- Email: [email protected]
I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei
Accepted Manuscript Title: I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei Author: Jean Paul Ouedraogo Mark Arentshorst Igor Nikolaev Sharief Barends Arthur F.J. Ram PII: DOI: Reference:
S0168-1656(16)30057-8 http://dx.doi.org/doi:10.1016/j.jbiotec.2016.02.012 BIOTEC 7406
To appear in:
Journal of Biotechnology
Received date: Revised date: Accepted date:
13-12-2015 2-2-2016 4-2-2016
Please cite this article as: Ouedraogo, Jean Paul, Arentshorst, Mark, Nikolaev, Igor, Barends, Sharief, Ram, Arthur F.J., I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2016.02.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei
Jean Paul Ouedraogoa, 1, Mark Arentshorsta, Igor Nikolaevb, Sharief Barendsb and Arthur F.J. Rama
a
Molecular Microbiology and Biotechnology, Institute of Biology Leiden, Leiden University, Kluyver
Centre for Genomics of Industrial Fermentation , Sylviusweg 72, 2333 BE Leiden, the Netherlands b
Dupont Industrial Biosciences, Archimedesweg 30, 2333 CN Leiden, The Netherlands
1
present address: Center for Structural and Functional Genomics, Concordia University, 7141 Sherbrooke
St. W. Montreal, QC, H4B 1R6, Canada
Corresponding author: Arthur F.J. Ram e-mail: [email protected] Tel: +31 (0)71 5274914 Fax: +31 (0)71 5274999
1
Highlights
The NHEJ pathway in T. reesei is required for I-SceI-mediated double strand break repair Recombinant I-SceI can be added during transformation to create double strand breaks I-SceI-mediated integration in a NHEJ mutant is an efficient method targeted integration
Abstract We previously showed that creation of a double strand DNA break (DSB) by expressing I-SceI in an engineered Trichoderma reesei (Hypocrea jecorina) strain containing a I-SceI recognition site improved transformation and homologous integration efficiencies. In this study, we further improved homologous integration frequencies by combining I-SceI mediated double strand break with disruption of the tku70 gene. The inability of the tku70 mutant to repair a I-SceI mediated DSB via NHEJ was used to force integration of an expression cassette with homologous flanks surrounding the DSB site. Besides expressing I-SceI from a plasmid, we also show that adding I-SceI enzyme during transformation was successful to generate DSBs. The I-SceI enzyme mediated integration, or SEMI, in combination with a Δtku70 mutant has a synergistic effect on homologous recombination efficiencies as 90 to 100% of the transformants exhibited integration of the expression cassette at the homologous site.
Key Words: Hypocrea jecorina, non-homologous-end-joining, double strand break, homologous integration, ade1
1. Introduction Restriction-enzyme-mediated integration has been a useful method for generating non-homologous integration of transforming DNA into the chromosomes of eukaryotic cells (Kuspa and Loomis, 1992; Kuspa, 2006) including filamentous fungi (Sanchez et al. 1998; Sweigard et al. 1998). Currently, there are 2
four major sequence-specific gene editing technologies, which include i) meganucleases (Stoddard, 2014), ii) zinc finger nucleases (ZFNs) (Carroll, 2011), iii) the transcription activator-like effector nuclease (TALENs) (Jankele and Svoboda, 2014) and iv) the clustered regularly interspaced short palindromic repeats (CRISPR) with the CRISPR associated (Cas) nuclease (CRISPR-Cas9) (Hsu et al. 2014; Liu et al., 2015, Nødvig et al. 2015). All four nuclease types introduce a site specific double-strand break (DSBs) in the DNA, which is normally repaired by DNA repair mechanisms. Eukaryotic cells have two most prominent mechanisms to repair the broken DNA: i) the homologous recombination (HR) pathway that involves interaction between homologous sequences for break repair (Heyer et al. 2010; Amunugama and Fishel, 2012) and ii) the non-homologous end joining (NHEJ) pathway which is predominant in many organisms and repairs the DSB independently of DNA homology (Mao et al. 2008; Davis and Chen, 2013). In fungi, the best-characterized cellular components of homologous recombination system are the RAD proteins which function by coordination upon induction of DNA damage (Boiteux and Jinks-Robertson, 2013; Liu and Huang, 2014). The KU heterodimer, which consists of Ku70 and Ku80 proteins, plays an early role in the NHEJ pathway and has a high affinity to DNA ends (Stoddard, 2014). Ku70 or ku80 genes deletion lead to significant increase frequency of homologous recombination and has become an important tool to create gene disruption mutants with high frequency in filamentous fungi (Ninomiya et al. 2004; Nayak et al. 2006; Carvalho et al. 2010; Koh et al. 2014). In our previous study, we have shown that the expression of I-SceI and the subsequent creation of a double strand break (DSB) in a T. reesei strain with an engineered I-SceI restriction sites in its genome stimulate transformation frequency as well as homologous recombination efficiencies (Ouedraogo et al. 2015). In the present study, we combined deletion of tku70 gene with creating double strand breaks using the S. cerevisiae I-SceI meganuclease to further improve targeted integration frequencies. As our previous studies were carried out in the P37Δcbh1pyrG-26 strain (Ouedraogo et al. 2015), a tku70 deletion mutant was made in this background and verified (See Suppl. Figure 1 and 2 for details).
3
Deletion of the tku70 gene in the T. reesei P37Δcbh1pyrG-26 did not reveal apparent growth differences as reported earlier (Guangtao et al. 2009).
The effect of deletion of tku70 on homologous
recombination (HR) efficiency was tested by deleting the T. reesei ade1 gene (JGI ID: 43662) as the accumulation of a red pigment facilitates easy detection of correctly targeted transformants. Ade1 gene deletion cassettes were constructed (ade1::pyrG) with either 1.0-kb or 0.5-kb flanking regions by PCR as described in materials and methods and Suppl. Figure 3 and transformed to the tku70 mutant or its parental strain. The homologous recombination (HR) frequencies calculated from the efficiency by which ade1 mutants were obtained go up from 20% (4/20) in the parental to 100% (20/20) in the tku70 mutant when 1.0-kb flanks are used. Shortening the flanking regions to 0.5-kb yielded no ade1 mutants in the wild-type (18 transformants purified) and still 75% (15/20) successful homologous recombination (ade1 mutants) in the tku70 mutant and confirmed that deletion of the tku70 dramatically increases homologous recombination frequencies in T. reesei, similarly as found for other tku70 deletion strains (Guangtao et al. 2009).
We previously engineered a T. reesei strain with a I-SceI restriction site in its genome. The I-SceI restriction site was inserted at a predetermined site (cbh2 locus) using construct (pBJP6) which is schematically depicted in Figure 1a and Suppl. Figure 4. To investigate whether I-SceI mediated creation of a DSB in combination with inactivation of tku70 would further increase and improve homologous recombination frequencies, a PCR amplified linear fragment from pBJP6 containing the I-SceI restriction site was transformed to the ∆tku70 strain (JP11.3.4). Out of seven stable transformants, three transformants contained the complete pBJP6 cassette integrated into the cbh2 locus and transformant JP12.8 was selected for further analysis (Suppl. Figure 4). It was anticipated that the generation of double strand break in the Δtku70 mutant could be harmful to the cells as a DSB cannot be repaired by non-homologous end joining because of the tku70 deletion (McKinney et al. 2013). Indeed, despite several attempts, no transformants were obtained when the pTTT- ISceI expression plasmid was transformed to JP12.8 whereas transformant were obtained from 4
the same batch of protoplast in control transformations. The results is suggest that expression of I-SceI from the cbh1 promoter, even under non-inducing conditions (glucose), is sufficiently high to generate double strand DNA breaks, which are not efficiently repaired in the tku70 mutant, resulting in lethality. The inability to obtain JP12.8 transformants containing pTTT- ISceI restricted the possibility to assess whether the HR efficiency in ∆tku70 could be further improved by creating a double strand break via controlled I-SceI expression. For this purpose, it was therefore investigated whether addition of recombinant I-SceI during the transformation could improve homologous recombination efficiencies. First, we confirmed that the addition of I-SceI had a positive effect on homologous recombination efficiencies in a parental (functional tku70) background. To test HR frequencies, strain JP7.7 was transformed with linear fragment (pJP8) containing the glucoamylase expression cassette and the alS selection marker which can integrate via a double cross over event thereby replacing I-SceI /pyrG site for the alS selection marker (Figure 1). As shown in Table 2, the addition of I-SceI to protoplast of strain JP7.7 during transformation had a positive effect on obtaining stable transformants and increased homologous recombination efficiencies. The effect of adding I-SceI during the transformation is comparable to the effect of expressing I-SceI during transformation as reported previously (Ouedraogo et al. 2015). In a similar experiment, the Δtku70 mutant (JP12.8) was transformed with the homologous recombination cassette (pJP8) in the presence of increasing amounts of I-SceI. Even when no I-SceI was added, analysis of the transformants revealed that a substantial percentage of transformants (28%) were likely to be the result from a targeted integration event as these transformants showed a pyrG- phenotype (Table 2). The addition of I-SceI during transformation had a further positive effect of HR efficiencies in tku70 mutant leading to 90 to 100% homologous recombination frequencies when adding low concentrations of I-SceI (5 or 10 Units I-SceI per transformation). Higher amounts of I-SceI addition (25 Units of I-SceI per transformation or higher) turned out to be harmful to the tku70 protoplasts as the number of transformants obtained dropped significantly (Table 2). However, the stable transformants 5
obtained are likely to be the result from a targeted integration event as all transformants showed a pyrGphenotype. To analyze if the pyrG- transformants obtained after transformation, contain the glucoamylase expression cassette at the intended locus via a HR event, 18 pyrG- transformants were randomly selected from the different transformation experiments and analyzed for glucoamylase production and integration patterns. As shown in Figure 2, in all 18 pyrG- transformants, comparable levels of glucoamylase activity was measured in the culture fluid. In 18 randomly selected pyrG+ transformants, only four transformants produced glucoamylase with variable levels (Figure 2). Ten pyrG- transformants and five pyrG+ transformants randomly taken from the transformant analyzed for glucoamylase production (see above) were analyzed by Southern blot to determine the integration pattern of the glucoamylase cassette. As shown in Suppl. Fig. 5 all pyrG- transformants analyzed had the glucoamylase gene targeted integrated at the predefined locus. The pyrG+ transformants have the cassette randomly integrated into the genome according to the differences in integration pattern between the transformants. This study demonstrated the successful use of I-SceI enzyme to improve the transformation efficiency and targeted integration frequencies of the DNA cassette in both wild-type and tku70 mutant strains. The approach of using I-SceI enzyme is a variant of the restriction enzyme-mediated insertional (REMI) approach that has been used in several studies to increase the frequency of insertion mutagenesis in fungi (Manivasakam and Schiestl, 1998; Sanchez et al. 1998; Sweigard et al. 1998; Yaver et al. 2000). However, a major advantage of I-SceI enzyme mediated integration (SEMI) over REMI is that I-SceI cuts only once in the genome at a predetermined site. The SEMI gene targeting system is therefore well suitable for high throughput screening of enzyme variants or gene libraries in T. reesei and readily applicable to other fungal expression hosts.
Acknowledgement 6
We thank Bob Schepers for his helpful contributions to the project and Dr. Jaap Visser for helpful discussions. This project was carried out within the research programme of the Kluyver Centre for Genomics of Industrial Fermentation, which is part of the Netherlands Genomics Initiative/Netherlands Organization for Scientific Research. Contributors
References Ain, Q.U., Chung, J.Y., Kim, Y., 2015. Current and future delivery systems for engineered nucleases; ZFN, TALEN and RGEN. J. Control Release 205, 120-127. Amunugama, R., Fishel, R., 2012. Homologous recombination in eukaryotes. Prog. Mol. Biol. Transl. Sci. 110, 155-206. Boiteux, S., Jinks-Robertson, S., 2013. DNA repair mechanisms and the bypass of DNA damage in Saccharomyces cerevisiae. Genetics 193, 1025-1064. Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188, 773-782. Carvalho, N.D., Arentshorst, M., Jin Kwon, M., Meyer, V., Ram, A.F., 2010. Expanding the ku70 toolbox for filamentous fungi: establishment of complementation vectors and recipient strains for advanced gene analyses. Appl. Microbiol. Biotechnol. 87, 1463-1473. Davis, A.J., Chen, D.J., 2013. DNA double strand break repair via non-homologous end-joining. Transl. Cancer Res. 2, 130-143. Green, M.R., Sambrook, J., 2012. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, fourth ed. Cold Spring Harbor, New York.
7
Guangtao, Z., Hartl, L., Schuster, A., Polak, S., Schmoll, M., Wang, T., Seidl, V., Seiboth, B., 2009. Gene targeting in a nonhomologous end joining deficient Hypocrea jecorina. J. biotech. 139,146-151. Heyer, W.D., Ehmsen, K.T., Liu, J., 2010. Regulation of homologous recombination in eukaryotes. Annu. Rev. Genet. 44,113-139. Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278. Ichinomiya, M., Yamada, E., Yamashita, S., Ohta, A., Horiuchi, H., 2005. Class I and class II chitin synthases are involved in septum formation in the filamentous fungus Aspergillus nidulans Eukaryotic. cell 4,1125-1136. Jankele, R., Svoboda, P., 2014. TAL effectors: tools for DNA targeting. Brief. Funct. Genomics. 13, 409419. Jiang, D., Zhu, W., Wang, Y., Sun, C., Zhang, K.Q., Yang, J., 2013. Molecular tools for functional genomics in filamentous fungi: recent advances and new strategies. Biotechnol. Adv. 31, 1562-1574. Jin, F.J., Maruyama, J., Juvvadi, P.R., Arioka, M., Kitamoto, K., 2004. Adenine auxotrophic mutants of Aspergillus oryzae: development of a novel transformation system with triple auxotrophic hosts. Biosci. Biotechnol. Biochem. 68, 656-662. Koh, C.M., Liu, Y., Moehninsi, Du M., Ji, L., 2014. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol. 14:50. doi: 10.1186/1471-2180-14-50. Kuspa, A., Loomis, W.F., 1992. Tagging developmental genes in Dictyostelium by restriction enzymemediated integration of plasmid DNA. Proc. Natl. Acad. Sci. U S A, 89, 8803-8807. Kuspa, A., 2006. Restriction enzyme-mediated integration (REMI) mutagenesis. Methods Mol. Biol. 346, 201-209. Liu, R., Chen, L., Jiang, Y., Zhou, Z., Zou, G., 2015. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discovery 1, 15007. Liu, T., Huang, J., 2014. Quality control of homologous recombination Cellular and molecular life sciences: Cell Mol. Life Sci. 7, 3779-3797. Maier, F.J., Schafer, W., 1999. Mutagenesis via insertional- or restriction enzyme-mediated-integration (REMI) as a tool to tag pathogenicity related genes in plant pathogenic fungi. Biol. Chem. 380, 855-864. Manivasakam, P., Schiestl, R.H., 1998. Nonhomologous-end joining during restriction enzyme-mediated DNA integration in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 1736-1745. Mao, Z., Bozzella, M., Seluanov, A., Gorbunova, V., 2008. Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair (Amst) 7, 1765-1771. McKinney, J.S., Sethi, S., Tripp, J.D., Nguyen, T.N., Sanderson, B.A., Westmoreland, J.W, Resnick, M.A., Lewis, L.K., 2013. A multistep genomic screen identifies new genes required for repair of DNA double-strand breaks in Saccharomyces cerevisiae. BMC genomics 14:251. doi: 10.1186/1471-2164-14251. Meyer, V., Ram, A.F., Punt, P.J., 2010. in Manual of Industrial Microbiology and Biotechnology, Demain A.L., Davis J. (Eds.) third ed., John Wiley and Sons Inc., New York, pp. 318-329. 8
Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R., 2006. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172, 1557-1566. Ninomiya, Y., Suzuki, K., Ishii, C., Inoue, H., 2004. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. 101, 12248–12253. Nødvig C.S., Nielsen J.B., Kogle M.E., Mortensen U.H., 2015. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One. 10, e0133085. doi: 10.1371/journal.pone.0133085. Ouedraogo, JP., Arentshorst, M., Nikolaev I., Barends, S., Ram, A.F.J., 2015. I-SceI-mediated doublestrand DNA breaks stimulate efficient gene targeting in the industrial fungus Trichoderma reesei . Appl. Microbiol. Biotechnol. DOI: 10.1007/s00253-015-6829-1 Pan, F.C., Chen, Y., Loeber, J., Henningfeld, K., Pieler, T., 2006. I-SceI meganuclease-mediated transgenesis in Xenopus. Dev. Dyn. 235, 247-252. Penttila, M., Nevalainen, H., Ratto, M., Salminen, E., Knowles, J., 1987. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 61, 155-164. Sanchez, O., Navarro, R.E., Aguirre, J., 1998. Increased transformation frequency and tagging of developmental genes in Aspergillus nidulans by restriction enzyme-mediated integration (REMI). Mol. Genet. Genomics 258, 89-94. Semighini, C.P., von Zeska Kress Fagundes, M.R., Ferreira, J.C., Pascon, R.C., de Souza Goldman, M.H., Goldman, G.H., 2003. Different roles of the Mre11 complex in the DNA damage response in Aspergillus nidulans. Mol. Microbiol. 48, 1693-1709. Stoddard, B.L., 2014. Homing endonucleases from mobile group I introns: discovery to genome engineering. Mob. DNA 5:7. doi: 10.1186/1759-8753-5-7. Sweigard, J.A., Carroll, A.M., Farrall, L., Chumley, F.G., Valent, B., 1998. Magnaporthe grisea pathogenicity genes obtained through insertional mutagenesis. Mol. Plant Microbe Interact. 11, 404-412. Takahashi, T., Ogawa, M., Koyama, Y., 2012. Analysis of the functions of recombination-related genes in the generation of large chromosomal deletions by loop-out recombination in Aspergillus oryzae. Eukaryot. cell 11, 507-517. Thermes, V., Grabher, C., Ristoratore, F., Bourrat, F., Choulika, A., Wittbrodt, J., Joly, J.S., 2002. I-SceI meganuclease mediates highly efficient transgenesis in fish. Mech. Dev. 118, 91-98. Thon, M.R., Nuckles, E.M., Vaillancourt, L.J., 2000. Restriction enzyme-mediated integration used to produce pathogenicity mutants of Colletotrichum graminicola. Mol. Plant Microbe Interact. 13, 13561365. Ugolini, S., Bruschi, C.V., 1996. The red/white colony color assay in the yeast Saccharomyces cerevisiae: epistatic growth advantage of white ade8-18, ade2 cells over red ade2 cells. Curr. Genet. 30, 485-492. Yaver, D.S., Lamsa, M., Munds, R., Brown, S.H., Otani, S., Franssen, L., Johnstone, J.A., Brody, H., 2000. Using DNA-tagged mutagenesis to improve heterologous protein production in Aspergillus oryzae. Fungal Genet. Biol. 29, 28-37.
9
Figures
Figure 1. Schematic representation of targeted integration of the glucoamylase expression cassette via addition of I-SceI enzyme mediated homologous recombination. a) The strains JP7.7 and JP12.8 with ISceI restriction sites inserted at the cbh2 locus were used to test the targeted integration mediated by addition of I-SceI enzyme into the transformation mixture. b, c) Transformation of both strains with the glucoamylase expressing cassette (pJP8) with simultaneous addition of I-SceI enzyme to create DSB. d) The DSB can be repaired by homologous recombination with the glucoamylase expressing cassette which has homologous regions to the locus containing the I-SceI sites. e) A correct targeted integration would generate a strain which is resistant to chlorimuron ethyl (alS+), uridine auxotrophic (pyrG-) and is expected to express the glucoamylase gene under induction of PcbhI. Media to grow T. reesei strains and transformations were performed as described (Ouedraogo et al. 2015).
10
Figure 2. Glucoamylase activity in culture medium of transformants obtained after targeted or random integration. Targeted integration transformants of the glucoamylase cassette (pyrG- transformants) displayed high homogeneity of glucoamylase activity compared to random integration transformants (pyrG+ transformants). The targeted (n = 18) and random (n = 18) integrated transformants are pyrG- and pyrG+ phenotype, respectively. The pyrG- transformants were selected randomly from the different transformation experiments with the I-SceI enzyme. Plots were created using GraphPad Prism 6 (column scatter graph). The horizontal bars represent the mean values with standard deviations.
11
Table 1 Strains and plasmids used in this study Fungal strains
Genotype or description
Source or reference
RL-P37∆cbhIpyrG-26
pyrG-, cbhI-
DuPont bioscience
JP11.3
Δtku70::pyrG
This study
JP11.3.4
Δtku70-, pyrG-
This study
JP7.7
RL-P37∆cbhIpyrG-26 with I-SceI restriction sites cassette integrated at cbh2 locus
Ouedraogo et al., 2015
JP12.8
JP11.3.4 with I-SceI restriction sites cassette integrated at cbh2 locus
This study
pBJP3
tku70::pyrG deletion cassette
This study
pBJP6
I-SceI restriction site cassette
Ouedraogo et al., 2015
pCRpyrGAN
Containing the full gene of A. nidulans pyrG
Ouedraogo et al., 2015
pTTT
cbhI promoter and amdS selection marker
DuPont Bioscience
pTTT-ISceI
I-SceI under control of the inducible cbh1 promoter with amdS selection
Ouedraogo et al., 2015
pJP8
T. reesei glucoamylase cassette with homologous regions to the I-SceI restriction site cassette
Ouedraogo et al., 2015
Plasmids
12
Table 2. The effect of I-SceI enzyme addition on transformation efficient, stability and homologous integration frequencies (HRF) in tku70+ (JP7.7) and Δtku70- (JP12.8) T. reesei strains
No I-SceI added 5Ud 10U 25 U 50 U 100 U
# of primary transformantsa JP7.7 JP12.8 19 22 31 34 42 40 49 23 56 16 70 3
% stable transformantsb JP7.7 13/19 19/20 20/20 19/20 18/20 20/20
68% 95% 100% 95% 90 % 100%
JP12.8 18/20 90% 20/20 100% 20/20 100% 13/20 65% 13/16 81% 2/3 66%
pyrG- transformants (HRF efficiency)c JP7.7 JP12.8 0/13 0% 5/18 28% 4/19 21% 18/20 90% 6/20 30% 18/20 90% 11/19 58% 13/13 100% 14/18 78% 13/13 100% 17/20 85% 2/2 100%
a
Number of primary transformants on transformation plate. Numbers of primary transformants are shown for the same protoplast batch to be able to compare efficiencies. Results for a typical experiment are shown. b
Primary transformants were purified on selective medium (TrMM + uridine + alS substrate). Stable transformants grow well on these plates. Abortive transformants (not stable) do not grow.
c Stable transformants were tested for the pyrG- phenotype by inoculating spores of each transformant on trMM with uridine or trMM without uridine. The efficiency of targeted integration was determined by scoring transformants which have lost the pyrG selection marker (Suppl. Figure 5). To confirm the targeted integration of the glucoamylase cassette, transformants were further analyzed by Southern blot and for glucoamylase production as described (Ouedraogo et al. 2015). d
Protoplast transformation which included the addition of I-SceI (Thermo scientific) were performed as follows: to 200µL of protoplasts, different amounts of I-SceI enzyme (5 to 100 Units) plus 4 µg of linearized pJP8 cassette, 30µL (1x final concentration) enzyme buffer and water was added to give a final volume of the protoplast mixture of 300µL which was incubated for 15 minutes at room temperature followed by a 20 minutes incubation on ice. After the 35 minutes of incubation, the protoplast mixture was plated out on transformation plate containing 10mM uridine and 5µg/ml of chlorimuron ethyl (alS substrate) (Ouedraogo et al. 2015).
13
Supplemental Table 1. Primers used in this study Primers name
f/r
Sequence (5’to 3’oriented)
Remark
Template
P1 (ClaI)
f
CCATCGATGGGGCCCTTTGCAATGTAGTTC1
Amplification of 5’flank tku70
gDNA QM6a
P2
r
GGTTTCAGCCTTCACAGTTC
Amplification of 5’flank tku70
gDNA QM6a
f
GAACTGTGAAGGCTGAAACCCATTGTCCTCACGGG ACTTG2
Amplification of 500 bps DR
gDNA QM6a
P4 (XbaI)
r
GCTCTAGAGCGCTGGAGAGGAAATCCATAG
Amplification of 500 bps DR
gDNA QM6a
P5 (XbaI)
f
GCTCTAGAGCCATTGTCCTCACGGGACTTG
Amplification of 3’flank tku70
gDNA QM6a
r
ATAAGAATGCGGCCGCTAAACTATTCTGATCGGCA GCATCCTTC
Amplification of 3’flank tku70
gDNA QM6a
P7 (XbaI)
f
GCTCTAGAGCTCGCCCTTGCTCTAGATAAC
Amplification of the selection marker
pCRpyrGAN
P8 (XbaI)
r
GCTCTAGAGCAATTCGCCCTTGACTAGTGC
Amplification of the selection marker
pCRpyrGAN
Ade1_P1_500
f
AGTAGCAGCAGCAACACAG
Amplification of 5’ade1 500 bps frank
gDNA QM6a
Ade1_P1_1000
f
GGATGCGAATCAGGAGTC
Amplification of 5’ade1 1000 bps frank
gDNA QM6a
Rev_5’ade1
r
GTGATGGTGGTGGTGTAG
Amplification of 5’ade1 frank
gDNA QM6a
f
CATCACCACCACTACCGTCACCTCGCCCTTGCTCTA GATAAC
Amplification of 5’pyrG marker fragment
pCRpyrGAN
r
TCCGCAGACGTTACTACTTC
Amplification of 5’pyrG marker fragment (for split marker fragment 1)
pCRpyrGAN
Ade1_P3
f
CAAAGGCAACGACGTGCG
Amplification of 3’ade1 frank
gDNA QM6a
Ade1_P4_500
r
AGCAGGATCGAGCTCATC
Amplification of 3’ade1 500 bps frank
gDNA QM6a
Ade1P4_1000
r
CACATGCACTCGGTATGC
Amplification of 3’ade1 1000 bps frank
gDNA QM6a
f
CCCTTATCCGACAGATTCAC
Amplification of 3’pyrG marker fragment (for split marker fragment 2)
pCRpyrGAN
r
CACGCACGTCGTTGCCTTTGTAATTCGCCCTTGACT AGTGC
Amplification of 3’pyrG marker fragment
pCRpyrGAN
P3
P6 (NotI)
pyrG-5’ade1 Rev_pyrG_1205
Fw_pyrG_599 pyrG_rev_3’ade1
1
Restriction sites are given in italic
2
Underlined sequences within the primers are complementary sequence for performing the fusion PCR
14
Legends to Supplemental Figures
Supplemental Figure 1. Schematic construction of the tku70 deletion cassette and strategy for recycling the ANpyrG selection marker. a) Schematic construction of the deletion cassette with double repeats (DRs) and cloning into pBluescript SK (+). Primers are found in Supplementary Table 1. b) The uridine auxotrophic marker pyrG of A. nidulans, flanked with a 500-bp sequence of the 3’UTR of the tku70 gene (DRs, marked by a black box) was integrated into the tku70 gene by homologous recombination (1). The resulting strain JP11.3 with disrupted tku70 open reading frame and uridine auxotrophic phenotype was further plated on minimal medium containing 1.5 mg/ml FOA to select the ANpyrG loop out colonies (2). The ANpyrG marker gene looped out via single crossover between the DRs and a marker free ∆tku70 strain is generated (JP11.3.4) (3).
Supplemental Figure 2. Deletion of tku70 open reading frame and efficient loop out of the ANpyrG selection marker. (a, b and c) Graphical representation of the tku70 open reading frame before deletion, after deletion and after loop out of the ANpyrG selection marker respectively. In panel a, the tku70 open reading frame is illustrated as an arrow. The 500 bps of the 3’ flank is showing by a black box and is used to flank the ANpyrG marker for efficient loop out after deleting the tku70 open reading frame (panels b and c). The 500 bps 3’flank is used as probe and the position is shown in all panels as the black box. (d) Southern blot analysis of 6 transformants for deletion of the tku70 open reading frame (lane 1 to 6 represent respectively JP11.1, JP11.2, JP11.3, JP11.4, JP11.5, JP11.6) and the parental strain RLP37∆cbhIpyrG-26 (line 7). The expected band sizes are 4.7 kb and 1.29 kb for the disrupted mutant and 2.9 kb for the wild-type tku70 locus. (e) Southern blot analysis for efficient loop out of the ANpyrG marker in 4 transformants (lane 1 to 4 represent respectively JP11.3.4, JP11.3.3, JP11.3.2, JP11.3.1 ) and the parental strain JP11.3 (line 5). The expected bands size on the blot when the pyrG marker is looped 15
out is 3.7 kb. A non-loop out of the ANpyrG marker is characterized by the bands size of 4.7 kb and 1.29 kb. Smalls bars point to relevant fragment sizes. The primers used for PCR amplifications are listed in Suppl. Table 1.
Supplemental Figure 3. Schematic construction of the ade1 deletion cassette for gene knock out by fusion PCR approach. The homologous sequences of ade1 gene were fused with the A. nidulans pyrG gene used as selection marker to obtain the ade1 deletion cassette which is used to knock out the ade1 gene by homologous recombination. The construction of ade1 gene deletion cassettes with either 500 or 1000 bps 5’and 3’flanks were constructed by fusion PCR using oligonucleotides listed in Suppl. Table 1. PCR amplified fragments were purified and directly used for transformation. Stables transformants were obtained by streaking on TrMM plates containing the required selection pressure for two successive rounds. Single colonies obtained as such were selected for further analysis. Transformation medium for ade1 deletion was supplemented with 200mg/L of adenine. In order to visualize the red pigment due to ade1 deletion, 10mg/L of adenine was supplemented to the purification medium.
Supplemental Figure 4. Southern blot analysis of transformants containing the I-SceI restriction sites cassette in the genome of JP11.3.4 (∆tku70, pyrG-). (a) Graphical representation of the complete I-SceI restriction sites cassette (pBJP6) in the genome of T. reesei. (b) Southern blot analysis of seven transformants (lane 1 to 7 represent respectively JP12.3, JP12.4, JP12.5, JP12.6, JP12.7, JP12.8 and JP12.9) and the parental strain RL-P37∆cbhIpyrG-26 (lane 8). Genomics DNAs were digested with PstI and hybridized with the probe Pcbh1. 6.3 kb is the expected band size of the integrated I-SceI restriction sites cassette. The probe is not binding to the parental strain lacking PcbhI.
16
Supplemental Figure 5. Southern blot analysis of selected transformants after transformation with the glucoamylase expression cassette (a): Graphical representation of pJP8 transformants to analyze integration of the glucoamylase cassette at the 5' flank and 3' flank of the cbh2 locus by using SpeI and BamHI as restriction enzyme and PcbhI and Tcbh2 as probe respectively. The expected band size is 5.4 kb for integration of the glucoamylase cassette at the 5' flank and 6.8 kb for integration at 3' flank. A nonhomologous integration of the glucoamylase cassette will not alter the cbh2 locus and a hybridizing DNA fragment of 3.6 kb and 3 kb are expected with probe A and probe B respectively. (b) Southern blot results of pJP8 transformants to analyze the integration of the glucoamylase cassette at the 5' flank (left blot) and 3' flank (right blot) of the cbh2. Line 1 to 10 represent targeted integrated transformants and Line 11 to 15 represent random integrated transformants with a pyrG+ phenotype.
17
S0168-1656(16)30057-8 http://dx.doi.org/doi:10.1016/j.jbiotec.2016.02.012 BIOTEC 7406
To appear in:
Journal of Biotechnology
Received date: Revised date: Accepted date:
13-12-2015 2-2-2016 4-2-2016
Please cite this article as: Ouedraogo, Jean Paul, Arentshorst, Mark, Nikolaev, Igor, Barends, Sharief, Ram, Arthur F.J., I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2016.02.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
I-SceI enzyme mediated integration (SEMI) for fast and efficient gene targeting in Trichoderma reesei
Jean Paul Ouedraogoa, 1, Mark Arentshorsta, Igor Nikolaevb, Sharief Barendsb and Arthur F.J. Rama
a
Molecular Microbiology and Biotechnology, Institute of Biology Leiden, Leiden University, Kluyver
Centre for Genomics of Industrial Fermentation , Sylviusweg 72, 2333 BE Leiden, the Netherlands b
Dupont Industrial Biosciences, Archimedesweg 30, 2333 CN Leiden, The Netherlands
1
present address: Center for Structural and Functional Genomics, Concordia University, 7141 Sherbrooke
St. W. Montreal, QC, H4B 1R6, Canada
Corresponding author: Arthur F.J. Ram e-mail: [email protected] Tel: +31 (0)71 5274914 Fax: +31 (0)71 5274999
1
Highlights
The NHEJ pathway in T. reesei is required for I-SceI-mediated double strand break repair Recombinant I-SceI can be added during transformation to create double strand breaks I-SceI-mediated integration in a NHEJ mutant is an efficient method targeted integration
Abstract We previously showed that creation of a double strand DNA break (DSB) by expressing I-SceI in an engineered Trichoderma reesei (Hypocrea jecorina) strain containing a I-SceI recognition site improved transformation and homologous integration efficiencies. In this study, we further improved homologous integration frequencies by combining I-SceI mediated double strand break with disruption of the tku70 gene. The inability of the tku70 mutant to repair a I-SceI mediated DSB via NHEJ was used to force integration of an expression cassette with homologous flanks surrounding the DSB site. Besides expressing I-SceI from a plasmid, we also show that adding I-SceI enzyme during transformation was successful to generate DSBs. The I-SceI enzyme mediated integration, or SEMI, in combination with a Δtku70 mutant has a synergistic effect on homologous recombination efficiencies as 90 to 100% of the transformants exhibited integration of the expression cassette at the homologous site.
Key Words: Hypocrea jecorina, non-homologous-end-joining, double strand break, homologous integration, ade1
1. Introduction Restriction-enzyme-mediated integration has been a useful method for generating non-homologous integration of transforming DNA into the chromosomes of eukaryotic cells (Kuspa and Loomis, 1992; Kuspa, 2006) including filamentous fungi (Sanchez et al. 1998; Sweigard et al. 1998). Currently, there are 2
four major sequence-specific gene editing technologies, which include i) meganucleases (Stoddard, 2014), ii) zinc finger nucleases (ZFNs) (Carroll, 2011), iii) the transcription activator-like effector nuclease (TALENs) (Jankele and Svoboda, 2014) and iv) the clustered regularly interspaced short palindromic repeats (CRISPR) with the CRISPR associated (Cas) nuclease (CRISPR-Cas9) (Hsu et al. 2014; Liu et al., 2015, Nødvig et al. 2015). All four nuclease types introduce a site specific double-strand break (DSBs) in the DNA, which is normally repaired by DNA repair mechanisms. Eukaryotic cells have two most prominent mechanisms to repair the broken DNA: i) the homologous recombination (HR) pathway that involves interaction between homologous sequences for break repair (Heyer et al. 2010; Amunugama and Fishel, 2012) and ii) the non-homologous end joining (NHEJ) pathway which is predominant in many organisms and repairs the DSB independently of DNA homology (Mao et al. 2008; Davis and Chen, 2013). In fungi, the best-characterized cellular components of homologous recombination system are the RAD proteins which function by coordination upon induction of DNA damage (Boiteux and Jinks-Robertson, 2013; Liu and Huang, 2014). The KU heterodimer, which consists of Ku70 and Ku80 proteins, plays an early role in the NHEJ pathway and has a high affinity to DNA ends (Stoddard, 2014). Ku70 or ku80 genes deletion lead to significant increase frequency of homologous recombination and has become an important tool to create gene disruption mutants with high frequency in filamentous fungi (Ninomiya et al. 2004; Nayak et al. 2006; Carvalho et al. 2010; Koh et al. 2014). In our previous study, we have shown that the expression of I-SceI and the subsequent creation of a double strand break (DSB) in a T. reesei strain with an engineered I-SceI restriction sites in its genome stimulate transformation frequency as well as homologous recombination efficiencies (Ouedraogo et al. 2015). In the present study, we combined deletion of tku70 gene with creating double strand breaks using the S. cerevisiae I-SceI meganuclease to further improve targeted integration frequencies. As our previous studies were carried out in the P37Δcbh1pyrG-26 strain (Ouedraogo et al. 2015), a tku70 deletion mutant was made in this background and verified (See Suppl. Figure 1 and 2 for details).
3
Deletion of the tku70 gene in the T. reesei P37Δcbh1pyrG-26 did not reveal apparent growth differences as reported earlier (Guangtao et al. 2009).
The effect of deletion of tku70 on homologous
recombination (HR) efficiency was tested by deleting the T. reesei ade1 gene (JGI ID: 43662) as the accumulation of a red pigment facilitates easy detection of correctly targeted transformants. Ade1 gene deletion cassettes were constructed (ade1::pyrG) with either 1.0-kb or 0.5-kb flanking regions by PCR as described in materials and methods and Suppl. Figure 3 and transformed to the tku70 mutant or its parental strain. The homologous recombination (HR) frequencies calculated from the efficiency by which ade1 mutants were obtained go up from 20% (4/20) in the parental to 100% (20/20) in the tku70 mutant when 1.0-kb flanks are used. Shortening the flanking regions to 0.5-kb yielded no ade1 mutants in the wild-type (18 transformants purified) and still 75% (15/20) successful homologous recombination (ade1 mutants) in the tku70 mutant and confirmed that deletion of the tku70 dramatically increases homologous recombination frequencies in T. reesei, similarly as found for other tku70 deletion strains (Guangtao et al. 2009).
We previously engineered a T. reesei strain with a I-SceI restriction site in its genome. The I-SceI restriction site was inserted at a predetermined site (cbh2 locus) using construct (pBJP6) which is schematically depicted in Figure 1a and Suppl. Figure 4. To investigate whether I-SceI mediated creation of a DSB in combination with inactivation of tku70 would further increase and improve homologous recombination frequencies, a PCR amplified linear fragment from pBJP6 containing the I-SceI restriction site was transformed to the ∆tku70 strain (JP11.3.4). Out of seven stable transformants, three transformants contained the complete pBJP6 cassette integrated into the cbh2 locus and transformant JP12.8 was selected for further analysis (Suppl. Figure 4). It was anticipated that the generation of double strand break in the Δtku70 mutant could be harmful to the cells as a DSB cannot be repaired by non-homologous end joining because of the tku70 deletion (McKinney et al. 2013). Indeed, despite several attempts, no transformants were obtained when the pTTT- ISceI expression plasmid was transformed to JP12.8 whereas transformant were obtained from 4
the same batch of protoplast in control transformations. The results is suggest that expression of I-SceI from the cbh1 promoter, even under non-inducing conditions (glucose), is sufficiently high to generate double strand DNA breaks, which are not efficiently repaired in the tku70 mutant, resulting in lethality. The inability to obtain JP12.8 transformants containing pTTT- ISceI restricted the possibility to assess whether the HR efficiency in ∆tku70 could be further improved by creating a double strand break via controlled I-SceI expression. For this purpose, it was therefore investigated whether addition of recombinant I-SceI during the transformation could improve homologous recombination efficiencies. First, we confirmed that the addition of I-SceI had a positive effect on homologous recombination efficiencies in a parental (functional tku70) background. To test HR frequencies, strain JP7.7 was transformed with linear fragment (pJP8) containing the glucoamylase expression cassette and the alS selection marker which can integrate via a double cross over event thereby replacing I-SceI /pyrG site for the alS selection marker (Figure 1). As shown in Table 2, the addition of I-SceI to protoplast of strain JP7.7 during transformation had a positive effect on obtaining stable transformants and increased homologous recombination efficiencies. The effect of adding I-SceI during the transformation is comparable to the effect of expressing I-SceI during transformation as reported previously (Ouedraogo et al. 2015). In a similar experiment, the Δtku70 mutant (JP12.8) was transformed with the homologous recombination cassette (pJP8) in the presence of increasing amounts of I-SceI. Even when no I-SceI was added, analysis of the transformants revealed that a substantial percentage of transformants (28%) were likely to be the result from a targeted integration event as these transformants showed a pyrG- phenotype (Table 2). The addition of I-SceI during transformation had a further positive effect of HR efficiencies in tku70 mutant leading to 90 to 100% homologous recombination frequencies when adding low concentrations of I-SceI (5 or 10 Units I-SceI per transformation). Higher amounts of I-SceI addition (25 Units of I-SceI per transformation or higher) turned out to be harmful to the tku70 protoplasts as the number of transformants obtained dropped significantly (Table 2). However, the stable transformants 5
obtained are likely to be the result from a targeted integration event as all transformants showed a pyrGphenotype. To analyze if the pyrG- transformants obtained after transformation, contain the glucoamylase expression cassette at the intended locus via a HR event, 18 pyrG- transformants were randomly selected from the different transformation experiments and analyzed for glucoamylase production and integration patterns. As shown in Figure 2, in all 18 pyrG- transformants, comparable levels of glucoamylase activity was measured in the culture fluid. In 18 randomly selected pyrG+ transformants, only four transformants produced glucoamylase with variable levels (Figure 2). Ten pyrG- transformants and five pyrG+ transformants randomly taken from the transformant analyzed for glucoamylase production (see above) were analyzed by Southern blot to determine the integration pattern of the glucoamylase cassette. As shown in Suppl. Fig. 5 all pyrG- transformants analyzed had the glucoamylase gene targeted integrated at the predefined locus. The pyrG+ transformants have the cassette randomly integrated into the genome according to the differences in integration pattern between the transformants. This study demonstrated the successful use of I-SceI enzyme to improve the transformation efficiency and targeted integration frequencies of the DNA cassette in both wild-type and tku70 mutant strains. The approach of using I-SceI enzyme is a variant of the restriction enzyme-mediated insertional (REMI) approach that has been used in several studies to increase the frequency of insertion mutagenesis in fungi (Manivasakam and Schiestl, 1998; Sanchez et al. 1998; Sweigard et al. 1998; Yaver et al. 2000). However, a major advantage of I-SceI enzyme mediated integration (SEMI) over REMI is that I-SceI cuts only once in the genome at a predetermined site. The SEMI gene targeting system is therefore well suitable for high throughput screening of enzyme variants or gene libraries in T. reesei and readily applicable to other fungal expression hosts.
Acknowledgement 6
We thank Bob Schepers for his helpful contributions to the project and Dr. Jaap Visser for helpful discussions. This project was carried out within the research programme of the Kluyver Centre for Genomics of Industrial Fermentation, which is part of the Netherlands Genomics Initiative/Netherlands Organization for Scientific Research. Contributors
References Ain, Q.U., Chung, J.Y., Kim, Y., 2015. Current and future delivery systems for engineered nucleases; ZFN, TALEN and RGEN. J. Control Release 205, 120-127. Amunugama, R., Fishel, R., 2012. Homologous recombination in eukaryotes. Prog. Mol. Biol. Transl. Sci. 110, 155-206. Boiteux, S., Jinks-Robertson, S., 2013. DNA repair mechanisms and the bypass of DNA damage in Saccharomyces cerevisiae. Genetics 193, 1025-1064. Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188, 773-782. Carvalho, N.D., Arentshorst, M., Jin Kwon, M., Meyer, V., Ram, A.F., 2010. Expanding the ku70 toolbox for filamentous fungi: establishment of complementation vectors and recipient strains for advanced gene analyses. Appl. Microbiol. Biotechnol. 87, 1463-1473. Davis, A.J., Chen, D.J., 2013. DNA double strand break repair via non-homologous end-joining. Transl. Cancer Res. 2, 130-143. Green, M.R., Sambrook, J., 2012. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, fourth ed. Cold Spring Harbor, New York.
7
Guangtao, Z., Hartl, L., Schuster, A., Polak, S., Schmoll, M., Wang, T., Seidl, V., Seiboth, B., 2009. Gene targeting in a nonhomologous end joining deficient Hypocrea jecorina. J. biotech. 139,146-151. Heyer, W.D., Ehmsen, K.T., Liu, J., 2010. Regulation of homologous recombination in eukaryotes. Annu. Rev. Genet. 44,113-139. Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278. Ichinomiya, M., Yamada, E., Yamashita, S., Ohta, A., Horiuchi, H., 2005. Class I and class II chitin synthases are involved in septum formation in the filamentous fungus Aspergillus nidulans Eukaryotic. cell 4,1125-1136. Jankele, R., Svoboda, P., 2014. TAL effectors: tools for DNA targeting. Brief. Funct. Genomics. 13, 409419. Jiang, D., Zhu, W., Wang, Y., Sun, C., Zhang, K.Q., Yang, J., 2013. Molecular tools for functional genomics in filamentous fungi: recent advances and new strategies. Biotechnol. Adv. 31, 1562-1574. Jin, F.J., Maruyama, J., Juvvadi, P.R., Arioka, M., Kitamoto, K., 2004. Adenine auxotrophic mutants of Aspergillus oryzae: development of a novel transformation system with triple auxotrophic hosts. Biosci. Biotechnol. Biochem. 68, 656-662. Koh, C.M., Liu, Y., Moehninsi, Du M., Ji, L., 2014. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol. 14:50. doi: 10.1186/1471-2180-14-50. Kuspa, A., Loomis, W.F., 1992. Tagging developmental genes in Dictyostelium by restriction enzymemediated integration of plasmid DNA. Proc. Natl. Acad. Sci. U S A, 89, 8803-8807. Kuspa, A., 2006. Restriction enzyme-mediated integration (REMI) mutagenesis. Methods Mol. Biol. 346, 201-209. Liu, R., Chen, L., Jiang, Y., Zhou, Z., Zou, G., 2015. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discovery 1, 15007. Liu, T., Huang, J., 2014. Quality control of homologous recombination Cellular and molecular life sciences: Cell Mol. Life Sci. 7, 3779-3797. Maier, F.J., Schafer, W., 1999. Mutagenesis via insertional- or restriction enzyme-mediated-integration (REMI) as a tool to tag pathogenicity related genes in plant pathogenic fungi. Biol. Chem. 380, 855-864. Manivasakam, P., Schiestl, R.H., 1998. Nonhomologous-end joining during restriction enzyme-mediated DNA integration in Saccharomyces cerevisiae. Mol. Cell. Biol. 18, 1736-1745. Mao, Z., Bozzella, M., Seluanov, A., Gorbunova, V., 2008. Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair (Amst) 7, 1765-1771. McKinney, J.S., Sethi, S., Tripp, J.D., Nguyen, T.N., Sanderson, B.A., Westmoreland, J.W, Resnick, M.A., Lewis, L.K., 2013. A multistep genomic screen identifies new genes required for repair of DNA double-strand breaks in Saccharomyces cerevisiae. BMC genomics 14:251. doi: 10.1186/1471-2164-14251. Meyer, V., Ram, A.F., Punt, P.J., 2010. in Manual of Industrial Microbiology and Biotechnology, Demain A.L., Davis J. (Eds.) third ed., John Wiley and Sons Inc., New York, pp. 318-329. 8
Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R., 2006. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172, 1557-1566. Ninomiya, Y., Suzuki, K., Ishii, C., Inoue, H., 2004. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. 101, 12248–12253. Nødvig C.S., Nielsen J.B., Kogle M.E., Mortensen U.H., 2015. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One. 10, e0133085. doi: 10.1371/journal.pone.0133085. Ouedraogo, JP., Arentshorst, M., Nikolaev I., Barends, S., Ram, A.F.J., 2015. I-SceI-mediated doublestrand DNA breaks stimulate efficient gene targeting in the industrial fungus Trichoderma reesei . Appl. Microbiol. Biotechnol. DOI: 10.1007/s00253-015-6829-1 Pan, F.C., Chen, Y., Loeber, J., Henningfeld, K., Pieler, T., 2006. I-SceI meganuclease-mediated transgenesis in Xenopus. Dev. Dyn. 235, 247-252. Penttila, M., Nevalainen, H., Ratto, M., Salminen, E., Knowles, J., 1987. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 61, 155-164. Sanchez, O., Navarro, R.E., Aguirre, J., 1998. Increased transformation frequency and tagging of developmental genes in Aspergillus nidulans by restriction enzyme-mediated integration (REMI). Mol. Genet. Genomics 258, 89-94. Semighini, C.P., von Zeska Kress Fagundes, M.R., Ferreira, J.C., Pascon, R.C., de Souza Goldman, M.H., Goldman, G.H., 2003. Different roles of the Mre11 complex in the DNA damage response in Aspergillus nidulans. Mol. Microbiol. 48, 1693-1709. Stoddard, B.L., 2014. Homing endonucleases from mobile group I introns: discovery to genome engineering. Mob. DNA 5:7. doi: 10.1186/1759-8753-5-7. Sweigard, J.A., Carroll, A.M., Farrall, L., Chumley, F.G., Valent, B., 1998. Magnaporthe grisea pathogenicity genes obtained through insertional mutagenesis. Mol. Plant Microbe Interact. 11, 404-412. Takahashi, T., Ogawa, M., Koyama, Y., 2012. Analysis of the functions of recombination-related genes in the generation of large chromosomal deletions by loop-out recombination in Aspergillus oryzae. Eukaryot. cell 11, 507-517. Thermes, V., Grabher, C., Ristoratore, F., Bourrat, F., Choulika, A., Wittbrodt, J., Joly, J.S., 2002. I-SceI meganuclease mediates highly efficient transgenesis in fish. Mech. Dev. 118, 91-98. Thon, M.R., Nuckles, E.M., Vaillancourt, L.J., 2000. Restriction enzyme-mediated integration used to produce pathogenicity mutants of Colletotrichum graminicola. Mol. Plant Microbe Interact. 13, 13561365. Ugolini, S., Bruschi, C.V., 1996. The red/white colony color assay in the yeast Saccharomyces cerevisiae: epistatic growth advantage of white ade8-18, ade2 cells over red ade2 cells. Curr. Genet. 30, 485-492. Yaver, D.S., Lamsa, M., Munds, R., Brown, S.H., Otani, S., Franssen, L., Johnstone, J.A., Brody, H., 2000. Using DNA-tagged mutagenesis to improve heterologous protein production in Aspergillus oryzae. Fungal Genet. Biol. 29, 28-37.
9
Figures
Figure 1. Schematic representation of targeted integration of the glucoamylase expression cassette via addition of I-SceI enzyme mediated homologous recombination. a) The strains JP7.7 and JP12.8 with ISceI restriction sites inserted at the cbh2 locus were used to test the targeted integration mediated by addition of I-SceI enzyme into the transformation mixture. b, c) Transformation of both strains with the glucoamylase expressing cassette (pJP8) with simultaneous addition of I-SceI enzyme to create DSB. d) The DSB can be repaired by homologous recombination with the glucoamylase expressing cassette which has homologous regions to the locus containing the I-SceI sites. e) A correct targeted integration would generate a strain which is resistant to chlorimuron ethyl (alS+), uridine auxotrophic (pyrG-) and is expected to express the glucoamylase gene under induction of PcbhI. Media to grow T. reesei strains and transformations were performed as described (Ouedraogo et al. 2015).
10
Figure 2. Glucoamylase activity in culture medium of transformants obtained after targeted or random integration. Targeted integration transformants of the glucoamylase cassette (pyrG- transformants) displayed high homogeneity of glucoamylase activity compared to random integration transformants (pyrG+ transformants). The targeted (n = 18) and random (n = 18) integrated transformants are pyrG- and pyrG+ phenotype, respectively. The pyrG- transformants were selected randomly from the different transformation experiments with the I-SceI enzyme. Plots were created using GraphPad Prism 6 (column scatter graph). The horizontal bars represent the mean values with standard deviations.
11
Table 1 Strains and plasmids used in this study Fungal strains
Genotype or description
Source or reference
RL-P37∆cbhIpyrG-26
pyrG-, cbhI-
DuPont bioscience
JP11.3
Δtku70::pyrG
This study
JP11.3.4
Δtku70-, pyrG-
This study
JP7.7
RL-P37∆cbhIpyrG-26 with I-SceI restriction sites cassette integrated at cbh2 locus
Ouedraogo et al., 2015
JP12.8
JP11.3.4 with I-SceI restriction sites cassette integrated at cbh2 locus
This study
pBJP3
tku70::pyrG deletion cassette
This study
pBJP6
I-SceI restriction site cassette
Ouedraogo et al., 2015
pCRpyrGAN
Containing the full gene of A. nidulans pyrG
Ouedraogo et al., 2015
pTTT
cbhI promoter and amdS selection marker
DuPont Bioscience
pTTT-ISceI
I-SceI under control of the inducible cbh1 promoter with amdS selection
Ouedraogo et al., 2015
pJP8
T. reesei glucoamylase cassette with homologous regions to the I-SceI restriction site cassette
Ouedraogo et al., 2015
Plasmids
12
Table 2. The effect of I-SceI enzyme addition on transformation efficient, stability and homologous integration frequencies (HRF) in tku70+ (JP7.7) and Δtku70- (JP12.8) T. reesei strains
No I-SceI added 5Ud 10U 25 U 50 U 100 U
# of primary transformantsa JP7.7 JP12.8 19 22 31 34 42 40 49 23 56 16 70 3
% stable transformantsb JP7.7 13/19 19/20 20/20 19/20 18/20 20/20
68% 95% 100% 95% 90 % 100%
JP12.8 18/20 90% 20/20 100% 20/20 100% 13/20 65% 13/16 81% 2/3 66%
pyrG- transformants (HRF efficiency)c JP7.7 JP12.8 0/13 0% 5/18 28% 4/19 21% 18/20 90% 6/20 30% 18/20 90% 11/19 58% 13/13 100% 14/18 78% 13/13 100% 17/20 85% 2/2 100%
a
Number of primary transformants on transformation plate. Numbers of primary transformants are shown for the same protoplast batch to be able to compare efficiencies. Results for a typical experiment are shown. b
Primary transformants were purified on selective medium (TrMM + uridine + alS substrate). Stable transformants grow well on these plates. Abortive transformants (not stable) do not grow.
c Stable transformants were tested for the pyrG- phenotype by inoculating spores of each transformant on trMM with uridine or trMM without uridine. The efficiency of targeted integration was determined by scoring transformants which have lost the pyrG selection marker (Suppl. Figure 5). To confirm the targeted integration of the glucoamylase cassette, transformants were further analyzed by Southern blot and for glucoamylase production as described (Ouedraogo et al. 2015). d
Protoplast transformation which included the addition of I-SceI (Thermo scientific) were performed as follows: to 200µL of protoplasts, different amounts of I-SceI enzyme (5 to 100 Units) plus 4 µg of linearized pJP8 cassette, 30µL (1x final concentration) enzyme buffer and water was added to give a final volume of the protoplast mixture of 300µL which was incubated for 15 minutes at room temperature followed by a 20 minutes incubation on ice. After the 35 minutes of incubation, the protoplast mixture was plated out on transformation plate containing 10mM uridine and 5µg/ml of chlorimuron ethyl (alS substrate) (Ouedraogo et al. 2015).
13
Supplemental Table 1. Primers used in this study Primers name
f/r
Sequence (5’to 3’oriented)
Remark
Template
P1 (ClaI)
f
CCATCGATGGGGCCCTTTGCAATGTAGTTC1
Amplification of 5’flank tku70
gDNA QM6a
P2
r
GGTTTCAGCCTTCACAGTTC
Amplification of 5’flank tku70
gDNA QM6a
f
GAACTGTGAAGGCTGAAACCCATTGTCCTCACGGG ACTTG2
Amplification of 500 bps DR
gDNA QM6a
P4 (XbaI)
r
GCTCTAGAGCGCTGGAGAGGAAATCCATAG
Amplification of 500 bps DR
gDNA QM6a
P5 (XbaI)
f
GCTCTAGAGCCATTGTCCTCACGGGACTTG
Amplification of 3’flank tku70
gDNA QM6a
r
ATAAGAATGCGGCCGCTAAACTATTCTGATCGGCA GCATCCTTC
Amplification of 3’flank tku70
gDNA QM6a
P7 (XbaI)
f
GCTCTAGAGCTCGCCCTTGCTCTAGATAAC
Amplification of the selection marker
pCRpyrGAN
P8 (XbaI)
r
GCTCTAGAGCAATTCGCCCTTGACTAGTGC
Amplification of the selection marker
pCRpyrGAN
Ade1_P1_500
f
AGTAGCAGCAGCAACACAG
Amplification of 5’ade1 500 bps frank
gDNA QM6a
Ade1_P1_1000
f
GGATGCGAATCAGGAGTC
Amplification of 5’ade1 1000 bps frank
gDNA QM6a
Rev_5’ade1
r
GTGATGGTGGTGGTGTAG
Amplification of 5’ade1 frank
gDNA QM6a
f
CATCACCACCACTACCGTCACCTCGCCCTTGCTCTA GATAAC
Amplification of 5’pyrG marker fragment
pCRpyrGAN
r
TCCGCAGACGTTACTACTTC
Amplification of 5’pyrG marker fragment (for split marker fragment 1)
pCRpyrGAN
Ade1_P3
f
CAAAGGCAACGACGTGCG
Amplification of 3’ade1 frank
gDNA QM6a
Ade1_P4_500
r
AGCAGGATCGAGCTCATC
Amplification of 3’ade1 500 bps frank
gDNA QM6a
Ade1P4_1000
r
CACATGCACTCGGTATGC
Amplification of 3’ade1 1000 bps frank
gDNA QM6a
f
CCCTTATCCGACAGATTCAC
Amplification of 3’pyrG marker fragment (for split marker fragment 2)
pCRpyrGAN
r
CACGCACGTCGTTGCCTTTGTAATTCGCCCTTGACT AGTGC
Amplification of 3’pyrG marker fragment
pCRpyrGAN
P3
P6 (NotI)
pyrG-5’ade1 Rev_pyrG_1205
Fw_pyrG_599 pyrG_rev_3’ade1
1
Restriction sites are given in italic
2
Underlined sequences within the primers are complementary sequence for performing the fusion PCR
14
Legends to Supplemental Figures
Supplemental Figure 1. Schematic construction of the tku70 deletion cassette and strategy for recycling the ANpyrG selection marker. a) Schematic construction of the deletion cassette with double repeats (DRs) and cloning into pBluescript SK (+). Primers are found in Supplementary Table 1. b) The uridine auxotrophic marker pyrG of A. nidulans, flanked with a 500-bp sequence of the 3’UTR of the tku70 gene (DRs, marked by a black box) was integrated into the tku70 gene by homologous recombination (1). The resulting strain JP11.3 with disrupted tku70 open reading frame and uridine auxotrophic phenotype was further plated on minimal medium containing 1.5 mg/ml FOA to select the ANpyrG loop out colonies (2). The ANpyrG marker gene looped out via single crossover between the DRs and a marker free ∆tku70 strain is generated (JP11.3.4) (3).
Supplemental Figure 2. Deletion of tku70 open reading frame and efficient loop out of the ANpyrG selection marker. (a, b and c) Graphical representation of the tku70 open reading frame before deletion, after deletion and after loop out of the ANpyrG selection marker respectively. In panel a, the tku70 open reading frame is illustrated as an arrow. The 500 bps of the 3’ flank is showing by a black box and is used to flank the ANpyrG marker for efficient loop out after deleting the tku70 open reading frame (panels b and c). The 500 bps 3’flank is used as probe and the position is shown in all panels as the black box. (d) Southern blot analysis of 6 transformants for deletion of the tku70 open reading frame (lane 1 to 6 represent respectively JP11.1, JP11.2, JP11.3, JP11.4, JP11.5, JP11.6) and the parental strain RLP37∆cbhIpyrG-26 (line 7). The expected band sizes are 4.7 kb and 1.29 kb for the disrupted mutant and 2.9 kb for the wild-type tku70 locus. (e) Southern blot analysis for efficient loop out of the ANpyrG marker in 4 transformants (lane 1 to 4 represent respectively JP11.3.4, JP11.3.3, JP11.3.2, JP11.3.1 ) and the parental strain JP11.3 (line 5). The expected bands size on the blot when the pyrG marker is looped 15
out is 3.7 kb. A non-loop out of the ANpyrG marker is characterized by the bands size of 4.7 kb and 1.29 kb. Smalls bars point to relevant fragment sizes. The primers used for PCR amplifications are listed in Suppl. Table 1.
Supplemental Figure 3. Schematic construction of the ade1 deletion cassette for gene knock out by fusion PCR approach. The homologous sequences of ade1 gene were fused with the A. nidulans pyrG gene used as selection marker to obtain the ade1 deletion cassette which is used to knock out the ade1 gene by homologous recombination. The construction of ade1 gene deletion cassettes with either 500 or 1000 bps 5’and 3’flanks were constructed by fusion PCR using oligonucleotides listed in Suppl. Table 1. PCR amplified fragments were purified and directly used for transformation. Stables transformants were obtained by streaking on TrMM plates containing the required selection pressure for two successive rounds. Single colonies obtained as such were selected for further analysis. Transformation medium for ade1 deletion was supplemented with 200mg/L of adenine. In order to visualize the red pigment due to ade1 deletion, 10mg/L of adenine was supplemented to the purification medium.
Supplemental Figure 4. Southern blot analysis of transformants containing the I-SceI restriction sites cassette in the genome of JP11.3.4 (∆tku70, pyrG-). (a) Graphical representation of the complete I-SceI restriction sites cassette (pBJP6) in the genome of T. reesei. (b) Southern blot analysis of seven transformants (lane 1 to 7 represent respectively JP12.3, JP12.4, JP12.5, JP12.6, JP12.7, JP12.8 and JP12.9) and the parental strain RL-P37∆cbhIpyrG-26 (lane 8). Genomics DNAs were digested with PstI and hybridized with the probe Pcbh1. 6.3 kb is the expected band size of the integrated I-SceI restriction sites cassette. The probe is not binding to the parental strain lacking PcbhI.
16
Supplemental Figure 5. Southern blot analysis of selected transformants after transformation with the glucoamylase expression cassette (a): Graphical representation of pJP8 transformants to analyze integration of the glucoamylase cassette at the 5' flank and 3' flank of the cbh2 locus by using SpeI and BamHI as restriction enzyme and PcbhI and Tcbh2 as probe respectively. The expected band size is 5.4 kb for integration of the glucoamylase cassette at the 5' flank and 6.8 kb for integration at 3' flank. A nonhomologous integration of the glucoamylase cassette will not alter the cbh2 locus and a hybridizing DNA fragment of 3.6 kb and 3 kb are expected with probe A and probe B respectively. (b) Southern blot results of pJP8 transformants to analyze the integration of the glucoamylase cassette at the 5' flank (left blot) and 3' flank (right blot) of the cbh2. Line 1 to 10 represent targeted integrated transformants and Line 11 to 15 represent random integrated transformants with a pyrG+ phenotype.
17