γ-lyase from Lactococcus lactis ssp. cremoris MG13631

FEMS Microbiology Letters 182 (2000) 249^254

www.fems-microbiology.org

Identi¢cation and characterization of a cystathionine L/Q-lyase from Lactococcus lactis ssp. cremoris MG13631 Nada Dobric a , Ga«etan K.Y. Limsowtin b , Alan J. Hillier Barrie E. Davidson a; *

c;e

, Nicholas P.B. Dudman d ,

a

d

Department of Biochemistry and Molecular Biology, The University of Melbourne, Parkville, Vic. 3052, Australia b Australian Starter Culture Research Centre Ltd., Private Bag 16, Werribee, Vic. 3030, Australia c Food Science Australia, Private Bag 16, Werribee, Vic. 3030, Australia Centre for Thrombosis and Vascular Research, University of New South Wales, Prince Henry Hospital, Little Bay, N.S.W. 2036, Australia e Department of Food Science and Agribusiness, The University of Melbourne, Parkville, Vic. 3052, Australia Received 11 August 1999 ; received in revised form 9 November 1999; accepted 11 November 1999

Abstract This paper describes the nucleotide sequence of a gene encoding cystathionine L/Q-lyase from Lactococcus lactis ssp. cremoris MG1363, its overexpression in Escherichia coli and some functional characteristics of the purified recombinant protein. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Lactic acid bacterium; Cystathionine lyase; Cheese £avor; Amino acid derivatization

1. Introduction Cheddar cheese maturation is a process involving the breakdown and metabolism of fats, carbohydrates and proteins. Proteolysis occurs as a result of indigenous milk proteinases, introduced calf rennet/chymosin and reactions of the proteolytic enzymes of lactic acid bacteria [1,2]. The bacterial enzymes are essential in producing `typical' cheese £avors in mature cheese (for a review, see [3]). Proteolysis and the subsequent metabolism of amino acids results in the formation of low molecular mass compounds which give the greatest intensity to cheese £avor [4]. These volatile and non-volatile compounds include amines, amino acids, K-oxo acids and sulfur compounds and their formation is postulated to be catalyzed by bacterial enzymes [5^7]. Sulfur compounds (particularly methanethiol and hydrogen sul¢de) are components of cheddar cheese £avor [6,8,9], and enzymes involved in the metabolism of sulfur containing amino acids may therefore have a major role in

the formation of £avor compounds during cheese ripening [10,11]. Cystathionine lyase, which is involved in methionine biosynthesis [12], has been puri¢ed from a number of organisms, including Lactococcus lactis ssp. cremoris B78 and Lactobacillus fermentum DT41 [13,14]. The Q-lyase converts cystathionine to cysteine, K-oxobutyrate and ammonia via an K,Q-elimination reaction. The L-lyase converts cystathionine to homocysteine, pyruvate and ammonia via an K,L-elimination reaction. Cystathionine lyases from various sources have shown to have great sequence similarities [15,16] and broad substrate speci¢cities, one of which results in the production of methanethiol from methionine. This paper describes the identi¢cation and characterization of a cystathionine lyase from L. lactis ssp. cremoris MG1363. This enzyme has the unique ability to carry out both the K,L-elimination and K,Q-elimination reactions on the cystathionine substrate. 2. Materials and methods 2.1. Bacterial strains and culture conditions

* Corresponding author. Tel. : +61 (3) 9344 5912; Fax: +61 (3) 9347 7730; E-mail : [email protected] 1

Dedicated to the memory of Dr. K. Harmark.

L. lactis ssp. cremoris MG1363 (plasmid free derivative of L. lactis ssp. cremoris NCDO 712) [17] was grown in M17 medium [18] supplemented with 0.5% (w/v) glucose at

0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 5 9 9 - 6

FEMSLE 9173 22-12-99

250

N. Dobric et al. / FEMS Microbiology Letters 182 (2000) 249^254

30³C and stored at 320³C in skim milk (10% (w/v) solution of skim milk powder). Escherichia coli strains JM107 (endA1 gyrA96 thi-1 hsdR17 supE44 relA1vlac-proAB [FP traD36 proAB lacIq ZvM15]50) [19] and BL21(DE3) 3 (F3 hsdS gal (r3 B mB ) (V lacUV5-gene 1 cloned in int nin5) [20] were grown in Luria Bertani medium [21] at 37³C with shaking, and stored in 15% (v/v) glycerol at 370³C. 2.2. General procedures Routine molecular biology procedures were as described by Sambrook et al. [21]. L. lactis chromosomal DNA was isolated from crude cell lysates as described by Leblanc and Lee [22]. Puri¢cation of DNA from agarose gels, plasmid DNA and PCR products were all conducted with Qiagen kits (Qiagen, Germany). Inverse PCR of EcoR1 restriction fragments of L. lactis DNA was performed as described previously [23] using `touchdown' conditions [24]. 2.3. Recombinant protein puri¢cation The growth, induction and overexpression of the putative cystathionine Q-lyase gene (cgl), cloned into pET22b, was as described in the pET system manual (Novagen, USA). The His-tagged Cgl protein, present in the soluble fraction of the cell lysate, was puri¢ed by TALON1 metalchelation chromatography (Clontech, USA) according to the manufacturer's instructions, dialyzed against 20 mM potassium phosphate pH 7.6 and 1 mM EDTA and concentrated using Centricon 10 ¢lters (Amicon, USA). Protein concentration was determined by the Bradford method [25]. 2.4. Enzyme assays for cystathionine lyase The standard reaction mix (250 Wl) contained 0.1 M Tris pH 8.0, 0.02 mM pyridoxal 5P-phosphate (PLP), 50 mM 5,5P-dithiobis(2-nitrobenzoic acid) (DTNB), 25 mM substrate and enzyme. Reactions were performed at 30³C for 60 min in a THERMOmax microplate reader (Molecular Devices, CA, USA) and analyzed at 410 nm. Activity was measured by the production of free thiol groups [26], the production of keto-acids [27] or the production of ammonia (Ammonia Determination kit, Boehringer Mannheim).

et al. [28] and (ii) derivatization using the £uorescent 7benzo-2-oxa-1,3-diazole-4-sulfonic acid (SBD-F) as described by Dudman et al. [29]. 2.6. Gas chromatography (GC) Methanethiol was detected on a Perkin-Elmer Gas Chromatograph and headspace sampler HS40, with £ame ionization detection and a 25-m dimethyl polysiloxane 100% 25QC5/BP1-5.0 column (SGE). The run pro¢le was as follows : 40³C for 2 min followed by a 10³C min31 increase until 180³C was reached, where this temperature was maintained for 3 min. 3. Results and discussion 3.1. Isolation and sequence of cystathionine lyase Cgl protein sequences from Saccharomyces cerevisiae, Bacillus subtilis, Mycobacterium leprae, Stenotrophomonas maltophilia and Streptomyces coelicolor were aligned and two degenerate oligonucleotide primers ND20 and ND22 (Table 1) were designed based on the amino acid sequences ETPT /S NP and MTHASI /T , respectively. A product of V600 bp was obtained when these primers were used in the PCR with L. lactis ssp. cremoris MG1363 genomic DNA. The PCR product was cloned into the vector pGEM-T (Promega) and the nucleotide sequence of the cloned insert showed signi¢cant similarity to various PLP-dependent enzymes. This cloned fragment hybridized to a 4.0-kb EcoR1 fragment of MG1363 genomic DNA. The remainder of the putative cgl was cloned by inverse PCR, by self ligating EcoR1 digests of MG1363 genomic DNA and ampli¢cation with the primers ND25 and ND26 (Table 1) which were V350 bp apart. Therefore, the predicted size of the required PCR product was V3.7 kb. The 3.7-kb amplicon was ampli¢ed using a `touchdown' PCR procedure, extracted from a low melt temperature agarose gel, quantitated and used as the template for nucleotide sequencing. The nucleotide sequence of the putative cgl was determined by chromosomal walking. The gene was found to contain a 1140-bp open reading frame (GenBank accession number: AF170901) encoding a protein of 380 amino

Table 1 Oligonucleotide primers used in this study (Bresatec, Australia)

2.5. Determination of cysteine and homocysteine Cystathionine is converted to cysteine by the cystathionine Q-lyase reaction and to homocysteine via the cystathionine L-lyase reaction. Homocysteine and cysteine were detected as products of the enzyme reaction with the puri¢ed recombinant protein by two methods: (i) analysis of DTNB-derivatized products as described by Bruinenberg

Primer identi¢cation

Primer sequence (5P-3P)

ND20 ND22 ND25 ND26 ND29 ND31

GAAACT /A CCT /A ACT /A AAT /C CC A A /T /G TT /A GAT /A GCG /T TGT /A GTCAT

FEMSLE 9173 22-12-99

GGCTGAATCACTAGGTGGCG CCACCTAAATATTTCGTTGCGG AAAAGGGCATATGACAAGTATAA CTGTCAGTACTCGAGTTTTTTTTCAAG

N. Dobric et al. / FEMS Microbiology Letters 182 (2000) 249^254

251

Fig. 1. Multiple sequence alignment of PLP-dependent enzymes of known function. Abbreviations are: Lac.CBGL : L. lactis ssp. cremoris Cbgl; Eco.CGS: E. coli cystathionine Q-synthase; Scer.CGL : S. cerevisiae cystathionine Q-lyase; Pput.MGL : P. putida methionine Q-lyase; Eco.CBL: E. coli cystathionine L-lyase. (*) Indicates identical amino acids; (.) indicates similar amino acids, (#) lysine residue of the PLP binding site ; arrows depict positions of primers ND20 and ND22.

acids (Fig. 1) with a predicted subunit molecular mass of 40 937 kDa. This is similar to other known PLP-dependent enzymes from various organisms (e.g. [30,31]). PLP-dependent enzymes have been classi¢ed into the K, L and Q families on the basis of sequence alignments and construction of protein pro¢les [15]. The amino acid sequence encoded by the putative cgl showed signi¢cant similarity to the Q family of PLP-dependent enzymes [15] including cystathionine L-lyase (E. coli; 32% identity), cystathionine Q-lyase (S. cerevisiae; 37% identity), cystathionine Q-synthase (E. coli; 34% identity) and methionine Qlyase (Pseudomonas putida; 40% identity) (Fig. 1). Several highly conserved regions in the Q family of PLP-dependent enzymes were also observed in the L. lactis amino acid sequence, with a high degree of homology surrounding Table 2 Substrate speci¢city of the recombinant Cbgl from L. lactis ssp. cremoris MG1363 Substrate

Relative activity (%)a

L-Cystine

133 131 100 24 15 NDd

Lanthionineb L-Cystathionine L-Djenkolic acid L-Cysteine c DL-Methionine

a

One unit (U) of enzyme activity will produce 1 nmol of keto-acid min31 at 30³C where 100% was equivalent to 11.5 Wmol min31 mg31 . b A mixture of DD, LL and meso isomers. c Slight activity was detected using the thiol assay. d Not detectable ( 6 100 nmol min31 mg31 ) for substrates L-homoserine, S-methyl L-cysteine, L-homocysteine and DL-methionine.

the lysine that binds the cofactor PLP and associated active site residues. The E. coli cystathionine L-lyase crystal structure has been determined [16] and exhibits a similar folding pattern and domain organization to aminotransferase enzymes belonging to the K family of PLP-dependent enzymes, which indicates an evolutionary link between the K and Q families [15,16]. Enzymatic studies were carried out on the putative Cgl to con¢rm its identity and function. 3.2. Overexpression and puri¢cation The putative cgl was ampli¢ed by PCR, using primers ND29 and ND31 (Table 1) to introduce NdeI and XhoI sites, respectively, and cloned into the E. coli expression plasmid pET22b. The nucleotide sequence of the clone was determined and comparison with the wild-type sequence identi¢ed an ACG transition at position 37, which resulted in an I13V mutation. This position can tolerate a wide range of di¡erent amino acids (Fig. 1) and the crystal structure of the E. coli cystathionine L-lyase indicates that it is not involved in either the active site, PLP binding, substrate binding or catalytic activity of the protein [16]. This plasmid was cloned into E. coli BL21(DE3) (Novagen, USA) and the His-tagged protein expressed and puri¢ed as described in Section 2 (Fig. 2). 3.3. Protein characterization Cystathionine lyase catalyzes the conversion of cystathionine to ammonia, a keto-acid and a thiol compound.

FEMSLE 9173 22-12-99

252

N. Dobric et al. / FEMS Microbiology Letters 182 (2000) 249^254

The ability of the recombinant enzyme to degrade various substrates was tested by assaying for the generation of these products (Table 2). The reaction rate decreased in the order L-cystine s lanthionine s L-cystathionine s Ldjenkolic acid s L-cysteine s DL-methionine. No activity was detected with homocysteine as substrate. The overall substrate speci¢city is similar to that of cystathionine Q-lyase from L. fermentum DT41 [13] and cystathionine L-lyase from L. lactis ssp. cremoris B78 [14]. Most of the above substrates are only involved in K,Lelimination except cystathionine which is a substrate for both the K,L- and K,Q-elimination. The speci¢c activity of the puri¢ed enzyme towards cystathionine as a substrate was 11.5 Wmol min31 mg31 (Table 2). The expected products of the enzyme-catalyzed K,L- and K,Q-elimination reactions with cystathionine are homocysteine (Hcy) and cysteine (Cys), respectively. DTNB reacts with free thiol to give a mixed disul¢de plus 2-nitro-5thiobenzoic acid (TNB). In order to identify the enzyme as a cystathionine L- or Q-lyase, the DTNB-derivatized products were separated and quantitated by high performance liquid chromatography (HPLC) (Fig. 3). Preliminary experiments showed that the cysteine derivative (CysTNB), the homocysteine derivative (Hcy-TNB) and TNB eluted at 18.4 þ 0.4, 24.8 þ 0.5 and 25.6 þ 0.7 min, respectively. When the products of the enzymic reaction were resolved by HPLC, the main peaks eluted at 18.4, 24.7 and 25.6 min (Fig. 3C). From analysis of these data and the use of appropriate standards, it was calculated that 20 nmol of cystathionine was converted to 8.8 nmol of Hcy-

Fig. 3. HPLC separation of DTNB-derivatized products. A: L-Homocysteine reacted with DTNB ; B: L-Cysteine reacted with DTNB; C: Recombinant enzyme reaction using cystathionine as a substrate, with DTNB, for 60 min.

Fig. 2. The puri¢ed recombinant Cbgl protein following a¤nity chromatography.

TNB and 10.6 nmol of Cys-TNB (from Fig. 3C). Similar results were obtained using the SBD-F derivatization method (data not shown). These data indicate the enzyme catalyzes both the K,L- and K,Q-elimination reactions equally well and is a mixed cystathionine L/Q-lyase (Cbgl). This dual catalytic activity on the same substrate has not been observed previously. Other PLP-dependent enzymes, such as the L-methionine Q-lyase from P. putida [32] and the cystathionine L-lyase from L. lactis ssp. cremoris B78 [14], can carry out the K,L- and K,Q-elimination reactions on di¡erent substrates, but these activities have not been observed on a single substrate. The ability of the Cbgl from L. lactis to catalyze both reactions has signi¢cance for substrates such as methionine and cysteine. The degradation of methionine for 24 h at 30³C by the K,Qelimination reaction resulted in the formation of a low concentration of methanethiol, which was detected in the headspace of the reaction vial (Fig. 4). Alternatively, when cysteine was a substrate for the K,L-elimination reaction, hydrogen sul¢de was detected (data not shown). These two sulfur compounds may have a signi¢cant role in cheddar cheese £avor.

FEMSLE 9173 22-12-99

N. Dobric et al. / FEMS Microbiology Letters 182 (2000) 249^254

253

Fig. 4. Detection of methanethiol as the product of the recombinant Cbgl reaction using methionine as substrate. A: Pure methanethiol eluted at 6.77 min ; B: Reaction product with methanethiol eluting at 6.8 min; C: No substrate control.

Acknowledgements We would like to thank Ms. Lijuan Xie for performing the HPLC using SBD-F derivatization. Thank you to Dr. Malcolm Broome for assistance with the GC and HPLC apparatus, and to Dr. Richard Pau for critical reading of the manuscript.

References [1] Olson, N.F. (1990) The impact of lactic acid bacteria on cheese £avor. FEMS Microbiol. Rev. 87, 131^148. [2] Kunji, E.R.S., Mierau, I., Hagting, A., Poolman, B. and Konings, W.N. (1996) The proteolytic systems of lactic acid bacteria. Antonie van Leewenhoek 70, 187^221. [3] Visser, S. (1993) Proteolytic enzymes and their relation to cheese ripening and £avor: an overview. J. Dairy Sci. 76, 329^350. [4] Rank, T.C., Grappin, R. and Olson, N.F. (1985) Secondary proteolysis of cheese during ripening: a review. J. Dairy Sci. 68, 801^805. [5] Urbach, G. (1993) Relations between cheese £avour and chemical composition. Int. Dairy J. 3, 389^422.

[6] Urbach, G. (1995) Contribution of lactic acid bacteria to £avour compound formation in dairy products. Int. Dairy J. 5, 877^903. [7] Cli¡e, A.J., Marks, J.D. and Mulholland, F. (1993) Isolation and characterization of non-volatile £avours from cheese: peptide pro¢le of £avour fractions from cheddar cheese, determined by reversephase high-performance liquid chromatography. Int. Dairy J. 3, 379^387. [8] Kim, S.C. and Olson, N.F. (1989) Production of methane thiol in milk fat-coated microcapsules containing Brevibacterium linens and methionine. J. Dairy Res. 56, 799^811. [9] Lindsay, R.C. and Rippe, J.K. (1986) Enzymic generation of methanethiol to assist in the £avor development of Cheddar cheese and other foods. In: Biogeneration of Aromas (Parliment, T.H. and Croteau, R., Eds.), ACS Symposium Series No. 317, pp. 286^308. American Chemical Society, Washington, DC. [10] Flavin, M. (1975) Methionine biosynthesis. In: Metabolism of Sulfur Compounds, 3rd edn., Vol. 7 (Greenberg, D.M., Ed.), pp. 457^503. Academic Press, New York. [11] Dias, B. and Weimer, B. (1998) Conversion of methionine to thiols by Lactococci, Lactobacilli, and Brevibacteria. Appl. Environ. Microbiol. 64, 3320^3326. [12] Gao, S., Mooberry, E.S. and Steele, J.L. (1998) Use of 13 C nuclear magnetic resonance and gas chromatography to examine methionine catabolism by Lactococci. Appl. Environ. Microbiol. 64, 4670^4675. [13] Smacchi, E. and Gobbetti, M. (1998) Puri¢cation and characteriza-

FEMSLE 9173 22-12-99

254

[14]

[15]

[16]

[17]

[18] [19]

[20]

[21]

[22] [23]

N. Dobric et al. / FEMS Microbiology Letters 182 (2000) 249^254 tion of cystathionine Q-lyase from Lactobacillus fermentum DT41. FEMS Microbiol. Lett. 166, 197^202. Alting, A.C., Engels, W.J.M., van Schalkwijk, S. and Exterkate, F.A. (1995) Puri¢cation and characterization of cystathionine L-lyase from Lactococcus lactis subsp. cremoris B78 and its possible role in £avor development in cheese. Appl. Environ. Microbiol. 61, 4037^4042. Alexander, F.W., Sandmeier, E., Mehta, P.K. and Christen, P. (1994) Evolutionary relationships among pyridoxal-5P-phosphate-dependent enzymes: regio-speci¢c K, L, and Q families. Eur. J. Biochem. 219, 953^960. Clausen, T., Huber, R., Laber, B., Pohlenz, H. and Messerschmidt, A. (1996) Crystal structure of the pyridoxal-5P-phosphate dependent î . J. Mol. Biol. cystathionine L-lyase from Escherichia coli at 1.83 A 262, 202^224. Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154, 1^9. Terzaghi, B.E. and Sandine, W.E. (1975) improved medium for lactic streptococci and their bacteriophages. Appl. Microbiol. 29, 807^813. Yannisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103^119. Studier, F.W. and Mo¡at, B.A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113^130. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Leblanc, D.J. and Lee, L.N. (1979) Rapid screening procedure for detection of plasmids in Streptococci. J. Bacteriol. 140, 1112^1115. Silver, J. (1991) Inverse polymerase chain reaction. In: PCR: A Prac-

[24]

[25]

[26] [27]

[28]

[29]

[30]

[31]

[32]

tical Approach (McPherson, M.J., Quirke, P. and Taylor, G.R., Eds.), pp. 137^146. Oxford University Press, New York. Roux, K.H. (1995) Optimization and troubleshooting in PCR. In: PCR Primer: A Laboratory Manual (Die¡enbach, C.W. and Dveksler, G.S., Eds.), pp. 53^62. Cold Spring Harbor Laboratory Press, New York. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248^254. Uren, J.R. (1987) Cystathionine L-lyase from Escherichia coli. Methods Enzymol. 143, 483^486. Soda, K. (1968) Microdetermination of D-amino acids and D-amino acid oxidase activity with 3-methyl-2-benzothiazolone hydrazone hydrochloride. Anal. Biochem. 25, 228^235. Bruinenberg, P.G., De Roo, G. and Limsowtin, G.K.Y. (1997) Puri¢cation and characterization of cystathionine Q-lyase from Lactococcus lactis subsp. cremoris SK11: possible role in £avor compound formation during cheese maturation. Appl. Environ. Microbiol. 63 (2), 561^566. Dudman, N.P.B., Guo, X.W., Crooks, R., Xie, L. and Silberberg, J.S. (1996) Assay of plasma homocysteine: light sensitivity of the £uorescent 7-benzo-2-oxa-1,3-diazole-4-sulfonic acid derivative, and use of appropriate calibrators. Clin. Chem. 42, 2028^2032. Ono, B., Kijima, K., Inoue, T., Miyoshi, S., Matsuda, A. and Shinoda, S. (1994) Puri¢cation and properties of Saccharomyces cerevisiae cystathionine L-synthase. Yeast 10, 333^339. Dias, B. and Weimer, B. (1998) Puri¢cation and characterization of L-methionine Q-lyase from Brevibacterium linens BL2. Appl. Environ. Microbiol. 64, 3327^3331. Tanaka, H., Esaki, N. and Soda, K. (1985) A versatile bacterial enzyme: L-methionine Q-lyase. Enzym. Microb. Technol. 7, 530^537.

FEMSLE 9173 22-12-99