Identification and Characterization of Genes Responsible for Drought Tolerance in Rice Mediated by Pseudomonas fluorescens

Available online at www.sciencedirect.com

ScienceDirect Rice Science, 2017, 24(5): 291í298

Identification and Characterization of Genes Responsible for Drought Tolerance in Rice Mediated by Pseudomonas fluorescens Manjesh SAAKRE, Thirthikar Meera BABURAO, Abida Puthenpeedikal SALIM, Rose Mary FFANCIES, Valasala Poothecty ACHUTHAN, George THOMAS, Sajeevan Radha SIVARAJAN (Centre for Plant Biotechnology and Molecular Biology / Department of Genetics and Plant Breeding / Department of Agronomy, College of Horticulture, Kerala Agricultural University, Vellanikkara, Thrissur680656, Kerala, India)

Abstract: Drought is one of the major abiotic stresses which adversely affect crop plants limiting growth and yield potential. Structural and functional characterization of drought stress-induced genes has contributed to a better understanding of how plants respond and adapt to the drought stress. In the present study, differential display technique was employed to study the gene expression of rice plants at the reproductive stage that were subjected to drought stress by withholding water, Pseudomonas fluorescens strain (Pf1) treated plants subjected for drought stress by withholding water and control (well-watered). Differentially expressed cDNAs of six genes (COX1, PKDP, bZIP1, AP2-EREBP, Hsp20 and COC1) were identified, cloned and sequenced. Real-time qPCR analysis showed that all the six genes were upregulated in drought-stressed plants treated with Pf1. This revealed that the remarkable influence of Pf1 colonization leads to drought tolerance at the reproductive stage. These results showed that high levels of gene expression in plants lacking adequate water can be remarkably influenced by Pf1 colonization, which might be a key element for induced systemic tolerance by microbes. Key words: rice; drought tolerance; Pseudomonas fluorescens; differential display reverse transcription polymerase chain reaction; quantitative real-time PCR; transcript derived fragment

Rice (Oryza sativa L.) is one of the major food crops for about 65% of the world’s population, and is the staple food for an expansive part of the world, particularly in Asia (Ghadirnezhad and Fallah, 2014). It has been estimated that a large portion of the world’s population depends wholly or partially on rice for its calorie intake. Climatic factors play a major role in the growth and development of any crops. Among the various factors, water availability is of great significance with regard to rice cultivation (Singh et al, 2008). Rice is predominantly a kharif season crop. However, it is also grown as rabi/summer season crop with assured

irrigation wherever winter is not severe. Indian rice production largely depends on monsoon rains, and only 59% area under rice cultivation has assured irrigation (Auffhammer et al, 2011). Drought is a problem of worldwide importance, affecting the crop production and quality on a large scale, and is becoming more serious with respect to the global climate change (Halliwell, 2006). Therefore, it is associated with all parts of plant biology. As of now, research on drought stress has been one of the principle headings in the global plant biology and biological breeding. Plant growth promoting rhizobacterias (PGPRs) are

Received: 21 December 2016; Accepted: 20 April 2017 Corresponding author: Manjesh SAAKRE ([email protected]) Copyright © 2017, China National Rice Research Institute. Hosting by Elsevier B.V. B V This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Peer review under responsibility of China National Rice Research Institute http://dx.doi.org/ http://dx.doi.org/10.1016/j.rsci.2017.04.005

292

soil bacteria inhabiting around/on the root surface, and can directly or indirectly involve in promoting plant growth and development via production and secretion of various regulatory chemicals in the vicinity of rhizosphere (Ahmad and Kibert, 2013). Several microbes promote plant growth, and many microbial products that stimulate plant growth have been marketed (Lugtenberg and Kamilova, 2009). Such bacteria are generally designated as PGPRs (Lugtenbergc and Kamilova, 2009), which are effective in a wide range of crops to enhance the growth and improve the crop yield (Herman et al, 2008). Pseudomonas fluorescens is a PGPR that colonizes a wide range of ecological niches, including the rhizosphere of plants (Jose et al, 2013). By promoting seed germination, accelerating growth at early stages and inducing root initiation, P. fluorescens acts as a plant growth stimulator (Heinonsalo et al, 2004). Marschner and Timonen (2006) reported the production of various phytohormones by P. fluorescens including auxins, gibberellins and cytokinins. P. fluorescens is also reported to produce specific amino acids and other growth promoters that improve plant growth. Matthijs et al (2007) observed that P. fluorescens has a high capacity for solubilizing phosphate and also can affect in siderophore production. Deveau et al (2007) reported that P. fluorescens adheres and colonizes the surface of some ectomycorrhizas. This colonization of P. fluorescens improves the symbiotic relationship between the plant and the ectomycorrhiza, and benefits the host plant. Certain strains of P. fluorescens promote the 1-aminocyclopropane-1-carboxylate deaminase activity and help plants to resist the stress conditions more efficiently (Arshad et al, 2007). An additional mechanism, by which biocontrol agents can reduce plant biotic and abiotic stresses, enhances plant growth and metabolism, in which P. fluorescens is a significant group of bacteria which help inducing systemic resistance (Ganeshan and Arthikala, 2005). P. fluorescens is also involved in controlling pathogens and forms an integral component of organic farming. The growth promotional activity of P. fluorescens in plants has been revealed previously under different conditions such as laboratory, glass house and field. P. fluorescens strain Pf1, developed by Kerala Agricultural University, Thrissur, India, was found to exhibit plant growth promotional activity in rice under both in-vitro and in-vivo conditions. But the mechanism underlying such promotional activity of P. fluorescens is not yet understood clearly. The

Rice Science, Vol. 24, No. 5, 2017

transcriptomic and gene expression analysis can provide in depth data about the interaction between plant cells and bacteria. In this study, efforts were made to elucidate the molecular responses of rice plants to P. fluorescens treatment through gene expression profiling. Currently, there are several molecular techniques for transcriptome analysis, including differential display reverse transcription polymerase chain reaction (DD-RT-PCR), cDNA-amplified fragment length polymorphism, suppression subtractive hybridization and cDNA microarrays. DD-RT-PCR is a simple, sensitive and powerful technique that can be used successfully to isolate a number of differentially expressed genes from plants. This is comparatively inexpensive method among the techniques and does not require previous sequence information. Quantitative real-time PCR (qRT-PCR) technique is highly sensitive, accurate and practically easy to use, and hence it has become a routine bioinstrumentation for gene level measurement (Provenzano and Mocellin, 2007). In the present study, six transcript derived fragments (TDFs) were identified and isolated from rice with different treatments by DD-RT-PCR. These isolates were cloned, sequenced and characterized as differentially expressed genes by validating using quantitative real-time and semiquantitative reverse transcriptase PCR.

MATERIALS AND METHODS Rice materials High-yielding rice variety Matta Triveni (PTB45) was used in the present study. It is a popular rice variety in Kerala, India, but performed very poor growth in upland. Seeds were sown in plastic trays and posted 15 d, and the seedlings were transplanted to earthen pots (Supplemental Fig. 1). Pots were filled with red soil, clay and cow dung in 1:1:1. The plants were grown under a completely randomized design with three treatments and five replications. A total of 60 plants were grown (four plants in each pot) in pots and representative plants were used for molecular analysis. Drought treatments Rice plants were subjected for drought stress at the reproductive stage (panicle initiation stage). The first batch of control plants was maintained under well-watered condition (T1). The second batch was subjected for drought stress by withholding water for

Manjesh SAAKRE, et al. Assessment of Rice Drought genes by P. fluorescens

15 d (T2), and the third one (Pf1-treated plants) was subjected for drought stress by withholding water for 15 d (T3). T3 plants were given three applications of Pf1 i.e., seed treatment, soil application and foliar spray. Observations were taken on shoot length, root length, fresh weight, dry weight and 1000-grain weight after the harvest. Statistical analysis was carried out using ANOVA and there were significant differences between treatments. Duncan’s multiple range statistical analysis had been carried out for noted observations using WASP-Web Agri Stat Package 2.0 online software (http://www.ccari.res.in/ wasp2.0/index.php). In seed treatment, seeds of Matta Triveni variety were soaked for 24 h in Pf1 solution (10 g seeds, 1 × 1010 CFU/g). The pots were previously drenched with 10 mL Pf1. Foliar spray of Pf1 (2%) was given for plants at 50 d after sowing. Water was withheld continuously for 15 d at the panicle initiation stage one week after foliar spray. Plants exhibited leaf rolling score 7 (leaves margin touching), which was scored according to standard evaluation system (IRRI, 1996), was selected for total RNA extraction. DD-RT-PCR Total RNA was isolated from the leaves of 65 day old rice plants using TRIzol reagent (Sigma, California, USA). The integrity and quality of RNA samples were assessed through formaldehyde agarose denaturing gel (1%) and Nanodrop ND-1000 spectrophotometer, respectively. Total RNA isolated was treated with 1 μg DNaseI (Promega, Wisconsin, USA) and used for the first strand cDNA synthesis. First strand cDNA synthesis was performed in the 20 μL reaction using Thermo Scientific RevertAid H Minus First Strand cDNA Kit (Thermo Scientific, Massachusetts, USA) following the manufacturer’s instructions. The second strand synthesis and PCR amplification were performed in the 20 μL reaction mixture, using 2 μL first strand cDNA mix. Each reaction mixture contained 2 μL of 10× PCR buffer A, 1.6 μL dNTPs (25 mmol/L), 2 μL anchored oligodT and one of the arbitrary primers HAP1: 5ƍ-AAGCTTGATTGCC-3ƍ; HAP2: 5ƍ-AAGCTTCGACTGT-3ƍ; HAP3: 5ƍ-AAGCT TTGGTCAG-3ƍ; HAP4: 5ƍ-AAGCTTCTCAACG-3ƍ; HAP5: 5ƍ-AAGCTTAGTAGGC-3ƍ; HAP6: 5ƍ-AAGC TTGCACCAT-3ƍ; HAP7: 5ƍ-AAGCTTAACGAGG-3ƍ; HAP8: 5ƍ-AAGCTTTTACCGC-3ƍ and 0.2 μL of 4U Taq DNA polymerase (Sisco Research Laboratories).

293

The reactions were performed using a thermal cycler (ProFlex 3 × 32-well PCR System) programmed to initial denaturation at 94 ºC for 2 min, denaturation at 94 ºC for 30 s followed by annealing at 40 ºC for 2 min, extension at 72 ºC for 1 min for 40 cycles and then followed by final extension at 72 ºC for 5 min. The DD-RT-PCR mixture of 4 μL was denatured with 2 μL gel loading dye (95% formamide, 0.5 mol/L EDTA, 0.1% xylene cyanole and 0.1% bromophenol blue) at 90 ºC for 2 min and resolved on 6% polyacrylamide and 8 mol/L urea gel by electrophoresis at 60 V. The transcripts in the gel were visualized using silver staining. Selected cDNA fragments were cut from the gel and eluted by soaking in 40 μL TE buffer followed by heating at 100 ºC for 5 min. The eluted fragments were re-amplified under the same PCR conditions using the same set of primers that generated the differential products. The PCR product was separated on the 1.2% agarose gel and purified with an AxyPrep DNA gel elution kit (Axygen Biosciences). cDNA cloning and sequence analysis The eluted and purified cDNA product was cloned into a pJET vector using Fermentas CloneJET Kit (Thermo Scientific, Massachusetts, USA) as the manufacturer’s instructions. The recombinant colonies were selected and plasmids were isolated and sequenced through SciGenom Labs Pvt Ltd., Cochin, India. The raw sequences obtained were subjected for VecSceen tool (http://www.ncbi.nlm.nih.gov/tools/ vecscreen/) provided by NCBI (National Center for Biotechnology Information) to identify the vector contamination sequences. The vector and the adapter sequences present were removed using the BioeditBiological sequence alignment editor tool. To merge the sequences generated by forward and reverse primers, one of the sequences has to be reversing complemented. This was done by using the reverse complement tool (http://www.bioinformatics.org/sms/ rev_comp.html), and the reverse complemented sequence was merged by using EmbossMerger (http://www. bioinformatics.nl/cgibin/emboss/merger). The cloned nucleotide sequences were identified using the BLAST tools of different rice genome databases such as TIGR (Institute of Genome Research; http://blast. jcvi.org/euk-blast/index.cgi?project=osa1), Plant Transcription Factor Database V3.0 (http://planttfdb. cbi.pku.edu.cn/), DRTF (Database of Rice Transcription Factor; http://drtf.cbi.pku.edu.cn/), and RGAP (Rice Genome Annotation Project; http://rice. plantbiology.

294

Rice Science, Vol. 24, No. 5, 2017

msu.edu/index.shtm). Proteins with BLASTX scores above 50 bits and significantly low expected value (E-value) were designated as known functions. Validation of differentially expressed genes qRT-PCR assay was used to validate the differentially expressed genes. Primers were designed using the IDT-PrimerQuest tool (http://eu.idtdna.com/primerquest/ home/index) and validated using IDT-OligoAnalyzer 3.1 (https://eu.idtdna.com/calc/ analyzer) for homologue cDNA sequences. Details of primers used are given in Table 1. qRT-PCR was carried out using an ABI7300 Real Time PCR System and Sequence Detection Software version 2.1. Actin gene was used as endogenous control for all reactions, and primer reported by Yamanouchi et al (2002) was used (Forward: 5ƍ-TCCATCTTGGCATCTCTCAG-3ƍ and Reverse: 5ƍ-GTACCCGCATCAGGCATCTG-3ƍ). qRT-PCR was performed as per the manufacture’s recommendations using the Thermo Scientific and SYBR® Premix Ex Taq™ II (Tli RNaseH Plus; Takara Bio Ltd. India). PCR cycling conditions comprised an initial cycle at 50 ºC for 2 min, one cycle at 95 ºC for 30 s, followed by 40 cycles at 95 ºC for 15 s and 60 ºC for 1 min. The relative expression levels were calculated using the ¨¨Ct method (Livak and Schmittgen, 2001). All the reactions were performed in triplicate. For semi-quantitative RT-PCR, the rice actin gene was used as an internal control for standardizing the

Table 1. Primers used by real-time PCR. Gene COX1 PKDP bZIP1 AP2EREBP Hsp20 COC1

Sequence (5ƍ–3ƍ) F: CTCCTAGTCGGCCTGATTTC R: CATGAGCAGTAGCATCCTTGA F: CGTTGATAGTCGCCGCTAAA R: TTTAAGAGGCGGGAATGGTG F: GAGCGTACTCTGTCCCATTTAG R: GTTCCAGCGATGAGGTTGT F: AGGTAAAGCCCGAGCAATTC R: GCATCGGTGAATGGTGGTATAA F: TGTGTGTCACCACGCTTTA R: CCTCGCATAGACCCATTCATC F: CACCTCATGACGATGCAAGA R: GAGCTTGCTCACTCCTTCAA

Fragment length (bp) 108 109 115 101 119 101

amount of input cDNA template and as a reference to normalize the relative expression of target mRNA. The amplified PCR products were resolved on a 1.2% agarose gel and stained with ethidium bromide. The intensity of the bands in the gel was visualized by use of the Gel Doc™ XR+ Gel Documentation System. Softwares used for the analysis of the digital image data are Quantity one and PD Quest.

RESULTS As expected, the maximum shoot length, root length (Supplemental Fig. 3), fresh weight, dry weight and 1000-grain weight were obtained in control plants (T1) followed by water stressed + Pf1-treated plants (T3). T3 plants were shown a better response of survival compared to T2 (water stressed plants) (Table 2). DD-RT-PCR and sequence cloning Rice genes whose expressions were regulated by drought stress were studied by differential mRNA display. We observed six partial cDNAs that were potentially differentially upregulated in response to drought in water stressed plants for which Pf1 was applied (Fig. 1). Six cDNA bands that consistently appeared were isolated, cloned and sequenced. The pJET vector used in the present study for cloning will give only white colonies for the recombinant plasmid, which confirmed the presence of recombinants (Supplemental Fig. 4). This confirmed the presence of the insert in the plasmid. The sequences showed good homology with known proteins. A 159 bp fragment corresponding to sequence 1 has homology with cytochrome c oxidase subunit 1 (COX1), and sequence 2 of 161 bp found similarity with protein kinase domain protein (PKDP). Sequence 3 (680 bp) and sequence 6 (228 bp) were found as bZIP1 (basic leucine zipper 1) and COC1 (Circadian oscillator component 1), respectively. For sequence 4 (276 bp), the BLASTX analysis was done using DRTF database and found as AP2-EREBP (APETALA2-ethylene responsive element binding protein). Sequence 5 (484 bp) was found as Hsp20 (Heat shock protein 20).

Table 2. Measurement of biometric parameters after harvest using Duncan’s multiple range statistical analysis (n = 3). Treatment Control Water stressed Water stressed + Pf1-treated CD (1%)

Shoot length (cm) Root length (cm) Fresh weight (g) Dry weight (g) Yield per panicle (g) 1000-grain weight (g) 111.50 91.38 98.86 11.59

26.66 15.54 24.00 3.04

45.620 27.420 34.940 10.248

29.500 11.800 14.400 12.584

3.196 1.482 1.994 0.297

24.520 18.700 21.220 1.747

Manjesh SAAKRE, et al. Assessment of Rice Drought genes by P. fluorescens

Fig. 1. Differential display pattern of transcript derived fragments from three treatments in rice variety PTB45. M, Marker; T1, Control; T2, Water stressed; T3, Water stressed + Pf1-treated.

Further details of BLASTX analysis are showed in Table 3. This showed that these six genes are already reported in rice genome.

295

Fig. 2. qRT-PCR analysis of COX1, PKDP, bZIP1, AP2-EREBP, Hsp20 and COC1 genes under three different treatments in 65 d old plants of rice variety PTB45. Actin was used as endogenous control. Error bars represent standard deviation.

Validation of differential genes To study the expression pattern of cloned genes under drought conditions (Sequence 1 to Sequence 6 as shown in Table 3), quantitative real-time PCR analysis was performed. All the six genes studied (COX1, PKDP, bZIP1, AP2-EREBP, Hsp20 and COC1) showed upregulation in water stressed + Pf1-treated plants. COX1, PKDP, bZIP1, AP2-EREBP, Hsp20 and COC1 were found to have 2.3-, 2.0-, 6.0-, 2.8-, 4.5and 4.0-fold increases in relative expression levels in the same treatment, respectively (Fig. 2). But in case of AP2-EREBP, there were 2.8-fold increase of gene expression in water stressed + Pf1-treated plants, and 2.5-fold increase of gene expression was found in water stressed plants also. The expression of AP2-EREBP gene was not influenced by Pf1 treatment but it was influenced by water stressed condition. Semiquantitative Reverse Transcriptase PCR products were also run on 1.2% agarose gel. The induction in all six genes was recorded especially in the water stressed + Pf1-treated plants which shown comparably higher band intensity (Fig. 3).

Fig. 3. Semi-quantitative reverse transcriptase PCR analysis showing differential gene expressions in different treatments. T1, Control; T2, Water stressed; T3, Water stressed + Pf1-treated.

DISCUSSION Induced systemic tolerance is a phenomenon whereby resistance against subsequent abiotic stress is induced at the whole plant level in response to colonization of

Table 3. Sequence homologies of the TDFs with known genes based on BLAST from different databases. Sequence

Gene code

Gene description

Length (bp) Hit score E-value Accession ID

Database

Sequence 1 COX1 Cytochrome c oxidase subunit 1 159 150 0.00 Os12g0561000 IGR, rice Sequence 2 PKDP Protein kinase domain protein 161 129 0.00 Os08g39170 IGR, rice Sequence 3 bZIP1 bZIP family protein 680 83 2e-17 CT833525 PTFD Sequence 4 AP2-EREBP APETALA2-ethylene responsive element binding protein 276 79 0.00 OsIBCD031146 DRTF Sequence 5 Hsp20 Heat shock protein 20 484 230 4e-25 Os01g04380.1 RGAP Sequence 6 COC1 Circadian oscillator component 1 228 97 3e-06 AY885936 PTFD IGR, Institute of Genome Research; PTFD, Plant Transcription Factor Database; DRTF, Database of Rice Transcription Factor; RGAP, Rice Genome Annotation Project.

296

the roots by certain plant growth-promoting rhizobacteria like P. fluorescens. Compared with the relative means of information in model plant species such as Arabidopsis, our understanding of the molecular mechanisms underlying systemic tolerance in economically important cereal crops is still in its infancy. This study focused on the abiotic determinants and host defense responses underlying P. fluorescens activated induced systemic tolerance in rice, the most important food crop worldwide and a key model for molecular genetic studies of water stress in monocotyledonous plants. The variety PTB45 was susceptible to drought. The survival rate was the least in T2, however, in case of T3, the plants showed comparatively better survival rate because of the Pf1-amendment according to biometric parameters (Table 2). It may be due to high susceptibility of rice to water stress during the reproductive stage without water. Kamoshita et al (2008) reported that plant growth will be resumed after the vegetative stage drought but this resumed growth will affect the development of sink size and source supply. Manjunatha et al (2015) observed reduced accumulation of photosynthates in the reproductive parts (seed formation and grain filling) during the reproductive stage due to water stress conditions. The study showed that colonization by the well characterized biocontrol agent P. fluorescens strain Pf1-renders tolerance to water stress. The data also revealed that this Pf1 is not based on direct activation of basal resistance mechanisms but rather acts for a pronounced multifaceted cellular defense platform. Moreover, the present study demonstrated that systemic tolerance by P. fluorescens enhances gene expression levels of stress induced transcription factors like bZIP1 and COC1, and stress induced chaperon proteins like Hsp20 which are involved in abscisic acid (ABA) dependent signaling pathway. Vleesschauwer et al (2008) demonstrated the ability of WCS374r, a strain of P. fluorescens, to trigger induced systemic tolerance in rice against the leaf blast pathogen Magnaporthe oryzae, which was a study with respect to biotic stress. However, the studies regarding the systemic tolerance induced by P. fluorescens for abiotic stress are very few. The current study demonstrated the influence of P. fluorescens under water stress for the high expression level of genes involved in ABA-mediated signaling pathway that provides tolerance to the plants especially during

Rice Science, Vol. 24, No. 5, 2017

the reproductive stage. The effects of P. fluorescens have been analyzed in relation with drought resistance and its systemic tolerance for water stress. P. fluorescens promotes plant growth and development by facilitating the uptake of nutrients from the environment (Kandasamy et al, 2009). Effects of PGPR on plant growth and development are manifested as increase in germination, root growth and leaf area. Chlorophyll, magnesium, nitrogen and protein contents are also improved as an effect of PGPR application. Other effects of PGPR include increase in hydraulic activity, tolerance to drought and salt stress, as well as shoot and root weights. PGPRs also delay the leaf senescence (Lucy and Glick, 2004). PGPR-mediated plant growth enhancement was reported by many researchers (Kloepper et al, 1988; Peer et al, 1989; Hergarten et al, 1998; Glick et al, 1999; Polyanskaya et al, 2000; Saravanakumar et al, 2009). However, the molecular basis of host plant-PGPR interaction in promoting plant growth is less understood yet. We identified six differentially-expressed genes in PTB45, a popular variety of Kerala susceptible to drought with the application of P. fluorescens using DD-RT-PCR technique. qRT-PCR was used to analyze the gene expression levels of differentially expressed genes that are expressed in water stressed plants under the influence of P. fluorescens. Among the identified genes, each may have an exclusive role in tolerating drought, which is highly expressed under P. fluorescens stimulation and mostly involved in ABA dependent pathway. COX1 is a mitochondrial DNA, encoding subunit of respiratory complex IV, which is a biological catalyst in the electron transport chain of mitochondrial oxidative phosphorylation. COX1 protein is involved in regulation of carbohydrate, nitrogen and energy metabolism. Yan et al (2005) reported that COX1 protein acts as a scavenging agent for reactive oxygen species and is involved in processing of mRNA and proteins. PKDP is a structurally conserved domain with a catalytic function of protein kinases (Scheeff and Bourne, 2005). Protein kinases are involved in the phosphorylation reaction, wherein a phosphate group is transferred onto proteins. These functions were as switch for many cellular processes, including metabolism, transcription, cell cycle progression and various others (Bononi et al, 2011). Plant-specific serine/threonine kinases including the SnRK2 family are involved in plant response to abiotic stress and

Manjesh SAAKRE, et al. Assessment of Rice Drought genes by P. fluorescens

ABA-dependent plant development. Embryonic development and many physiological responses are also switched on or off with the help of various protein kinases. Various stress-related responses and developmental processes in plants are highly influenced by AP2-EREBPs transcription factors. The AP2-EREBP genes are a multigene family, playing key roles throughout the plant life cycle by regulating several developmental processes including determination of floral organ identity and leaf epidermal cell identity control. They also form a part of the defense mechanisms employed by the plants to respond to various biotic and abiotic stresses (Riechmann and Meyerowitz, 1998). Chen et al (2016) reported its role in various hormone-related signal transduction pathways including ABA, ethylene, cytokinin and jasmonates. The current study demonstrated the influence of P. fluorescens under water stress for the high level expression of genes involved in ABA-mediated signaling pathway that provides tolerance to the plants especially during the reproductive stage. The study showed that gene expression in plants lacking adequate water can be remarkably influenced by microbial colonization. The activations of genes like bZIP1, AP2-EREBP and Hsp20 are involved in the ABA-dependent signaling pathway induced by colonization of P. fluorescens and might be a key element for induced systemic tolerance. Application of P. fluorescens at definite prescriptions will be helpful to tolerate rice plants under drought conditions, and the tolerance may be due to the expression of genes promoted by P. fluorescens.

ACKNOWLEDGEMENTS We thank the Jawaharlal Nehru University (JNU) research fellowship sponsored by the Department of Biotechnology (DBT), Government of India, and Center for Plant Biotechnology and Molecular Biology, Department of Genetics and Plant Breeding, Bioinformatics Centre, College of Horticulture, Kerala Agricultural University, Thrissur, India, for providing facilities for current work.

SUPPLEMENTAL DATA The following materials are available in the online version of this article at http://www.sciencedirect.com/ science/ journal/16726308; http://www.ricescience.org. Supplemental Fig. 1. Transplanted seedlings at 15 d

297

after sowing. Supplemental Fig. 2. Drought induced plants at 65 d after sowing, 90% leaf rolling at score 7.0 and root length. Supplemental Fig. 3. Root length measured in three treatments. Supplemental Fig. 4. Cloning of recombinants cloned by pJET vector system and white colonies confirming the presence of recombinants.

REFERENCES Auffhammer M, Ramanathan V, Vincent J R. 2011. Climate change, the monsoon, and rice yield in India. Clim Change, 111(2): 411–424. Ahmad M, Kibert M. 2013. Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J King Saud Univ Sci, 26(1): 1–20. Arshad M, Saleem M, Hussain S. 2007. Perspectives of bacterial ACC deaminase in phytoremediation. Trends Biotechnol, 25(8): 356–362. Bononi A, Agnoletto C, de Marchi E, Marchi S, Patergnani S, Bonora M, Giorgi C, Missiroli S, Poletti F, Rimessi A, Pinton P. 2011. Protein kinases and phosphatases in the control of cell fate. Enzyme Res, 2011: 1–26. Chen L H, Han J P, Deng X M, Tan S L, Li L L, Li L, Zhou J F, Peng H, Yang G X, He G Y, Zhang W X. 2016. Expansion and stress responses of AP2/EREBP superfamily in Brachypodium distachyon. Sci Rep, 6: 21623. Deveau A, Palin B, Delaruelle C, Peter M, Kohler A, Pierrat J C, Pierrart J C, Sarniguet A, Garbaye J, Martin F, Frey-Klett P. 2007. The mycorrhiza helper Pseudomonas fluorescens BBc6R8 has a specific priming effect on the growth, morphology and gene expression of the ectomycorrhizal fungus Laccaria bicolor S238N. New Phytol, 175(4): 743–755. Dominguez-Nunez J A, Munoz D, de la Cruz A, Saiz de Omenaca J A. 2013. Effects of Pseudomonas fluorescens on the water parameters of mycorrhizal and non-mycorrhizal seedlings of Pinus halepensis. Agron, 3(3): 571–582. Ganeshan G, Arthikala A M. 2005. Pseudomonas fluorescens, a potential bacterial antagonist to control plant diseases. J Plant Interact, 1(3): 123–134. Ghadirnezhad R, Fallah A. 2014. Temperature effect on yield and yield components of different rice cultivars in flowering stage. Int J Agron, 2014: 4. Halliwell B. 2006. Reactive species and antioxidants: Redox biology is a fundamental theme of aerobic life. Plant Physiol, 141(2): 312–322. Heinonsalo J, Hurme K R, Sen R. 2004. Recent 14C-labelled assimilate allocation to Scots pine seedling root and mycorrhizosphere compartments developed on reconstructed podsol humus, E- and B-mineral horizons. Plant Soil, 259: 111–121. Herman M A B, Nault B A, Smart C D. 2008. Effects of plant growth promoting rhizobacteria on bell pepper production and

298 green peach aphid infestations in New York. Crop Prot, 27(6): 996–1002. IRRI (International Rice Research Institute). 1996. Standard Evaluation System for Rice. Los Banos, the Philippines: International Rice Research Institute: 102. Lugtenbergc B, Kamilova F. 2009. Plant-growth-promoting rhizobacteria. Annu Rev Microbiol, 63: 541–556. Matthijs S, Tehrani K A, Laus G, Jackson R W, Cooper R W, Cornelis P. 2007. Thioquinolobactin, a Pseudomonas siderophore with antifungal and anti-pythium activity. Environ Microbiol, 9(2): 425–434. Riechmann J L, Meyerowitz E M. 1998. The AP2/EREBP family of plant transcription factors. Biol Chem, 379(6): 633–646. Scheeff E D, Bourne P E. 2005. Structural evolution of the protein

Rice Science, Vol. 24, No. 5, 2017 kinase-like superfamily. PLoS Comput Biol, 1(5): 351–381. Singh K B, Foley R C, Onate-Sanchez L. 2002. Transcription factors in plant defense and stress responses. Curr Opin Plant Biol, 5(5): 430–436. Vleesschauwer D D, Djavaheri M, Bakker P A H M, Hofte M. 2008. Pseudomonas fluorescens WCS374r-induced systemic resistance in rice against Magnaporthe oryzae based on pseudobactin-mediated priming for a salicylic acid-repressible multifaceted defense response. Plant Physiol, 148: 1996–2012. Yan S P, Tang Z C, Su W A, Sun W N. 2005. Proteomic analysis of salt stress responsive proteins in rice root. Proteomics, 5(1): 235–244. (Managing Editor: WANG Caihong)