms which govern hypoxia-dependent gene expression in trophoblasts have not been investigated. Recently, we suggested that JAr choriocarcinoma cells may represent an appropriate system in which to study hypoxia-mediated effects. We demonstrated that 13hCG mRNA was specifically downregulated under hypoxia in proliferating as well as growth-arrested cells, which should more closely mimic non-growing term trophoblasts (Strohmer et al., 1997). Here, we show that (x- and [~hCG, the two subunit proteins of the dirneric glycoprotein hCG, are repressed in the hypoxic environment at the level of mRNA abundancy in proliferating as well as growth-arrested cells (Figures 1 and 2). Changes in levels of both transcripts in continuously cycling cells precede the decline in hCG secretion, suggesting that reduction of hCG release during low oxygen tension is governed by the decrease of the subunit mRNAs. Although hypoxia-dependent modulations of hCG release cannot be excluded, we suspect that changes in hCG secretion are primarily coupled to de novo synthesis at low oxygen tension, similar to the regulation under standard culture conditions (Hussa, 1980; Muyan and Boime, 1997). Induction of the enzyme GAPDH indicates that cells adapt to the anaerobic environment and compensate for the decrease in mitochondrial ATP synthesis by enhanced glycolysis. So far upregulation of GAPDH under hypoxia has been demonstrated only in endothelial cells (Graven et al., 1994). Different signal transduction pathways have been described which are required for inducible hCG expression in trophoblast cells. Substances like 8-Bromo-cAMP activate protein kinase-A while IL-1 mediates induction via an IL-6/IL-6-receptordependent tyrosine kinase (Feinman et al., 1986; Neki et al., 1993). In the hypoxic environment, however, stimulated hCG secretion of term cytotrophoblasts and various choriocarcinoma cells was found to be repressed (Esterman et al., 1996; Strohmer et al., 1997), suggesting that modulations in these pathways could be involved. We have shown that, in proliferating JAr cells, cellular cAMP levels decrease only slightly under

399

H y p o x i a - R e g u l a t i o n of h C G m R N A s

hypoxia and have demonstrated that high levels of cAMP, achieved by stimulating adenylate cyclase with exogenously added forskolin, could not prevent downregulation of (x- and [3hCG mRNA (Figure 3). In agreement, we also found that transcript levels could not be induced by adding forskolin to hypoxic cells (not shown). From these data we conclude that changes in the cAMP-protein kinase A-dependent pathway are not involved in the hypoxic repression. On the other hand, changes in IL-6 secretion might affect IL-l-dependent hCG expression. We detected IL-1- induction of IL-6 mRNA under standard culture conditions and to a greater extent at low oxygen supply (Figure 4). The transient mRNA production likely occurs at the level of transcript synthesis by an NFlcB-dependent mechanism (Ray et al., 1989) while, similar to endothelial cells, enhanced transcription of the IL-6 gene under hypoxia may rely on the action of a different nuclear factor (Yan et al., 1995). Although the result indicates that the IL-1dependent response in JAr cells is not affected at the level of mRNA synthesis, quantitation of IL-6 concentration from supernatants demonstrates that secretion of the interleukin is significantly reduced during hypoxia. Therefore, we speculate that the decrease in IL-6 release may contribute to the repression of IL-l-inducible (x- and [3hCG mRNA production in the hypoxic environment. Alternatively, downregnlation of mRNAs at low oxygen may be independent from activating signal transduction pathways. Hypoxia may induce DNA-binding proteins which repress transcription of the hormone genes or destabilize the mRNAs. To further evaluate the regulatory mechanism, we analyzed ~x- and ~hCG mRNA stabilities under standard culture conditions and at low-oxygen tension. Actinomycin-D chases revealed that degradation of (x and [~hCG mRNA are similar in normoxic and hypoxic cultures (Figure 5), suggesting that alterations in mRNA decay do not play a predominant role in the hypoxic repression. Therefore, our data suggest that downregulation of hCG mRNAs at low oxygen pressure is mainly governed by transcriptional repression of its subunit genes. Actinomycin-D, on the other hand, does not specifically inhibit (x- and ~hCG mRNA synthesis and may affect the production of a putative short-lived regulatory factor. Further analyses of the endogenous transcription rates and the transcriptional activities of the gene's regulatory regions are required, which might allow identification of the cis-acting DNA sequences being involved in this novel hypoxia-mediated mechanism. SUMMARY

Oxygen tension plays a role in regulating placental differentiation and function. To begin to understand the mechanisms of hypoxia-mediated gene expression in trophoblast cells we investigated the regulation of hCG in cytotrophoblastic JAr cells cultured at low oxygen tension. We demonstrated that constitutive and inducible secretion of the hormone are repressed at the level of mRNA abundancy of both subunit genes, (x and ~. Transcripts, however, which encode the glycolytic enzyme GAPDH increase in the hypoxic environment indicating adaptation to the anaerobic conditions. Repression of hormone mRNAs may involve modulations in activating signal transduction pathways resulting in downregulation of transcriptional activity. Subtle changes in cellular cAMP are detectable, which, however, do not explain downregulation of c~/~ hCG mRNA expression at low oxygen supply. Furthermore, elevation of cAMP cannot overcome hypoxic suppression, suggesting that a cAMP/protein kinase-A-mediated signal transduction pathway is not involved. Although we detected IL-1- and hypoxiadependent induction of IL-6 mRNA, IL-6 secretion is reduced in the hypoxic environment. IL-l-inducible hCG expression, therefore might be affected by changes in

400

KnSfler et al.

IL-6/IL-6 receptor-dependent tyrosine phosphorylation. Actinomycin-D mRNA stability assays revealed that c~ and ~hCG mRNA half-lives do not decline in the hypoxic environment, suggesting that the decrease in transcriptional activities of both subunit genes could be the major cause of reduced hCG expression at low oxygen pressure. ACKNOWLEDGEMENTS

The authors thank G. Meinhardt, W. Lajta and R. Kuzmits for technical assistance and U. Tretzmfiller for culturing JAr cells. B. M6sl was supported by grant Nr. 6192 of the "Jubilaumsfond" of the Austrian National Bank. REFERENCES

Esterman, A., Finlay, T.H. and Dancis, J. (1996) The effect of hypoxia on term trophoblast: Hormone synthesis and release. Placenta 17, 217-222. Esterman, A., Greco, M.A., Mitani, Y., Finlay, T.H., Ismail-Beigi, F. and Dancis, J. (1997) The effect of hypoxia on human trophoblast in culture: Morphology, glucose transport and metabolism. Placenta 18, 129-136. Fairchild-Benyo, D., Miles, T.M. and Conrad, K.P. (1997) Hypoxia stimulates cytokine production by villous explants from the human placenta. J. Clin. Endocrinol. Metab. 82, 1582-1588. Falanga, V. and Kirsner, KS. (1993) Low oxygen stimulates proliferation of fibroblasts seeded as single cells. J. Cell Physiol. 154, 506-510. Feinman, M.A., Kliman, H.J., Caltabiano, S. and Strauss llI, J.C. (1986) 8-Brorno-3', 5'adenosine monophosphate stimulates the endocrine activity of human cytotrophoblasts in culture. J. Clin. Endocrinol. Metab. 63, 1211-1217. Fox, H. and Path, M.C. (1970) Effect of hypoxia on trophoblast in organ culture. Am. J. Obstet. Gynecol. 107, 1058-1064. Genbacev, O., Joslin, R., Damsky, C.H., Polliotti, B.M., and Fisher, S. J. (1996) Hypoxia alters early gestation human cytotrophoblast differentiation/invasion in vitro and models the placental defects that occur in preeclampsia. J. Clin. Invest. 97, 540-550. Gleadle, J.M., Ebert, B.L., Firth, J.D. and Ratcliffe, P.J. (1995) Regulation of angiogenic growth factor expression by hypoxia, transition metals, and chelating agents. Am. J. Physiol. 268, 1363-1368. Graven, K.K., Troxler, R.F., Komfeld, H., Panchenko, M.V. and Farber, H.W. (1994) Regulation of endothelial cell glyceraldehyde-3-phosphate dehydrogenase expression by hypoxia. J. Biol. Chem. 269, 24446-24453. Heacock, C.S. and Sutherland, R.M. (1990) Enhanced synthesis of stress proteins caused by hypoxia and relation to altered cell growth and metabolism. Br. J. Cancer 62, 217225.

H y p o x i a - R e g u l a t i o n of h C G m R N A s

401

Huot, R.I., Nardone, R.M. and Stromberg, K. (1987) Differential modulation of human chorionic gonadotropin production by methotrexate in normal and malignant placental cultures and its increase by dibutyryl cyclic adenosine monophosphate and/or actinomycin-D in normal cultures. Cancer Res. 47, 383-387. Hussa, 1LO. (1980) Biosynthesis of human chorionic gonadotropin. Endocr. Rev. 1, 268-294. Liao, J.K., Zulueta, J., Yu, F.S., Peng, H.,B., Cote, C.G. and Hassoun, P.M. (1995) Regulation of bovine endothelial constitutive nitric oxide synthase by oxygen. J. Clin. Invest. 96, 2661-2666. Liu, Y., Cox, S.R., Morita, T. and Kourembanas, S. (1995) Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Circ. Res. 77, 638643. Masuhiro, K., Matsuzaki, N., Nishino, E., Taniguchi, T., Kameda, T., Li, Y., Saji, F. and Tanizawa, O. (1991) Trophoblast-derived interleukin-1 (IL-1) stiraulates the release of human chorionic gonadotropin by activating IL-6 and IL-6 receptor system in first trimester human trophoblasts. J. Clin. Endocrinol. Metab. 72, 594-601. McMaster, G.K. and Carmichael, G.G. (1977) Analysis of single and double stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. Acad. Sci. USA 74, 4835-4838. MeliUo, G., Musso, T., Sica, A., Taylor, L.S., Cox, G.W. and Varesio, L. (1995) A hypoxiaresponsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. J. Exp. Med. 182,1683-1693. Meuris, S., Nagy, A.M., Delogne-Desnoeck, J., Jurkovic, D. and Jauniaux, E. (1995) Temporal relationship between the human chorionic gonadotropin peak and the establishment of interviUous blood flow in early pregnancy. Hum. Reprod. 10, 947950. Muyan, M. and Boime, I. (1997) Secretion of chorionic gonadotropin from human trophoblasts. Placenta 18, 237-241. Neki, R., Matsuzaki, N., Yamanaka, K. Shimoya, K., Okada, T., Saji, F., Iwashita, M. and Tanizawa O. (1993) The interlettkin-6 (IL-6)/IL-6-receptor system induces human chorionic gonadotropin production by activating tyrosine kinase-dependent signal transduction pathway different from pathways triggered by protein kinase activators including gonadotropin releasing hormone. J. Clin. Endocrinol. Metab. 77, 704-709. Otani, F., Otani, T. and Boime I. (1989) Effects of adenine nucleotides on choriogonadotropin (x and ~ subunit synthesis. Biochem. Biophys. Res. Comrnun. 169, 6-11. Ray, A., Sassone-Corsi, P. and Sehgal, P.B. (1989) A multiple cytokine and second messenger-responsive element in the enhancer of the human interleukin-6 gene: Similarities with c-fos gene regulation. Mol. Cell. Biol. 9, 5537-5547.

402

Kni~fler et al.

Rodesch, F., Simon, P., Donner, C. and Jauniaux, E. (1992) Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet. Gynecol. 80, 283-285. Said, M.E., Campbell, D.M., Azzam, M.E. and McGillivray (1984) Beta-human chorionic gonadotrophin levels before and after the development of pre-eclampsia. Br. J. Obstet. Gynaecol. 91, 772-775. Semenza, G.L. and Wang, G.L. (1992) A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell. Biol. 12, 5447-5454. Shreeniwas, R., Koga, S., Karakurum, M., Pinsky, D., Kaiser, E., Brett, J., Wolitzky, B.A., Norton, C., Plocinski, J., Benjamin, W., Bums, D.K., Goldstein, A. and Stem, D. (1992) Hypoxia-mediated induction of endothelial cell interleukin-lalpha. An autocrine mechanism promoting expression of leukocyte adhesion molecules on the vessel surface. J. Clin. Invest. 90, 2333-2339. Strohmer, H., Kiss, H., M6sl, B., Egarter, Ch., Husslein, P. and Kn6fler, M. (1997) Hypoxia downregulates continuous and interleukin-l-induced expression of human chorionic gonadotropin in choriocarcinoma cells. Placenta 18, 597-604. Taniguchi, T., Matsuzaki, N., Jo, T., Saji, F., Taga, T., Hirano, T., Kishimoto, T. and Tanizawa, O. (1992) Interleukin-1 (IL-1)-induced IL-6 and IL-6-receptor-mediated release of human chorionic gonadotropin by choriocarcinoma cell lines (JAR and HCCM-5) activates adenosine 3',5'-monophosphate-independent signal transduction pathway. J. Clin. Endocrinol. Metab. 74, 1389-1395. Wang, G.L. and Semenza, G.L. (1993) General involvement of hypoxia-inducible factor I in transcriptional response to hypoxia. Proc. Natl. Acad. Sci. USA 90, 43044308. Yan, S.F., Tritto, I., Pinsky, D., Liao, H., Huang, J., Fuller, G., Brett, J., May, L. and Stem, D. (1995) Induction of IL-6 by hypoxia in vascular cells. J. Biol. Chem. 270, 11463-11471. Ziesche, R., Petkov, V., Williams, J., Zakeri, S.M., Mosg611er, W., Kn6fler, M. and Block, L.H. (1996) Lipopolysaccharide and interleukin 1 augment the effects of hypoxia and inflammation in human pulmonary arterial tissue. Proc. Natl. Acad. Sci. USA 93, 12478-12483. Zhou, Y., Damsky, C.H., Chiu, K., Roberts, J.M. and Fisher, S.J. (1993) Preeclampsia is associated with abnormal expression of adhesion molecules by invasive cytotrophoblasts. J. Clin. Invest. 91, 950-960.