Identification and characterization of a novel U14 small nucleolar RNA gene cluster in Oryza sativa

Gene 294 (2002) 187–196 www.elsevier.com/locate/gene

Identification and characterization of a novel U14 small nucleolar RNA gene cluster in Oryza sativa Ge Jiang, Xianglong Chen, Wei Li, Youxin Jin*, Debao Wang State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences, 320 Yue-Yang Road, Shanghai 200031, China Received 21 January 2002; received in revised form 4 April 2002; accepted 6 June 2002 Received by W. Makalowski

Abstract Small nucleolar RNAs (snoRNAs) are required for ribose 2 0 -O-methylation of eukaryotic ribosomal RNA. Through computer search in international rice genome database, a novel U14 snoRNA gene cluster, consisting of two U14 snoRNA gene candidates, was found on rice chromosome II. They both have box C/D sequences and a 14 nucleotides (nt)-long complementarity to rice 18S ribosomal RNA (rRNA). Functional analysis of this gene cluster indicated that both were transcribed in vivo and might guide the methylations of C418 in rice 18S rRNA. By using primer extension, 5 0 and 3 0 rapid amplification of cDNA ends, the 5 0 and 3 0 ends of two snoRNAs were determined. The 52 nt long intergenic spacer of the gene cluster is rich in uridine. The absence of a conserved promoter element in this spacer, the proximity of the genes and the detection of transcripts containing linked U14 snoRNAs by reverse transcript polymerase chain reaction suggest that the rice U14 snoRNAs encoded in the cluster are transcribed as a polycistron under an upstream promoter, and individual U14 snoRNAs are released after processing of the precursor RNAs. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Ribosomal RNA; Methylation; Homology; Rice; Yeast

1. Introduction The biosynthesis of eukaryotic ribosomes in the nucleolus involves transcription of ribosomal RNA (rRNA) genes, the maturation and folding of rRNA, and the packaging of the rRNA and ribosomal protein into small and large ribosomal subunits (Maxwell and Fournier, 1995; Bachellerie et al., 2000). During the transcription, folding and maturation processes, up to a hundred or more posttranscriptional nucleotide modifications are introduced at specific positions within the nascent preribosomal RNA (pre-rRNA). The two prevalent types of modification are 2 0 -O-ribose methylations (about 55 and 107 in yeast and humans respectively) and pseudouridines (about 44 and 95 in yeast and humans, respectively) (Maden, 1990). Although the role of these modifications remains elusive, it is clear that virtually all of them are confined to the most conserved and functionally important domain of mature Abbreviations: bp, base pair(s); nt, nucleotide(s); pre-rRNA, preribosomal RNA; r-protein, ribosomal protein; RT-PCR, reverse transcript polymerase chain reaction; snoRNA, small nucleolar RNA * Corresponding author. Tel.: 186-21-6437-4430/5222; fax: 186-216433-8357. E-mail address: [email protected] (Y. Jin).

rRNA. Moreover, their precise locations within the rRNA sequences are largely conserved among distantly related eukaryotic organisms, indicating that they play some important role in rRNA structure and function (Brimacombe et al., 1993). The small nucleolar RNAs (snoRNAs) are involved at various stages of eukaryotic ribosome biogenesis (Maxwell and Fournier, 1995). All the snoRNAs, except RNase MRP (mitochondrial RNA processing), can be classified into two distinct classes: box C/D snoRNAs which have box C (consensus UGAUGA) and box D (consensus CUGA) motif near their 5 0 and 3 0 ends, and H/ACA snoRNAs which have a common secondary structure and contain a conserved ACA trinucleotide invariably positioned three nucleotides from the end of the RNA (Balakin et al., 1996). A large number of snoRNAs are involved in posttranscriptional modifications of rRNA (Tollervey and Kiss, 1997). The box C/D snoRNAs usually have a short-terminal stem and associate with several essential nucleolar proteins (fibrillarin, NOP56, NOP58 and 15.5 kDa protein; Watkins et al., 2000). Most of them contain 10–21 nucleotides (nt) regions complementary to one of the rRNA species and specifying the position of 2 0 -O-ribose methylation of rRNAs (Kiss-Laszlo et al., 1996). The H/ACA

0378-1119/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(02)00767-9

188

G. Jiang et al. / Gene 294 (2002) 187–196

snoRNAs associate with a different set of essential proteins (including Cbf5p, Nhp2p, Nop10 and Gar1p), and act as guide RNAs in the pseudouridylation of rRNAs (Watkins et al., 1998). Recent findings have shown that some snoRNAs can direct the modification of U2, U4 and U6 small nuclear RNAs (snRNAs) and some cellular RNAs (e.g. messenger RNA (mRNA) or their precursors) other than rRNA, demonstrating a new role of snoRNA in regulating gene expression by binding to and/or modifying other species RNAs or their precursors via their antisense elements (Tycowski et al., 1998; Huttenhofer et al., 2001). Since the 1990s, numerous novel snoRNA homologues and their mechanism of gene expression have been identified from eukaryotes (vertebrate and yeast), ancient eukaryotes (trypanosomes) and even from archae (Smith and Steiz, 1997; Omer et al., 2000). The snoRNA genes have two distinct types of genomic organizations: either they are transcribed independently or they are positioned within introns of protein genes (Maxwell and Fournier, 1995). In vertebrates, box C/D or H/ACA snoRNAs identified so far are encoded within introns of housekeeping genes and produced by processing of the pre-mRNA introns. Nevertheless, most of snoRNAs from yeast Saccharomyces cerevisiae are non-intronic. Early study mapped 123 (^5) 2 0 -O-methylation sites in the rRNA of sycamore plant cell (Cecchini and Miassod, 1979). Recently, a large number of snoRNAs were found in such plants as Arabidopsis thaliana (Qu et al., 2001; Barneche et al., 2001; Brown et al., 2001). Therefore, more snoRNAs are expected to exist in plants. Although most newly identified snoRNAs from plants appear to be homologue of yeast or animal counterparts, the gene organization in plants has shown characteristics different from yeast and animal snoRNAs. Many plant snoRNA genes were in gene clusters transcribed as polycistronic pre snoRNA transcripts from which individual snoRNA are processed. Recently, many novel snoRNA gene clusters were identified from A. thaliana (Qu et al., 2001; Barneche et al., 2001; Brown et al., 2001). Rice Oryza sativa is a cereal plant with the smallest genome (430 Mb) in monocots that serves as the major model system in plant molecular biology. A part of its genome sequence has been documented owing to the Rice Genome Project. Identification of novel snoRNA genes in rice will shed light on the diversity of plant snoRNA structure and function, as well as the mechanisms explored in snoRNA gene expression. In this paper, we report that the methylation sites are conserved in rice and yeast rRNA. From the analysis of methylation sites in rice 18S rRNA, a novel U14 box C/D snoRNA gene cluster was identified in rice chromosome II. Two closely linked rice box C/D snoRNAs are encoded in this gene cluster. These two RNAs are designated as variants of rice box C/D snoRNA U14.1 and U14.2, respectively. The structure of U14.1 and U14.2 snoRNAs and their expression patterns are further analyzed and discussed.

2. Materials and methods 2.1. Plant material Seeds of O. sativa indica Guangluai 4 were kindly provided by Dr Hong Guofan (National Center for Gene Research, Chinese Academy of Sciences). Seeds were imbibed in water for 12 h, and then germinated at 278C darkly. Fresh yellow seedlings were obtained after 7–8 days. 2.2. Computer analysis The partially complete rice genome database in Rice Genome Project (http://rgp.dna.affrc.go.jp) was searched against for putative rice U14 box C/D snoRNAs that exhibit structural features expected for guide of rice 18S rRNA C418 methylation. Search for the yeast U14 snoRNA 14nt complementarity to yeast 18S rRNA ribose-methylated sequence was performed with the program BLAST (Altschul et al., 1990) and FASTA (Pearson and Lipmen, 1988). Subsequently, the positive DNA sequences of rice U14 snoRNA candidates were searched for upstream box C sequence UGAUGA and downstream box D sequence CUGA and aligned with other known U14 sequences. 2.3. Extraction of DNA and RNA Genomic DNA was extracted from rice seedlings as described previously (Ausubel et al., 1995). Rice total cellular RNA was isolated from the yellow seedlings according to the phenol-sodium dodecyl sulfate (SDS) method (Ausubel et al., 1995). For isolating nuclei from rice, the method described previously (Lessard et al., 1997) was used. Nuclear RNA was extracted from isolated nuclei with Trizol (Gibco BRL, USA). Yeast S. cerevisiae total RNA was isolated using Trizol, too. 2.4. Determination of 2 0 -O-ribose methylation sites of rice and yeast 18S rRNA Ribose-methylated nucleotides of rice and yeast were determined by a deoxynucleoside triphosphate (dNTP) concentration-dependent primer extension assay (Lowe and Eddy, 1999). Total rice and yeast RNAs (0.4 mg/ml) were annealed with end-labeled primer P689 (0.15 pmol/ ml) at 658C for 5 min, respectively. Primer extensions were carried out in 5 ml reactions containing 0.8 mg of RNA and 0.3 of pmol 32P-end-labeled primer in the presence of 50 mM Tris–HCl (pH 8.6), 60 mM NaCl, 9 mM MgCl2, 10 mM dithiothreitol (DTT), 1 mM concentrations of each dNTP, and avian myeloblastosis virus (AMV) reverse transcriptase (0.2 U/ml) for 30 min at 378C. Low dNTP concentration reactions were carried out in the same manner except with 0.004 mM concentration of each dNTP and 5 mM MgCl2. In order to map the methylation site precisely, a rDNA sequence ladder was prepared and used as a molecular weight marker.

G. Jiang et al. / Gene 294 (2002) 187–196

2.5. Reverse transcript polymerase chain reaction (RTPCR) Analysis of rice U14 gene expression was performed using the Access RT-PCR system (Promega, USA). Total rice cellular RNA was treated with DNase prior to RT-PCR. Primer pairs RTU14.1-A/RTU14.1-B and RTU14.2-A/ RTU14.2-B were used to detect U14.1 and U14.2 snoRNAs, respectively. Subsequently, the RT-PCR products were cloned and sequenced. Primer pair RTU14.2-A/RTU14.1B was used to detect the polycistronic precursor of U14 snoRNA cluster. 2.6. Preparation of probes and Northern blot The T7 promoter sequence was added to RT-PCR products of U14.1 and U14.2 snoRNAs by PCR with primer pairs P964/RT-U14.1B and P965/RT-U14.2B, respectively. Then the gel-purified PCR products were used as the templates to obtain the single-stranded RNA probes by RiboProbe In Vitro Transcription system (Promega, USA). Total RNA and nuclear RNA were separated by electrophoresis on 1.2% agarose gels containing 1 £ MOPS (3-(Nmorpholino) propanesulfonic acid) buffer and 1.2 M formaldehyde (Sambrook et al., 1989) and transferred to nylon membrane (Hybond-N 1, Amersham, USA). Blots were hybridized overnight at 688C in solution containing 0.5% SDS, 6 £ SSC (1 £ ¼ 0.15 M NaCl, 0.015 M sodium citrate), 100 mg ml 21 denatured salmon sperm DNA, and a- 32P-UTP (uridine triphosphate) labeled in vitro transcribed single-stranded antisense RNA probes which were complementary to U14.1 and U14.2 snoRNAs, respectively. Wash conditions were: 2 £ SSC, 0.1% SDS, twice at room temperature (15 min each); 0.1 £ SSC, 0.5% SDS, 30 min at 378C; 0.1 £ SSC, 0.5% SDS, 30 min at 688C. Hybridization signal was detected by autoradiography. 2.7. 5 0 and 3 0 RACE Total RNA was reverse-transcribed with two 5 0 phosphorylated antisense primers RT-U14.1 A and RT-U14.2 A, which were complementary to 3 0 end of U14.1 and U14.2 snoRNA respectively, and ligated to obtain singlestranded circular cDNA (5 0 -Full RACE Core Set, Takara). The mixtures were used in PCR reaction (LA PCR, Takara) with the primer pairs P5 0 RACE14.1A/P5 0 RACE14.1B and P5 0 RACE14.2A/P5 0 RACE14.2B. The two resulting 90 bp fragments were recovered from the gel and cloned into pGEM-T vector (Promega, USA). After sequencing, the 5 0 ends of U14.1 and U14.2 snoRNAs were determined. The 3 0 ends of U14.1 and U14.2 snoRNAs were determined by RNA ligase mediated-rapid amplification of cDNA ends (RLM-RACE) (Liu and Gorovsky, 1993; Omer et al., 2000). Briefly, the primer P3 0 RACE-A was 5 0 phosphorylated with T4 polynucleotide kinase and ATP and blocked at 3 0 end with terminal deoxynucleotidyl transferase (Promega, USA) and ddCTP. The modified primer was

189

then ligate with rice total RNA for 16 h at 48C. Using the ligation products as templates, two RT-PCR reactions were performed with the primer pairs P3 0 RACE-B/RTU14.1-B and P3 0 RACE-B/RTU14.2-B (Access RT-PCR system, Promega, USA), respectively. The PCR products were cloned into pGEM-T vector (Promega, USA). After sequencing several independent clones, the 3 0 ends of U14.1 and U14.2 snoRNAs were obtained. 2.8. Reverse transcription analysis For reverse transcription analysis, 10 mg of rice total RNA was heat-denatured (10 min, 658C) in the presence of 1.5 pmol end-labeled primer P388 and allowed to cool to 428C for 10 min. Reaction was carried out in the buffer containing 50 mM Tris–HCl (pH 8.6), 60 mM NaCl, 9 mM MgCl, 10 mM DTT, 1 mM each dNTP, and AMV reverse transcriptase (0.2 U/ml) for 60 min at 378C. The cDNA synthesized thus was analyzed by 8% polyacrymide/7 M urea gel with a molecular weight marker. 2.9. Oligodeoxynucleotids Oligodeoxynucleotids were synthesized from Institute of Biochemistry and Cell Biology (Chinese Academy of Sciences, China). All oligodeoxynucleotids were gel-purified by electrophoresis with 20% acrylamide/8 M urea gel. The following oligonucleotides were used: P689 (5 0 GTTATTTATTGTCACTACCTCCC3 0 ); RTU14.1-A (5 0 ACATCCAAGGAAGGAATTAA3 0 ); RTU14.1-B (5 0 GCAATGATGATAAATTTAAGGCTTG3 0 ); RTU14.2-A (5 0 ACATCCAAGGAAGGAATTAG3 0 ); RTU14.2-B (5 0 AAATGATGCTAAAAGCAAGGCT3 0 ); P964 (5 0 GAATTCTAATACGACTCACTATAACATCCAAGGAAGGAATTAA3 0 ); P965 (GAATTCTAATACGACTCACTATAACATCCAAGGAAGGAATTAG3 0 ); P5 0 RACE14.1A (5 0 GCTTTCGCCCTGCCAGGC3 0 ); P5 0 RACE14.1B (5 0 ATGAGAAACAAGCCTTAAA3 0 ); P5 0 RACE14.2A (5 0 GCTTTCGCCTTGCCAGGT3 0 ); P5 0 RACE14.2B(5 0 ATGAGAAACAAGCCTTGCT3 0 ); P3 0 RACE-A (5 0 CTGCAGAAGCTTGCATGC3 0 ); P3 0 RACE-B (5 0 GCATGCAAGCTTCTGCAG3 0 ); P388 (5 0 GGCGGCAACTGCGAATGT3 0 ).

3. Results 3.1. Detecting rice U14 box C/D snoRNA gene cluster The length and sequence of 18S rRNA is highly conserved among eukaryotic organism (Takaiwa et al., 1984). By homology comparison, the nucleotide sequence of rice 18S rRNA shows 79% homology to that of yeast. Conserved regions are observed all over the 18S rRNA. About 2.1% of total nucleotides are modified and the majority of 2 0 -O-methylation sites have been located in yeast rRNA (Maden, 1990). Almost all of the modified nucleo-

190

G. Jiang et al. / Gene 294 (2002) 187–196

tides that have been located are in the conserved functional center of rRNA. Interestingly, we identified in 18S rRNA a 14 nt-long region from 414 to 427 nt in rice that was identical to the region from 410 to 423 nt in yeast. The C414 in this region of yeast was methylated via the guidance of U14 snoRNA. Because the ribose methylation sites of rRNA in rice had not been mapped, we devised experiment to determine whether C418 in rice 18S rRNA was methylated as C414 in yeast. As was shown in Fig. 1(b), the primer P689 was complementary to both yeast and rice 18S rRNA and annealed at downstream of rice C418. With dNTP concentration-dependent primer extension assay that could generate DNA fragments ending at ribose-methylated nucleotides using rice and yeast rRNAs as templates, we observed (see Fig. 1(a)) that the C418 was indeed methylated in rice, mirroring C414 in yeast. So we wondered if there was corresponding U14 box C/D snoRNA in rice, which contained the same 14-nt guide sequence as in yeast U14

box C/D snoRNA and could be complementary to the sequence from 414 to 427 nt in rice 18S rRNA. Using the yeast 14-nt guide sequence, we had blasted it against rice genome database of Rice Genome Project and discovered a novel U14-like gene cluster on rice chromosome II. This cluster contained two box C/D snoRNA homologues featuring the hallmark structures (see Fig. 2(a)) as in the case of yeast U14 box C/D snoRNA: in each homologue, there existed box C and box D motifs adjacent to terminal stem and the 14-nt-long guide sequence 5 0 to box D motif that was complementary to 414–427 nt in rice 18S rRNA. Subsequently, the sequences of the two rice putative U14 homologues were aligned with maize, Arabidopsis and Yeast U14 snoRNA sequences in Fig. 2(a). The putative coding regions were defined by the inverted repeat sequences adjacent to the box C and box D sequences. All four plant sequences showed high homology and extensive regions of identity to one another. When compared rice U14s to yeast U14, sequence homologies were about

Fig. 1. Determination of rRNA methylation sites within complementarity to U14 snoRNA. (a) Rice total RNA was used as templet in lanes 1 and 2; yeast total RNA was used as templet in lanes 3 and 4. Lanes 1 and 3, primer extension at 4 mmol/l; Lanes 2 and 4, control reaction at 1 mmol/l dNTP. Lanes A, C, G and T, the rDNA sequence ladder. The sites of ribose methylation were revealed by reverse transcript pauses at low dNTP concentration. Arrows indicated the same methylation sites in rice and yeast 18S rRNA. (b) The partial sequence of 18S rRNAs juxtapositioning the methylation site. Arrow shows primer P689 witch is used to determine the rRNA methylation site. Methylation sites in yeast and rice are in capital letter. A total of 14 nt complementarities to U14 snoRNA are boxed.

G. Jiang et al. / Gene 294 (2002) 187–196

60%. Although sequence variation existed among the plant and yeast U14 sequences, they contained two regions of virtual identify: the box C sequence, and an 18 nt region including box D, lying directly upstream of the 3 0 terminal inverted repeat. These two putative rice box C/D snoRNAs were designated as U14.1 and U14.2, respectively. 3.2. Positive identification of the putative U14 snoRNAs from rice The presences of putative rice U14.1 and U14.2 box C/D snoRNAs were confirmed by RT-PCR using primer pairs RTU14.1-A/RTU14.1-B and RTU14.2-A/RTU14.2-B, respectively. Each of primer pairs was designed to amplify the region, which spanned from box C domain to box D domain, within U14.1 or U14.2 snoRNA candidates. As shown in Fig. 3(a), U14.1 and U14.2 snoRNAs were detected, with the same 110 bp-bands produced by RT-PCR corresponding precisely to the size of the product, as expected. Control reactions without reverse transcriptase gave no products, showing no residual DNA in RNA preparations and confirming that the RT-PCR products were derived from RNA. The sequences of two RT-PCR products from each snoRNAs were determined by cloning of the gel-recovered bands. The sequences determined perfectly matched the corresponding U14 snoRNA genes in this cluster. To further confirm the identity and distribution of the two snoRNAs using rice total cellular RNA and nuclear RNA, northern blot analyses were carried out with in vitro transcribed U14.1 and U14.2 anti-sense RNA probes in condition as stringent as possible. These two probes covered almost full-length of U14.1 or U14.2 snoRNA extending from box C to box D and were purified with polyacrylamide gel electrophoresis to ensure their length homogeneity. As a result, these two probes had sufficient specificity to differentiate between the two closely related rice U14 snoRNA sequences. As shown in Fig. 3(b), both of target U14 snoRNAs were positively detected by northern blotting. A hybridizing RNA band of ,120 nt was observed on each lanes. The lane of 2 mg nuclear RNA had the same strong hybridizing signal as the lane of 24 mg total cellular RNA indicating that the U14 snoRNAs were enriched in rice nucleus. Note that: the difference of signal intensity between U14.1 and U14.2 blot was not due to that of abundance of the RNAs, but due to that of exposure time during autoradiography. In addition, the ,300 nt RNA band observed in the extracted RNA samples might represent the unprocessed U14 precursor RNA (described in Section 3.4). 3.3. Molecular characterization of rice U14 box C/D snoRNAs The 3 0 end sequences of two U14 snoRNAs were determined using RLM-RACE method. The modified (5 0 phosphorylated and 3 0 blocked) primer P3 0 RACE-A was ligated to extracted rice total RNA. Primer P3 0 RACE-B which was complementary to P3 0 RACE-A and two sense primers

191

RTU14.1-B and RTU14.2-B which were specific to U14.1 and U14.2 snoRNAs, respectively, were constructed. Using the ligation products as templates, two RT-PCR were performed with primer pairs P3 0 RACE-B/RTU14.1-B and P3 0 RACE-B/RTU14.2-B to amplify the 3 0 ends of U14.1 and U14.2 snoRNAs, respectively. A major RT-PCR product was obtained for each snoRNAs, as shown in Fig. 4(a). The specific products were recovered and cloned. After sequencing, the 3 0 end sequences of two U14 snoRNAs were determined. As shown in Fig. 2(c), both U14 snoRNAs ended at 5 nt downstream of box D sequence. To map the 5 0 ends of two U14 snoRNAs, the 5 0 phosphorylated antisense primers RTU14.1-A and RTU14.2-A were used to circularize single-stranded cDNAs of U14.1 and U14.2 snoRNAs, respectively. Subsequently, two 5 0 RACE PCR reactions were performed with primer pairs P5 0 RACE14.1 A/P5 0 RACE14.1B and P5 0 RACE14.2 A/ P5 0 RACE14.2B. As shown in Fig. 4(b), two specific products were observed in each RACE PCR reactions. After cloning and sequencing, the 5 0 ends of two U14 snoRNAs were derived. As shown in Fig. 2(c), 5 0 ends of U14.1 and U14.2 snoRNAs occurred 3 and 4 nt upstream of box C sequence, respectively. To further confirm the accuracy of 5 0 ends of each U14 snoRNAs, reverse transcription analysis of rice total RNA with the same primer P388 was carried out. Since the primer P388 was complementary to both U14 snoRNAs, there would be two products obtained on reverse transcription analysis according to results of 5 0 RACE. As shown in Fig. 4(c), two bands with only 1 nt difference in length were observed. This result further confirmed the 5 0 ends of two rice U14 snoRNAs. The full-length of rice U14.1 and U14.2 snoRNAs were 120 and 121 nt, respectively. This conclusion perfectly matched the result of northern blot analyses. Both 5 0 and 3 0 ends of each U14 snoRNAs located within the shortterminal stem structures, as shown in Fig. 2(c). This suggested that the short-terminal stem was the key signal recognized by nuclease(s) during processing of the terminal nucleotide of snoRNA. 3.4. Detection of polycistronic U14 transcript by RT-PCR and Northern blot Sequence analyses showed that the intergenic spacer, which separates U14.1 and U14.2 snoRNAs in the cluster, was 52 bp long and rich in uridine (up to 50%). No conserved plant promoter elements, particularly those of UsnRNA genes (TATA box; upstream sequence element and nomocot-specific element; Vankan and Filipowicz, 1989; Connelly et al., 1994), and RNA polymerase III elements were found within this 59 bp intergenic spacer. The discovery of closely linked U14 snoRNAs in this gene cluster suggests that U14.1 and U14.2 snoRNAs may be polycistronically expressed. Individual rice U14 snoRNAs would be released after processing by a nuclease(s) just as maize U14 snoRNAs (Leader et al., 1994).

192

G. Jiang et al. / Gene 294 (2002) 187–196

Because RTU14.2-A and RTU14.1-B were specific to 3 0 end of U14.2 and 5 0 end of U14.1, respectively, RT-PCR product amplified with this pair of primers should only be a 284 bp DNA fragment that was comprised of U14.1, the spacer and U14.2 if there was the polycistronic transcript from this U14 gene cluster. As shown in Fig. 5, a precursor representing an unprocessed polycistronic transcript was

detected, with the band produced by RT-PCR corresponding precisely to the predicted size, i.e. a band of ,280 bp. No DNA fragment was observed in any of the RT-PCR controls performed without reverse transcriptase or RNA template. Thus, RT-PCR has detected a transcript containing both U14.1 and U14.2 genes, suggesting that rice U14 snoRNA gene cluster is likely to be transcribed as a single polycitro-

Fig. 2. The sequence analyses of rice U14.1 and U14.2 BoxC/D snoRNAs. (a) Alignment of rice U14 genomic sequences with other plant and yeast U14 coding regions. Inverted repeats at the 5 0 and 3 0 ends of the genes are shown; box C and box D are in bold; regions of complementarity to 18S rRNA are indicated by asterisks. (b) The complementarity between rice U14 snoRNAs and 18S rRNA. The methylation site is boxed. (c) Potential terminal stem structures formed for both of U14.1 and U14.2 snoRNAs. Arrows indicate the 5 0 and 3 0 ends of two U14 snoRNAs.

G. Jiang et al. / Gene 294 (2002) 187–196

Fig. 3. Positive identification U14 snoRNA. (a) RT-PCR. Lane 1, molecular weight marker; lanes 2 and 4, RT-PCR of U14.1 and U14.2; lanes 3 and 5,control reactions without reverse transcriptase. (b) Northern blot analyses. M, single strand RNA molecular weight marker.

nic transcript and individual U14 snoRNAs would be released by processing. In addition, the result from Northern blot further supported this conclusion: a ,300 nt RNA band was observed in the extracted RNA samples, which might represent the unprocessed U14 precursor RNA (See Fig. 3(b)). However, the abundance of the precursor RNA was much lower than that of the mature U14 snoRNAs as evidenced by the difference of the signal intensity between the ,120 nt major and the ,300 nt RNA species. This phenomenon might be accounted for by different half-life of these RNA species.

4. Discussion In eukaryotic cells, pre-rRNA is methylated at specific 2 0 O-ribose parallelly with and/or shortly after synthesis and then cleaved to intermediates that are further processed to become the 18S, 5.8S and 28S rRNA components of ribosomes. The methylation sites have been determined predominantly from yeast and vertebrates and only a few from plant. Most of these sites are mapped into the conserved structural core of rRNA. By dNTP concentration-dependent primer extension assay, we found in 18S rRNA a new

193

methylation site C418 in rice that is the counterpart of C414 in yeast. Evidence from Xenopus oocytes has shown that U14 snoRNA is required for 2 0 -O-ribose methylation of the specific site in the pre-18S rRNA (Dunbar and Baserga, 1998). Gene deletion experiments have also shown that U14 is an essential snoRNA in yeast S. cerevisiae required for cell growth and processing of 18S rRNA precursor. (Zagorski et al., 1988; Li et al., 1990). It has been shown that all sites of rRNA ribose methylation are specified through the same snoRNA-guide process (Lowe and Eddy, 1999). In yeast, U14 snoRNA (previously designated 4.5S hybRNA) that contains a 14-nt complementarity to 18S rRNA (410–423 nt) plays a role in guiding the methylation of C414 of 18S rRNA. The sequence and structural similarity of U14 snoRNAs from different species suggests that they are probably functional homologs as well. Since the sequences around C418 in rice and C414 in yeast were identical and both of the cytidine nucleosides were methylated, we speculated that there were U14 box C/D snoRNA homologues in rice containing the same 14-nt complementarity. By computer searching against rice genome database, two closely linked U14 box C/D snoRNAs were found on rice chromosome II. These two U14 snoRNA gene sequences showed extensively sequence homology to yeast and maize U14 snoRNAs in containing box C/D motif and the 14-nt complementarity to their corresponding 18S rRNAs. The evidences from RT-PCR and northern analysis strongly suggest that we have isolated the first U14 box C/D snoRNAs from rice, which are likely to have a role in methylation modification of rRNA. It is worth noting that we also found a DNA fragment that is located about 90 bp downstream of U14.2 snoRNA. The sequence of this DNA fragment showed extensive sequence homology to U14.1 and U14.2 snoRNAs. However, there found no obvious box D motif, a 5 0 , 3 0 terminal stem or intact 14-nt guide sequence as would have been expected in this fragment. Furthermore, no transcript of this DNA fragment was detected by RT-PCR with the specific primer pairs. Evidences have shown that box C, box D and a 5 0 , 3 0 terminal stem are required for both intronic and nonintronic U14 snoRNA processing (Xia et al., 1997). This DNA fragment is likely to be a non-functional pseudogene of U14 snoRNA: relic of evolution accumulating many mutational changes in its important functional region, i.e. box D and terminal stem, in the course of evolution. The genomic organization of U14 snoRNA is diverse in eukaryotes. Yeast U14 snoRNA is an independent gene and transcribed from its own independent, upstream promoter (Zagorski et al., 1988). In mouse, rat, Xenopus and human, three copies of U14 snoRNAs are located in introns 5, 6 and 8 of the constitutively expressed cognate hsc70 heat shock gene (Liu and Maxwell, 1990). The orientation of U14 sequences in the coding strand of the hsc70 introns, the lack of an previously defined RNA polymerases I, II, or III binding site in the U14 snoRNA coding sequences and the upstream and downstream flanking regions, and the lack

194

G. Jiang et al. / Gene 294 (2002) 187–196

of a cap structure at 5 0 end suggest that vertebrate U14 snoRNAs are transcribed as part of the hsc70 pre-mRNA and generated by intron processing. In plant, another particular genomic organization of U14 snoRNA was found. Groups of U14 snoRNA genes clustered with other snoR-

NAs were firstly found in maize (Leader et al., 1994). These genes were transcribed polycistronically from an upstream promoter to give a precursor snoRNA, which was processed by splicing-independent mechanism (Leader et al., 1999). Rice U14.1 and U14.2 snoRNAs were closely linked

Fig. 4. Determination of 5 0 and 3 0 ends of U14 snoRNAs. (a) 3 0 -RACE DNA products. (b) 5 0 -RACE DNA products. (c) Primer extension analysis. Mapping of 5 0 ends of U14 snoRNA transcripts in rice total RNA with primer P388. Two products in size of 52 and 53 nt are observed (lane U14). Arrows indicate the primer extension product; box C sequences are underlined and the sequence and the position of primer P388 are shown.

G. Jiang et al. / Gene 294 (2002) 187–196

195

Fig. 5. Detection of a polycistronic U14 snoRNA transcript by RT-PCR with the primer pair RTU14.2-B/RTU14.1-A. (a) Schematic representation of U14 snoRNA cluster. The snoRNAs are represented by boxes, transcribed spacer by lines. Primers RTU14.2-A and RTU14.1-B are indicated by arrows. (b) Lane RNA, RT-PCR of rice total RNA with primer pair RTU14.2-B/RTU14.1-A; lane DNA, control PCR performed on rice total DNA; lane C1, control PCR performed on total RNA without reverse transcription; lane C2, control PCR performed with water as template; lane M, molecular weight marker.

through a 52 bp intergenic spacer. The absence of conserved plant promoter elements in the intergenic spacer and coding regions of U14.1 and U14.2 suggested that the rice U14 genes were either transcribed from novel promoter sequences or as a part of larger precursor RNA molecules. The detection of transcripts containing two U14 coding sequences and their intergenic spacer by RT-PCR and Northern blot suggested that the cluster of U14 snoRNA genes were transcribed as polycistronic transcripts from which individual U14 snoRNAs were processed. It is obviously that the snoRNA gene clusters are prominent characteristic of plant snoRNA gene organization (Qu et al., 2001), whereas no snoRNA gene clusters have been found in mammals and only five snoRNA gene clusters have been identified from yeast (Lowe and Eddy, 1999). SnoRNA gene cluster may represent an effective regulating means of gene expression to achieving higher levels of snoRNA transcripts. The clustered U14 snoRNA gene arrangement may also ensure abundant levels of U14 snoRNAs in rice. Further analyses of genomic flanking sequences and examination of the transcriptional activity and processing of rice U14 precursor is underway to determine the mechanism of rice U14 snoRNA gene expression. The gene cluster encoding rice U14.1 and U14.2 box C/D snoRNAs has been deposited in the GenBank database under accession number of AF332622. 4. Uncited References Luhrmann, 1998. Trinh-Rohlik and Maxwell, 1988. Acknowledgements We wish to thank Prof. Hong Guofan and Prof. Han Bin for the help of searching of rice genome database. This work

was supported by the Natural Science Foundation of China (Grant 39730120), the Chinese Academy of Sciences (Grant KSCX 2-2-04) and a Grant from Shanghai Institutes of Life Sciences. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidmen, J.G., Smith, J.A., Struhl, K., 1995. Current Protocols in Molecular Biology, 3rd Edition. John Wiley & sons, Inc, New York. Bachellerie, J.P., Cavaille, J., Qu, L.H., 2000. Nucleotide modifications in eukaryotic rRNAs: the world of small nucleolar RNA guides revisited. In: Garrett, R.A., Douthwaite, S.R., Liljas, A., Matheson, A.T., Moore, P.B., Noller, H.F. (Eds.). The Ribosome: Structure, Function, Antibiotics, and Cellular Interactions, American Society of Microbiology Press, Washington, DC, pp. 191–203. Balakin, A.G., Smith, L., Fournier, M.J., 1996. The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86, 823–834. Barneche, F., Gaspin, C., Guyot, R., Echeverria, M., 2001. Identification of 66 box C/D snoRNAs in Arabidopsis thaliana duplications generated multiple isoforms predicting new RNA 2 0 -O-methylation sites. J. Mol. Biol. 3, 57–73. Brimacombe, R., Mitchell, P., Osswald, M., Stade, K., Bochkariov, D., 1993. Clustering of modified nucleotides at the functional center of bacterial ribosomal RNA. FASEB J. 7, 161–167. Brown, J.W.S., Clark, G.P., Leader, D.J., Simpson, C.G., Lowe, T., 2001. Mutltiple snoRNA gene clusters from Arabidopsis. RNA 7, 1817–1832. Cecchini, J.P., Miassod, R., 1979. Studies on the methylation of cytoplasm RNA from cultured higher plant cells. Eur. J. Biochem. 98, 203–214. Connelly, S., Marshallsay, C., Leader, D.J., Brown, J.W.S., Filipowicz, W., 1994. Small nuclear RNAs genes transcribed by either RNA polymerase II or RNA polymerase III in monocot plants share three promoter elements and use a strategy to regulate gene expression different from that used by their dicot plant counterparts. Mol. Cell. Biol. 14, 5910– 5919. Dunbar, D.A., Baserga, S., 1998. The U14 snoRNA is required for 2 0 -Oribose methylation of the pre-18S rRNA in Xenopus oocytes. RNA 4, 195–204.

196

G. Jiang et al. / Gene 294 (2002) 187–196

Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O’Brien, J., Lehrach, H., Bachellerie, J.P., Brosius, J., 2001. RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. EMBO J. 20, 2943–2953. Kiss-Laszlo, Z., Henry, Y., Bachellerie, J.P., Caizergues-Ferrer, M., Kiss, T., 1996. Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell 85, 1077–1088. Leader, D.J., Sanders, J.F., Waugh, R., Shaw, P.J., Brown, J.W.S., 1994. Molecular characterization of plant U14 small nucleolar RNA genes: closely linked genes are transcribed as a polycistronic U14 transcript. Nucleic Acids Res. 22, 5196–5200. Leader, D.J., Clark, G.P., Waters, J., Beven, A.F., Shaw, P.J., Brown, J.W.S., 1999. Splicing-independent processing of plant box C/D and box H/ACA small nucleolar RNAs. Plant Mol. Biol. 39, 1091–1100. Lessard, P., Decroocq, V., Thomas, M., 1997. Isolation and analysis of messenger RNA from plant cells cloning of cDNAs. In: Melody, S.C. (Ed.). Plant Molecular Biology A Laboratory Manual, Springer-Verleg, Berlin, Heidelerg, pp. 154–198. Li, H.V., Zagorski, J., Fournier, M.J., 1990. Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae. Mol. Cell Biol. 10, 1145–1152. Liu, X.W., Gorovsky, M.A., 1993. Mapping the 5 0 and 3 0 ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Res. 21, 4954–4960. Liu, J., Maxwell, E.S., 1990. Mouse U14 snRNA is encoded in and intron of the mouse cognate hsc70 heat shock gene. Nucleic Acids Res. 18, 96– 5200. Lowe, T.M., Eddy, S.R., 1999. A computational screen for methylation guide snoRNAs in yeast. Science 283, 1168–1171. Luhrmann, R., 1998. Cbf5p, a potential pseudoridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNAs and constitute a common bipartite structure. RNA 4, 1549–1568. Maden, B.E.H., 1990. The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. 39, 241–301. Maxwell, E.S., Fournier, M.J., 1995. The small nucleolar RNAs. Annu. Rev. Biochem. 64, 897–934. Omer, A.D., Lowe, T.M., Russell, A.G., Ebhardt, H., Eddy, S.R., Dennis, P.P., 2000. Homologs of small nucleolar RNAs in Archaea. Science 288, 991–994.

Pearson, W.R., Lipmen, D.J., 1988. Improved tools for biological sequence comparison. Proc. Natl Acad. Sci. USA 85, 2444–2448. Qu, L.H., Meng, Q., Zhou, H., Chen, Y.Q., 2001. Identification of 10 novel snoRNA gene clusters from Arabidopsis thaliana. Nucleic Acids Res. 29, 1623–1630. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: A Laboratory Manual, 2nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Smith, C.M., Steiz, J.A., 1997. Sno storm in the nucleolus: new roles for myriad small RNPs. Cell 89, 669–672. Takaiwa, F., Oono, K., Sugiura, M., 1984. The complete nucleotide sequence of a rice 17S rRNA gene. Nucleic Acids Res. 12, 5441–5448. Tollervey, D., Kiss, T., 1997. Function and synthesis of small nucleolar RNAs. Curr. Opin. Cell Biol. 3, 337–342. Trinh-Rohlik, Q., Maxwell, E.S., 1988. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs. Nucleic Acids Res. 16, 6041–6056. Tycowski, K.T., You, Z.H., Graham, P.J., Steitz, J.A., 1998. Modification of U6 spliceosomal RNA is guided by other small RNAs. Mol. Cell 2, 629–638. Vankan, P., Filipowicz, W., 1989. A U-snRNA gene-specific upstream element and a 230 TATA box are required for transcription of the U2 snRNA gene of Arabidopsis thaliana. EMBO J. 8, 3875–3882. Watkins, N.J., Gottschalk, A., Nwubauer, G., Kastner, B., Fabrizio, P., Mann, M., Luhrmann, R., 1998. Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNAs and constitute a common bipartite structure. RNA 4, 1549–1568. Watkins, N.J., Segault, V., Charpentier, B., Nottrott, S., Fabrizio, P., Bachi, A., et al., 2000. A common core RNP structure shared between the small nucleolar box C/D RNPs and the spliceosomal U4 snRNP. Cell 103, 457–466. Xia, L., Watkins, N.J., Maxwell, E., 1997. Identification of specific nucleotide sequences and structural elements required for intronic U14 snoRNA processing. RNA 3, 17–26. Zagorski, J., Tollervey, D., Fournier, M.J., 1988. Characterization of an SNR Gene Locus in Saccharomyces cerevisiae that specifies both dispensable and essential small nuclear RNAs. Mol. Cell Biol. 8, 3282–3290.