- Email: [email protected]
galactarate utilization operon ycbCDEFGHJ
FEMS Microbiology Letters 210 (2002) 193^199
www.fems-microbiology.org
Identi¢cation and characterization of the Bacillus subtilis D-glucarate/galactarate utilization operon ycbCDEFGHJ Shigeo Hosoya a , Kunio Yamane b , Michio Takeuchi a , Tsutomu Sato a
a;
International Environmental and Agricultural Science, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan b Institute of Biological Sciences, University of Tsukuba, Ibaraki 305, Japan Received 4 January 2002 ; received in revised form 5 March 2002; accepted 8 March 2002 First published online 5 April 2002
Abstract In the course of the Bacillus subtilis functional genomics project, an open reading frame called ycbG whose product is classified as a transcriptional regulatory protein with a helix-turn-helix motif in the putative D-glucarate/galactarate utilization operon (ycbCDEFGHJ) was initially screened as the gene disruptant that exhibits a defect that blocked the early stage of sporulation. However, the transcription of ycbCDEFG was extremely highly induced in response to nutrient exhaustion by the disruption of ycbG, but inactivation of the transcription from upstream ycbC in the ycbG mutant restored the sporulation efficiency, suggesting that the inappropriate overproduction of the ycbCDEFG gene products inhibits efficient sporulation. We further analyzed the role of the ycbCDEFGHJ cluster and found that (i) a unit of ycbCDEFGHJ was induced by either D-glucarate or D-galactarate, and (ii) the cell growth was inhibited by the mutation of the ycbF and ycbH genes, that respectively encode the putative proteins, D-glucarate dehydratase and D-galactarate dehydratase on plates supplemented with D-glucarate and D-galactarate, respectively, as the sole carbon source. Our results indicate that the ycbCDEFGHJ genes are involved in the utilization of D-glucarate and D-galactarate in B. subtilis. 5 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Glucarate ; Galactarate; Sporulation ; Bacillus subtilis
1. Introduction With the completion of the Bacillus subtilis genomewide sequence [1], the focus of the B. subtilis functional genomics project presently, by Japanese and European consortia, is to conduct the disruption of all genes of unknown functions by insertional mutagenesis using pMUTIN vectors. Recently, Ogasawara [2] reported the ¢rst level test for the disruptants, such as for growth, motility, metabolism, and sporulation etc. In addition, the results of the phenotype of some gene disruptants described in the Micado (http://locus.jouy.inra.fr/cgi-bin/genmic/madbase_ home.pl) and BSORF (http://bacillus.genome.ad.jp/) web sites. Within the framework of this project we identi¢ed the sporulation-de¢cient mutant, ycbG, which encodes a regu-
* Corresponding author. Tel. : +81 (423) 67-5706; Fax : +81 (423) 67-5715. E-mail address : [email protected] (T. Sato).
latory protein for the D-glucarate/galactarate utilization operon, ycbCDEFGHJ. Enzymes in the D-glucarate/galactarate pathways have been identi¢ed in Escherichia coli [3]. The genes encoding these enzymes are organized in three transcriptional units: gudP-ygcY-gudD (encoding D-glucarate permease (GudP), non-functional D-glucarate dehydratase (GudD), and functional D-glucarate dehydratase (GudD), garP-garL-garR-garK (encoding D-galactarate permease (GarP), 5-keto-4-deoxy-D-glucarate aldolase (GarL), tartronate semialdehyde reductase (GarR) and glycerate kinase (GarK) and garD (encoding D-galactarate dehydratase (GarD)) [3,4]. Expression of each of these units is induced by D-galactarate, D-glucarate, and D-glycerate. In contrast, the homologous genes (with their associated putative products) for the E. coli gud and gar genes in B. subtilis contain seven genes which occur in the order ycbC (5-dehydro-4-deoxyglucarate dehydratase), ycbD (aldehyde dehydrogenase), ycbE (GudP), ycbF (GudD), ycbG (transcriptional regulator), ycbH (GarD), and ycbJ (macrolide 2P-phosphotransferase) in a unit. However, so far, there is no knowledge of the genes involved in the metabolism of D-glucarate and D-galactarate in B. subtilis other
0378-1097 / 02 / $22.00 5 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 0 6 1 2 - 2
FEMSLE 10444 23-5-02
194
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
Table 1 Bacterial strains used in this study Strain B. subtilis 168 YCBBd YCBCd YCBEd YCBFd YCBGd YCBHd YCBJd YCBGkm GbB GbC GbF E. coli JM105
Genotype, phenotype and relevant characteristics
Source, reference or constructiona
trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2
Laboratory stock pMUTcbBC168 pMUTcbCC168 pMUTcbEC168 pMUTcbFC168 pMUTcbGC168 pMUTcbHC168 pMUTcbJC168 pJMcbGC168 YCBGkm(chr)CYCBBd YCBGkm(chr)CYCBCd YCBGkm(chr)CYCBFd
ycbB: :pMUTIN2mcs ycbC: :pMUTIN2mcs ycbE: :pMUTIN2mcs ycbF: :pMUTIN2mcs ycbG: :pMUTIN2mcs ycbH: :pMUTIN2mcs ycbJ: :pMUTIN2mcs ycbG: :pJM114 ycbG: :pJM114 ycbB: :pMUTIN2mcs ycbG: :pJM114 ycbC: :pMUTIN2mcs ycbG: :pJM114 ycbF: :pMUTIN2mcs
supE endA sbcB15 hsdR4 rpsL thi v(lac-proAB) FP [traD36 proAB+ lacIq lacZvM15]
than the information from the genome sequence indicating homologies of E. coli gud and gar in B. subtilis. In this paper, we report that the gene disruptant, ycbG, coding a regulatory protein for the putative D-glucarate utilization operon (ycbCDEFGHJ), was incidentally screened as a sporulation-de¢cient mutant from a collection of disruptants of genes of unknown function in B. subtilis constructed by the Japanese consortium of the functional genomics project. Our results further suggest that inappropriate over-expression of ycbCDEFG in the ycbCDEFGHJ operon leads to sporulation defect caused by the disruption of the negative regulator YcbG. Also presented here are the evidences implicating the ycbC-
[5]
DEFGHJ genes in the utilization of D-glucarate and D-galactarate. This is the ¢rst report of analysis of the D-glucarate/galactarate utilization operon in B. subtilis.
2. Materials and methods 2.1. Bacterial strains and genetic techniques The bacterial strains and plasmids used in this study are listed in Table 1. Oligonucleotide primers are shown in Table 2. Transformation of B. subtilis was performed according to the method described by Dubnau and Davi-
Table 2 Oligonucleotide primers used in this study Name
Sequence (5P to 3P)a
Description, locationb and restriction enzyme
ycbB-1 ycbB-2 ycbC-1 ycbC-2 ycbE-1 ycbE-2 ycbF-1 ycbF-2 ycbG-1 ycbG-2 ycbH-1 ycbH-2 ycbJ-1 ycbJ-2 ycbG-F ycbG-R ycbC-T7F ycbJ-T7F T7R
GCGCAAGCTTAAGCTGCTGGTGAAGCAGAC GCCGAGCATCTAGCCGGCTTAGAGAATGCTG GCGCAAGCTTGCACCCGCTGGAATTTTAGG GCCGAGATCTTTTCGCATACTGGTACAGCC GCGCAAGCTTTTTGCGAGTGTTACTCCGGC GCCGAGATCTAGCAGGATAATCGCTGTGCC GCGCAAGCTTTGAAGGTGATTCCTGTTGCG GCCGAGATGTCGACCGGTTCCTGAAGAAAC GCGCAAGCTTAAGTCGATACAGTCAATCGG GCCGAGATCTTTTCCGCGGCAATTGTCACG GCGCAAGCTTAAGAACCAAGCCCCCCTTTA GCCGAGATCTTCCGCATTTCGGTATCCTTC GCGCAAGCTTGCTTATCACTGAGATTGTCG GCCGAGATCTGTAATTCAGCCAGTATGTCG CCGAATTCGGTACGAAGGTTTAGAGG CGCGGATCCCGGCCTGCTGACATGCA CCCAAGCTTGCACCCGCTGGAATTTTAGG CCCAAGCTTGCTTATCACTGAGATTGTCG TAATACGACTCACTATAGGGCGAAGTGTATCAACAAGCTGG
ycbB sense sequence, +80, HindIII ycbB antisense sequence, +410, BglII ycbC sense sequence, +19, HindIII ycbC antisense sequence, +375, BglII ycbE sense sequence, +13, HindIII ycbE antisense sequence, +350, BglII ycbF sense sequence, +68, HindIII ycbF antisense sequence, +427, BglII ycbG sense sequence, +26, HindIII ycbG antisense sequence, +364, BglII ycbH sense sequence, +19, HindIII ycbH antisense sequence, 3374, BglII ycbJ sense sequence, +24, HindIII ycbJ antisense sequence, +415, BglII ycbG sense sequence, +3, EcoRI ycbG antisense sequence, +168, BamHI ycbC sense sequence, +19, HindIII ycbJ sense sequence, +24, HindIII lacZ antisense sequence, 355
a
Additional sequences and restriction sites that do not correspond to the sequences of each gene are in italic and underlined, respectively. Sequence corresponding to the T7 RNA polymerase promoter region is shown in bold. b 3P end position of primers corresponding to the nucleotide numbers from the initiation codon of each gene.
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
do¡-Abelson [6]. The e⁄ciency of sporulation was measured by growing B. subtilis cells in DS (Difco sporulation) medium [7] at 37‡C for 24 h. The number of spores per milliliter of culture (colony forming units) was determined as the number of heat-resistant (80‡C for 10 min) colonies on tryptose blood agar base. Plasmid constructions were made in E. coli JM105. 2.2. Plasmid and strain constructions Plasmids pMUTcbB, pMUTcbC, pMUTcbE, pMUTcbF, pMUTcbG, pMUTcbH, and pMUTcbJ were constructed as follows. ycbB, ycbC, ycbE, ycbF, ycbG, ycbH, and ycbJ internal fragments were ampli¢ed by PCR using chromosomal DNA of B. subtilis 168 as template and oligonucleotide primers ycbB-1, ycbB-2, ycbC-1, ycbC-2, ycbE-1, ycbE-2, ycbF-1, ycbF-2, ycbG-1, ycbG-2, ycbH-1, ycbH-2, ycbJ-1, and ycbJ-2, respectively. These PCR products were trimmed with HindIII and BglII and ligated with pMUTIN2mcs that had been digested with HindIII and BamHI. The ligated DNAs were used to transform E. coli JM105 and selected by ampicillin resistance on an LB plate. Plasmid pJMcbG was obtained by subcloning an EcoRI^BamHI fragment, bearing the ycbG gene ampli¢ed by ycbG-F and ycbG-R primed PCR into the (EcoRI^BamHI) sites of pJM114 [8]. 2.3. L-Galactosidase assay One-ml aliquots of cells cultured in DS medium at 37‡C were taken and pelleted by centrifugation at the indicated times for the assay of L-galactosidase activity as described by Miller [9].
195
ycbG gene encodes a 233-amino acid long product. The deduced amino acid sequence showed a feature of transcriptional regulatory proteins, including a helix-turn-helix motif with the GntR family. Four genes, ycbCDEF, are located upstream the ycbG gene, and two other genes, ycbHJ, are located downstream in the ycbCDEFGHJ gene cluster [1]. The products of ycbE, F, H are similar to E. coli GudP, GudD, and GarD, respectively. In contrast, in E. coli, the genes involved in the utilization of D-glucarate, D-glycerate and D-galactarate are apparently distributed in three transcriptional units [4]. Based on the similarity of the predicted protein sequences of B. subtilis to those in E. coli, the products of the ycbCDEFGH gene cluster were assumed as being involved in the utilization of these compounds. However, the ycbG mutant (YCBGd) ine⁄ciently sporulated in DS medium, showing about 10% of wild-type sporulation frequency. Although we have shown that the mutation in ycbG blocked sporulation, it is likely that this inhibition is due to the inappropriate expression of ycbCDEFG genes during sporulation where the ycbG product acts as a transcriptional regulator for the ycbCDEFGHJ gene cluster. The other possibility is that YcbG may play a direct role in sporulation. To verify these possibilities, we constructed the ycbC and ycbG double insertion mutant and then examined its sporulation frequency. As expected, the sporulation e⁄ciency of the double-mutated strains did not exhibit any sporulation defect, indicating that the sporulation e⁄ciency of the ycbG mutant could be restored by insertional mutagenesis in ycbC (data not shown). These results imply that the inappropriate expression of ycbCDEFG a¡ects to sporulation. 3.2. Expression of the ycbCDEFG gene cluster in the insertional mutant of ycbG
2.4. Northern hybridization Cells were grown in DS medium at 37‡C, and aliquots were harvested by centrifugation, and then total RNA was extracted from the cells. Hybridizations speci¢c for ycbC, ycbG and ycbJ mRNA were conducted with digoxigeninlabeled RNA probes synthesized in vitro with T7 RNA polymerase. Oligonucleotide primers and template DNA were used in PCRs to generate-speci¢c probes of genes: ycbC, ycbC-T7F and T7R with chromosomal DNA from YCBCd; ycbG, ycbG-F and T7R with chromosomal DNA from YCBGd ; ycbJ, ycbJ-T7F and T7R with chromosomal DNA from YCBJd (Tables 1 and 2).
3. Results and discussion 3.1. Isolation of the ycbG gene The B. subtilis functional genomics project by the Japanese consortium revealed an open reading frame called ycbG disruption which exhibits a sporulation defect. The
To characterize the regulation of expression of the ycbCDEFGHJ gene cluster, we ¢rst determined the pattern of expression of L-galactosidase activity in the pMUTIN2mcs-inserted strains YCBBd (an ycbB-lacZ fusion strain), YCBCd (an ycbC-lacZ fusion strain), YCBFd (an ycbF-lacZ fusion strain), YCBGd (an ycbG-lacZ fusion strain), YCBHd (an ycbH-lacZ fusion strain), and YCBJd (an ycbJ-lacZ fusion strain). The ycbAB genes are located upstream the ycbC (226 bp distance between ycbB and ycbC). Note that the integration vector pMUTIN2mcs allows generation of a lacZ fusion transcript with a gene for L-galactosidase but interferes with transcription of genes downstream the sites it is inserted by the pMUTin2mcs vector. This is caused by the strong terminators in the pMUTIN2mcs. As shown in Fig. 1A, L-galactosidase activities were not detected in the strains YCBBd, YCBCd, YCBFd, YCBHd, and YCBJd. However, an extremely high level of L-galactosidase activity was detected in the strain YCBGd following nutrient deprivation. We next introduced the ycbG insertional muta-
FEMSLE 10444 23-5-02
196
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
speci¢c expression of ycbCDEFG, but it is likely that some regulatory factor might act to e¡ect full expression of ycbCDEFG.
3.3. Expression of the ycbCDEFGHJ gene cluster on D-glucarate, D-galactarate, and D-glycerate and determination of the transcriptional units
Fig. 1. E¡ects of mutation in the ycbG gene on the expression of ycb gene cluster. A: Expression of lacZ fusions of ycbB (in strain YCBBd, 8), ycbC (in strain YCBCd, F), ycbF (in strain YCBFd, R), ycbG (in strain YCBGd, b), ycbH (in strain YCBHd, X), ycbJ (in strain YCBJd, *). B: Expression of lacZ fusions of ycbB (in stain GbB, 8), ycbC (in strain GbC, F), ycbF (in strain GbF, b) in the ycbG: :pJM114 insertional mutant.
tion into the chromosomal DNA of the YCBBd, YCBCd, and YCBFd strains, since we assumed that the ycbG product plays a role as a regulatory protein of the ycbAB and ycbCDEFGHJ gene clusters in which case we expected the expression of genes negatively regulated by YcbG to be switched on by the disruption of the ycbG gene in each strain. We determined the L-galactosidase activity in these mutants, GbB (an ycbG-inactivated YCBBd strain), GbC (an ycbG-inactivated YCBCd strain), and GbF (an ycbGinactivated YCBFd strain). To our expectation, extremely high levels of L-galactosidase activities were detected in the strains GbC and GbF, but not in the strain GbB (Fig. 1B). This result indicates that the ycbC and ycbF (and also most probably ycbD and ycbE) gene cluster is negatively regulated by YcbG. This result further suggests that at least ycbCDEFG within ycbCDEFGHJ is a unit of transcription from a putative promoter between ycbB and ycbC, named P1. Moreover, an additional promoter is anticipated at the immediate upstream of ycbG, probably within the ycbF gene, since no L-galactosidase activity of ycbF-lacZ could be detected in YCBFd in which transcription of ycbG from P1 is blocked by insertion of pMUTIN2mcs. In principle, the transcription from P1 ought to be activated, if the ycbG gene is transcribed from P1 as a single promoter. We named this anticipated putative promoter just upstream ycbG P2. The extreme expression in ycbG mutant was induced from after the end of the exponential phase. We speculated that ycbA and ycbB, which encode a putative sensory transduction histidine kinase and a putative sensory transduction protein, respectively, may regulate the expression of ycbCDEFG during the exponential phase. To test this possibility, we introduced ycbB mutation into the strain YCBCd. However, the L-galactosidase activity was not detected in this strain (data not shown). We could not identify what protein is involved in the stationary phase-
Some of the genes in the B. subtilis ycbCDEFGHJ gene cluster are homologous to the D-glucarate/galactarate/glycerate utilization genes of E. coli [4]. Therefore, we ¢rst determined whether the ycbCDEFGHJ gene cluster is induced by these compounds or not. To establish the regulation of expression of the ycbCDEFGHJ gene, we determined the L-galactosidase activity expressed in the strains YCBCd (an ycbC-lacZ fusion strain), YCBHd (an ycbHlacZ fusion strain) and YCBJd (an ycbJ-lacZ fusion strain) in the presence and absence of the compounds (Fig. 2A). As expected, expression of all fusions was induced by the addition of D-glucarate and D-galactarate. The expression pattern of each gene with the two compounds was consistent with that of the ycbG mutants. However, no L-galactosidase activity was detected in the presence of D-glycerate, a phenotype dissimilar to E. coli. Furthermore, to examine the transcript of the putative ycbCDEFGHJ operon, we performed Northern blot analysis. Respective probes speci¢c to ycbC, ycbG, and ycbJ were hybridized to blots with total RNA from wild-type cells incubated with or without D-glucarate or D-galactarate-containing DS medium (Fig. 2B). Hybridization with all probes revealed the presence of one transcript of approximately 8.3 kb, which was solely detectable in RNA isolated from cells incubated with D-glucarate and D-galactarate. On the other hand, no transcripts were detected in cells incubated without D-glucarate and D-galactarate. The 8.3-kb transcripts were not unexpected from the length of the entire operon (ycbCDEFGHJ). In addition, 7.4-kb and 5.9-kb transcripts were detected with the ycbCand ycbG-speci¢c probes. 2.4-kb and 0.8-kb transcripts were also observed with ycbC- and ycbG-speci¢c probes, respectively (Fig. 2B). These results indicate that transcripts of 8.3 kb from P1 and 0.8 kb and 2.3 kb from P2 were induced by D-glucarate and D-galactarate. We could not detect products from P2 in the non-induced condition. However, considering the results of the L-galactosidase assay in Fig. 1A, the basal level of transcription of ycbG, whose product su⁄ciently represses the ycbCDEFGHJ operon, is possibly expressed from P2. The 7.4-kb, 5.9-kb and 2.3-kb products are either transcripts from P1 or the products of posttranscriptional processing of the larger 8.3-kb mRNA. Notably, found in the region between ycbJ and its downstream yczA is a strong termination-like structure, indicating that the ycbCDEFGHJ cluster consists of an operon induced by D-glucarate and D-galactarate.
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
197
Fig. 2. Induction of the ycbCDEFGHJ operon. A: Induction of ycbC-lacZ (in strain YCBCd), ycbH-lacZ (in strain YCBHd), ycbJ-lacZ (in strain YCBJd) by D-glucarate and D-galactarate. Overnight cultures were inoculated in fresh DS medium with no inducer (8), 1 mM inducer (F), and 10 mM inducer (b). B: Northern blotting analysis of the ycbCDEFGHJ transcript. Physical map of the ycbAB genes and the ycbCDEFGHJ operon is shown (upper section). Arrows indicate the observed mRNA species. Lines under the physical map indicate probes. Total RNA extracted from cells of strain 168 at T1 (1 h after the end of the exponential phase) incubated with no compounds (N), D-galactarate (Gal), or D-glucarate (Glu)-containing DS medium (lower section).
FEMSLE 10444 23-5-02
198
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
3.4. Growth of the mutants of genes in the ycbCDEFGHJ operon with D-glucarate, D-galactarate and D-glycerate as a sole carbon source The utilization of D-glucarate, D-glycerate and D-galactarate in E. coli has been reported [4]. However, in B. subtilis no information is available on the utilization of these compounds. The growth of B. subtilis 168 was investigated on minimum C agar plates containing either of these compounds without glucose. E. coli could grow on either compound. In contrast, B. subtilis could not grow on D-glycerate, but grow on D-glucarate and D-galactarate, suggesting that B. subtilis lacks the metabolic function to utilize D-glycerate. This result is consistent with the inability of the ycbCDEFGHJ operon by the addition of D-glycerate as discussed earlier in this text. We further studied the function of YcbF and YcbH, whose products have high homology with E. coli GudD (72%) and GarD (66%). Both D-glucarate and D-galactarate are converted to 5-keto-4-deoxy-D-glucarate by the respective enzymes GudD and GarD. In the YCBFd strain, in addition to the disruption of the ycbF gene by the insertional vector pMUTIN2mcs, the transcription of ycbGHJ from the major promoter P1 was interrupted, thus anticipating that the full expression of ycbH will be abolished. As shown in Fig. 3, YCBFd could not grow on both D-glucarate and Dgalactarate agar plates. On the other hand, in the YCBHd strain, the ycbH gene was disrupted and transcription of
ycbJ, downstream of ycbH, was interrupted. The ycbJ gene, whose product is 43% similar to macrolide 2P-phosphotransferase, is the last gene of the ycbCDEFGHJ operon. The disruption of the ycbJ gene did not inhibit the growth on both D-glucarate and D-galactarate agar plates. We further observed cell growth in the YCBHd strain on the D-glucarate, but not the D-galactarate plates, indicating that whereas ycbH is essential for the utilization of D-galactarate, ycbJ is not. These results suggest that YcbF and YcbH might have some GudD and GarD functions, respectively. Of the other products of the ycbCDEFGHJ operon, YcbC has 35% similarity to KdgD of Pseudomonas putida. KdgD, known as 5-dehydro-4-deoxyglucarate dehydratase, hydrates 5-keto-4-deoxy-D-glucarate to 2,5dioxopentanoate. YcbD is 40% similar to aldehyde dehydrogenase, which possibly dehydrates D-glucuronolactone to D-glucarate. YcbE contains 12 putative trans-membrane segments, implicating it as a transporter. In E. coli, D-glucarate and D-galactarate are dehydrated to 5-keto-4-deoxy-D-glucarate by GudD and GarD, respectively. Whereas 5-keto-4-deoxy-D-glucarate is converted to tartronate semialdehyde and pyruvate by GarL. Tartronate semialdehyde is reduced to D-glycerate by tartronate semialdehyde reductase and then phosphorylated to 3-phosphoglycerate by glycerate kinase. Interestingly, B. subtilis has no homologue of GarL, and thus cannot utilize D-glycerate. YcbC possibly dehydrates 5-keto-4-deoxy-D-glucarate to 2,5-dioxopentanoate. Based on these evidences, we conclude that the B. subtilis D-glucarate/galactarate utilization pathway di¡ers from that of E. coli. The ¢nal product in this pathway may be 2,5-dioxopentanoate involved in the ycbCDEFGHJ operon.
Acknowledgements We thank Samuel Amiteye for critical reading of the manuscript. This work was supported by a grant-in-aid for scienti¢c research on priority areas (C) ‘Genome Biology’ from the Ministry of Education, Science, Sports, and Culture of Japan.
References
Fig. 3. Contrasting e¡ect of growth of the wild-type strains of E. coli and B. subtilis, and the B. subtilis mutants. The wild-type strains of E. coli JM105, B. subtilis 168, and B. subtilis mutants strains (YCBFd, YCBHd and YCBJd) were grown on minimum C plates at 37‡C for 48 h under conditions of no compounds (a), 10 mM each of D-glucose (b), D-glucarate (e, g), D-galactarate (d, f) and D-glycerate (c).
[1] Kunst, F., Ogasawara, N. and Moszer, I. et al. (1997) The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249^256. [2] Ogasawara, N. (2000) Systematic function analysis of Bacillus subtilis genes. Res. Microbiol. 151, 129^134. [3] Hubbard, K.B., Koch, M., Palmer, D.R.J., Babbitt, P.C. and Gerlt, J.A. (1998) Evolution of enzymatic activities in the enolase superfamily: characterization of the (D)-glucarate/galactarate catabolic pathway in Escherichia coli. Biochemistry 37, 14369^14375. [4] Monterrubio, R., Baldoma, L., Obradors, N., Aguilar, J. and Badia, J. (2000) A common regulator for the operons encoding the enzymes
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199 involved in D-galactarate, D-glucarate, and D-glycerate utilization in Escherichia coli. J. Bacteriol. 182, 2672^2674. [5] Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103^119. [6] Dubnau, D. and Davido¡-Abelson, R. (1971) Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor^recipient complex. J. Mol. Biol. 56, 209^ 221.
199
[7] Schae¡er, P., Millet, J. and Aubert, J.P. (1965) Catabolic repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA 54, 704^ 711. [8] Pergo, M. (1993) Integrational vectors for genetic manipulation in Bacillus subtilis. In: Bacillus subtilis and other Gram-positive Bacteria (Sonenshein, A.L., Hoch, J.H. and Losick, R., Eds.), pp. 615^624. American Society for Microbiology, Washington, DC. [9] Miller, J.H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
FEMSLE 10444 23-5-02
www.fems-microbiology.org
Identi¢cation and characterization of the Bacillus subtilis D-glucarate/galactarate utilization operon ycbCDEFGHJ Shigeo Hosoya a , Kunio Yamane b , Michio Takeuchi a , Tsutomu Sato a
a;
International Environmental and Agricultural Science, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan b Institute of Biological Sciences, University of Tsukuba, Ibaraki 305, Japan Received 4 January 2002 ; received in revised form 5 March 2002; accepted 8 March 2002 First published online 5 April 2002
Abstract In the course of the Bacillus subtilis functional genomics project, an open reading frame called ycbG whose product is classified as a transcriptional regulatory protein with a helix-turn-helix motif in the putative D-glucarate/galactarate utilization operon (ycbCDEFGHJ) was initially screened as the gene disruptant that exhibits a defect that blocked the early stage of sporulation. However, the transcription of ycbCDEFG was extremely highly induced in response to nutrient exhaustion by the disruption of ycbG, but inactivation of the transcription from upstream ycbC in the ycbG mutant restored the sporulation efficiency, suggesting that the inappropriate overproduction of the ycbCDEFG gene products inhibits efficient sporulation. We further analyzed the role of the ycbCDEFGHJ cluster and found that (i) a unit of ycbCDEFGHJ was induced by either D-glucarate or D-galactarate, and (ii) the cell growth was inhibited by the mutation of the ycbF and ycbH genes, that respectively encode the putative proteins, D-glucarate dehydratase and D-galactarate dehydratase on plates supplemented with D-glucarate and D-galactarate, respectively, as the sole carbon source. Our results indicate that the ycbCDEFGHJ genes are involved in the utilization of D-glucarate and D-galactarate in B. subtilis. 5 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Glucarate ; Galactarate; Sporulation ; Bacillus subtilis
1. Introduction With the completion of the Bacillus subtilis genomewide sequence [1], the focus of the B. subtilis functional genomics project presently, by Japanese and European consortia, is to conduct the disruption of all genes of unknown functions by insertional mutagenesis using pMUTIN vectors. Recently, Ogasawara [2] reported the ¢rst level test for the disruptants, such as for growth, motility, metabolism, and sporulation etc. In addition, the results of the phenotype of some gene disruptants described in the Micado (http://locus.jouy.inra.fr/cgi-bin/genmic/madbase_ home.pl) and BSORF (http://bacillus.genome.ad.jp/) web sites. Within the framework of this project we identi¢ed the sporulation-de¢cient mutant, ycbG, which encodes a regu-
* Corresponding author. Tel. : +81 (423) 67-5706; Fax : +81 (423) 67-5715. E-mail address : [email protected] (T. Sato).
latory protein for the D-glucarate/galactarate utilization operon, ycbCDEFGHJ. Enzymes in the D-glucarate/galactarate pathways have been identi¢ed in Escherichia coli [3]. The genes encoding these enzymes are organized in three transcriptional units: gudP-ygcY-gudD (encoding D-glucarate permease (GudP), non-functional D-glucarate dehydratase (GudD), and functional D-glucarate dehydratase (GudD), garP-garL-garR-garK (encoding D-galactarate permease (GarP), 5-keto-4-deoxy-D-glucarate aldolase (GarL), tartronate semialdehyde reductase (GarR) and glycerate kinase (GarK) and garD (encoding D-galactarate dehydratase (GarD)) [3,4]. Expression of each of these units is induced by D-galactarate, D-glucarate, and D-glycerate. In contrast, the homologous genes (with their associated putative products) for the E. coli gud and gar genes in B. subtilis contain seven genes which occur in the order ycbC (5-dehydro-4-deoxyglucarate dehydratase), ycbD (aldehyde dehydrogenase), ycbE (GudP), ycbF (GudD), ycbG (transcriptional regulator), ycbH (GarD), and ycbJ (macrolide 2P-phosphotransferase) in a unit. However, so far, there is no knowledge of the genes involved in the metabolism of D-glucarate and D-galactarate in B. subtilis other
0378-1097 / 02 / $22.00 5 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 0 6 1 2 - 2
FEMSLE 10444 23-5-02
194
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
Table 1 Bacterial strains used in this study Strain B. subtilis 168 YCBBd YCBCd YCBEd YCBFd YCBGd YCBHd YCBJd YCBGkm GbB GbC GbF E. coli JM105
Genotype, phenotype and relevant characteristics
Source, reference or constructiona
trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2 trpC2
Laboratory stock pMUTcbBC168 pMUTcbCC168 pMUTcbEC168 pMUTcbFC168 pMUTcbGC168 pMUTcbHC168 pMUTcbJC168 pJMcbGC168 YCBGkm(chr)CYCBBd YCBGkm(chr)CYCBCd YCBGkm(chr)CYCBFd
ycbB: :pMUTIN2mcs ycbC: :pMUTIN2mcs ycbE: :pMUTIN2mcs ycbF: :pMUTIN2mcs ycbG: :pMUTIN2mcs ycbH: :pMUTIN2mcs ycbJ: :pMUTIN2mcs ycbG: :pJM114 ycbG: :pJM114 ycbB: :pMUTIN2mcs ycbG: :pJM114 ycbC: :pMUTIN2mcs ycbG: :pJM114 ycbF: :pMUTIN2mcs
supE endA sbcB15 hsdR4 rpsL thi v(lac-proAB) FP [traD36 proAB+ lacIq lacZvM15]
than the information from the genome sequence indicating homologies of E. coli gud and gar in B. subtilis. In this paper, we report that the gene disruptant, ycbG, coding a regulatory protein for the putative D-glucarate utilization operon (ycbCDEFGHJ), was incidentally screened as a sporulation-de¢cient mutant from a collection of disruptants of genes of unknown function in B. subtilis constructed by the Japanese consortium of the functional genomics project. Our results further suggest that inappropriate over-expression of ycbCDEFG in the ycbCDEFGHJ operon leads to sporulation defect caused by the disruption of the negative regulator YcbG. Also presented here are the evidences implicating the ycbC-
[5]
DEFGHJ genes in the utilization of D-glucarate and D-galactarate. This is the ¢rst report of analysis of the D-glucarate/galactarate utilization operon in B. subtilis.
2. Materials and methods 2.1. Bacterial strains and genetic techniques The bacterial strains and plasmids used in this study are listed in Table 1. Oligonucleotide primers are shown in Table 2. Transformation of B. subtilis was performed according to the method described by Dubnau and Davi-
Table 2 Oligonucleotide primers used in this study Name
Sequence (5P to 3P)a
Description, locationb and restriction enzyme
ycbB-1 ycbB-2 ycbC-1 ycbC-2 ycbE-1 ycbE-2 ycbF-1 ycbF-2 ycbG-1 ycbG-2 ycbH-1 ycbH-2 ycbJ-1 ycbJ-2 ycbG-F ycbG-R ycbC-T7F ycbJ-T7F T7R
GCGCAAGCTTAAGCTGCTGGTGAAGCAGAC GCCGAGCATCTAGCCGGCTTAGAGAATGCTG GCGCAAGCTTGCACCCGCTGGAATTTTAGG GCCGAGATCTTTTCGCATACTGGTACAGCC GCGCAAGCTTTTTGCGAGTGTTACTCCGGC GCCGAGATCTAGCAGGATAATCGCTGTGCC GCGCAAGCTTTGAAGGTGATTCCTGTTGCG GCCGAGATGTCGACCGGTTCCTGAAGAAAC GCGCAAGCTTAAGTCGATACAGTCAATCGG GCCGAGATCTTTTCCGCGGCAATTGTCACG GCGCAAGCTTAAGAACCAAGCCCCCCTTTA GCCGAGATCTTCCGCATTTCGGTATCCTTC GCGCAAGCTTGCTTATCACTGAGATTGTCG GCCGAGATCTGTAATTCAGCCAGTATGTCG CCGAATTCGGTACGAAGGTTTAGAGG CGCGGATCCCGGCCTGCTGACATGCA CCCAAGCTTGCACCCGCTGGAATTTTAGG CCCAAGCTTGCTTATCACTGAGATTGTCG TAATACGACTCACTATAGGGCGAAGTGTATCAACAAGCTGG
ycbB sense sequence, +80, HindIII ycbB antisense sequence, +410, BglII ycbC sense sequence, +19, HindIII ycbC antisense sequence, +375, BglII ycbE sense sequence, +13, HindIII ycbE antisense sequence, +350, BglII ycbF sense sequence, +68, HindIII ycbF antisense sequence, +427, BglII ycbG sense sequence, +26, HindIII ycbG antisense sequence, +364, BglII ycbH sense sequence, +19, HindIII ycbH antisense sequence, 3374, BglII ycbJ sense sequence, +24, HindIII ycbJ antisense sequence, +415, BglII ycbG sense sequence, +3, EcoRI ycbG antisense sequence, +168, BamHI ycbC sense sequence, +19, HindIII ycbJ sense sequence, +24, HindIII lacZ antisense sequence, 355
a
Additional sequences and restriction sites that do not correspond to the sequences of each gene are in italic and underlined, respectively. Sequence corresponding to the T7 RNA polymerase promoter region is shown in bold. b 3P end position of primers corresponding to the nucleotide numbers from the initiation codon of each gene.
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
do¡-Abelson [6]. The e⁄ciency of sporulation was measured by growing B. subtilis cells in DS (Difco sporulation) medium [7] at 37‡C for 24 h. The number of spores per milliliter of culture (colony forming units) was determined as the number of heat-resistant (80‡C for 10 min) colonies on tryptose blood agar base. Plasmid constructions were made in E. coli JM105. 2.2. Plasmid and strain constructions Plasmids pMUTcbB, pMUTcbC, pMUTcbE, pMUTcbF, pMUTcbG, pMUTcbH, and pMUTcbJ were constructed as follows. ycbB, ycbC, ycbE, ycbF, ycbG, ycbH, and ycbJ internal fragments were ampli¢ed by PCR using chromosomal DNA of B. subtilis 168 as template and oligonucleotide primers ycbB-1, ycbB-2, ycbC-1, ycbC-2, ycbE-1, ycbE-2, ycbF-1, ycbF-2, ycbG-1, ycbG-2, ycbH-1, ycbH-2, ycbJ-1, and ycbJ-2, respectively. These PCR products were trimmed with HindIII and BglII and ligated with pMUTIN2mcs that had been digested with HindIII and BamHI. The ligated DNAs were used to transform E. coli JM105 and selected by ampicillin resistance on an LB plate. Plasmid pJMcbG was obtained by subcloning an EcoRI^BamHI fragment, bearing the ycbG gene ampli¢ed by ycbG-F and ycbG-R primed PCR into the (EcoRI^BamHI) sites of pJM114 [8]. 2.3. L-Galactosidase assay One-ml aliquots of cells cultured in DS medium at 37‡C were taken and pelleted by centrifugation at the indicated times for the assay of L-galactosidase activity as described by Miller [9].
195
ycbG gene encodes a 233-amino acid long product. The deduced amino acid sequence showed a feature of transcriptional regulatory proteins, including a helix-turn-helix motif with the GntR family. Four genes, ycbCDEF, are located upstream the ycbG gene, and two other genes, ycbHJ, are located downstream in the ycbCDEFGHJ gene cluster [1]. The products of ycbE, F, H are similar to E. coli GudP, GudD, and GarD, respectively. In contrast, in E. coli, the genes involved in the utilization of D-glucarate, D-glycerate and D-galactarate are apparently distributed in three transcriptional units [4]. Based on the similarity of the predicted protein sequences of B. subtilis to those in E. coli, the products of the ycbCDEFGH gene cluster were assumed as being involved in the utilization of these compounds. However, the ycbG mutant (YCBGd) ine⁄ciently sporulated in DS medium, showing about 10% of wild-type sporulation frequency. Although we have shown that the mutation in ycbG blocked sporulation, it is likely that this inhibition is due to the inappropriate expression of ycbCDEFG genes during sporulation where the ycbG product acts as a transcriptional regulator for the ycbCDEFGHJ gene cluster. The other possibility is that YcbG may play a direct role in sporulation. To verify these possibilities, we constructed the ycbC and ycbG double insertion mutant and then examined its sporulation frequency. As expected, the sporulation e⁄ciency of the double-mutated strains did not exhibit any sporulation defect, indicating that the sporulation e⁄ciency of the ycbG mutant could be restored by insertional mutagenesis in ycbC (data not shown). These results imply that the inappropriate expression of ycbCDEFG a¡ects to sporulation. 3.2. Expression of the ycbCDEFG gene cluster in the insertional mutant of ycbG
2.4. Northern hybridization Cells were grown in DS medium at 37‡C, and aliquots were harvested by centrifugation, and then total RNA was extracted from the cells. Hybridizations speci¢c for ycbC, ycbG and ycbJ mRNA were conducted with digoxigeninlabeled RNA probes synthesized in vitro with T7 RNA polymerase. Oligonucleotide primers and template DNA were used in PCRs to generate-speci¢c probes of genes: ycbC, ycbC-T7F and T7R with chromosomal DNA from YCBCd; ycbG, ycbG-F and T7R with chromosomal DNA from YCBGd ; ycbJ, ycbJ-T7F and T7R with chromosomal DNA from YCBJd (Tables 1 and 2).
3. Results and discussion 3.1. Isolation of the ycbG gene The B. subtilis functional genomics project by the Japanese consortium revealed an open reading frame called ycbG disruption which exhibits a sporulation defect. The
To characterize the regulation of expression of the ycbCDEFGHJ gene cluster, we ¢rst determined the pattern of expression of L-galactosidase activity in the pMUTIN2mcs-inserted strains YCBBd (an ycbB-lacZ fusion strain), YCBCd (an ycbC-lacZ fusion strain), YCBFd (an ycbF-lacZ fusion strain), YCBGd (an ycbG-lacZ fusion strain), YCBHd (an ycbH-lacZ fusion strain), and YCBJd (an ycbJ-lacZ fusion strain). The ycbAB genes are located upstream the ycbC (226 bp distance between ycbB and ycbC). Note that the integration vector pMUTIN2mcs allows generation of a lacZ fusion transcript with a gene for L-galactosidase but interferes with transcription of genes downstream the sites it is inserted by the pMUTin2mcs vector. This is caused by the strong terminators in the pMUTIN2mcs. As shown in Fig. 1A, L-galactosidase activities were not detected in the strains YCBBd, YCBCd, YCBFd, YCBHd, and YCBJd. However, an extremely high level of L-galactosidase activity was detected in the strain YCBGd following nutrient deprivation. We next introduced the ycbG insertional muta-
FEMSLE 10444 23-5-02
196
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
speci¢c expression of ycbCDEFG, but it is likely that some regulatory factor might act to e¡ect full expression of ycbCDEFG.
3.3. Expression of the ycbCDEFGHJ gene cluster on D-glucarate, D-galactarate, and D-glycerate and determination of the transcriptional units
Fig. 1. E¡ects of mutation in the ycbG gene on the expression of ycb gene cluster. A: Expression of lacZ fusions of ycbB (in strain YCBBd, 8), ycbC (in strain YCBCd, F), ycbF (in strain YCBFd, R), ycbG (in strain YCBGd, b), ycbH (in strain YCBHd, X), ycbJ (in strain YCBJd, *). B: Expression of lacZ fusions of ycbB (in stain GbB, 8), ycbC (in strain GbC, F), ycbF (in strain GbF, b) in the ycbG: :pJM114 insertional mutant.
tion into the chromosomal DNA of the YCBBd, YCBCd, and YCBFd strains, since we assumed that the ycbG product plays a role as a regulatory protein of the ycbAB and ycbCDEFGHJ gene clusters in which case we expected the expression of genes negatively regulated by YcbG to be switched on by the disruption of the ycbG gene in each strain. We determined the L-galactosidase activity in these mutants, GbB (an ycbG-inactivated YCBBd strain), GbC (an ycbG-inactivated YCBCd strain), and GbF (an ycbGinactivated YCBFd strain). To our expectation, extremely high levels of L-galactosidase activities were detected in the strains GbC and GbF, but not in the strain GbB (Fig. 1B). This result indicates that the ycbC and ycbF (and also most probably ycbD and ycbE) gene cluster is negatively regulated by YcbG. This result further suggests that at least ycbCDEFG within ycbCDEFGHJ is a unit of transcription from a putative promoter between ycbB and ycbC, named P1. Moreover, an additional promoter is anticipated at the immediate upstream of ycbG, probably within the ycbF gene, since no L-galactosidase activity of ycbF-lacZ could be detected in YCBFd in which transcription of ycbG from P1 is blocked by insertion of pMUTIN2mcs. In principle, the transcription from P1 ought to be activated, if the ycbG gene is transcribed from P1 as a single promoter. We named this anticipated putative promoter just upstream ycbG P2. The extreme expression in ycbG mutant was induced from after the end of the exponential phase. We speculated that ycbA and ycbB, which encode a putative sensory transduction histidine kinase and a putative sensory transduction protein, respectively, may regulate the expression of ycbCDEFG during the exponential phase. To test this possibility, we introduced ycbB mutation into the strain YCBCd. However, the L-galactosidase activity was not detected in this strain (data not shown). We could not identify what protein is involved in the stationary phase-
Some of the genes in the B. subtilis ycbCDEFGHJ gene cluster are homologous to the D-glucarate/galactarate/glycerate utilization genes of E. coli [4]. Therefore, we ¢rst determined whether the ycbCDEFGHJ gene cluster is induced by these compounds or not. To establish the regulation of expression of the ycbCDEFGHJ gene, we determined the L-galactosidase activity expressed in the strains YCBCd (an ycbC-lacZ fusion strain), YCBHd (an ycbHlacZ fusion strain) and YCBJd (an ycbJ-lacZ fusion strain) in the presence and absence of the compounds (Fig. 2A). As expected, expression of all fusions was induced by the addition of D-glucarate and D-galactarate. The expression pattern of each gene with the two compounds was consistent with that of the ycbG mutants. However, no L-galactosidase activity was detected in the presence of D-glycerate, a phenotype dissimilar to E. coli. Furthermore, to examine the transcript of the putative ycbCDEFGHJ operon, we performed Northern blot analysis. Respective probes speci¢c to ycbC, ycbG, and ycbJ were hybridized to blots with total RNA from wild-type cells incubated with or without D-glucarate or D-galactarate-containing DS medium (Fig. 2B). Hybridization with all probes revealed the presence of one transcript of approximately 8.3 kb, which was solely detectable in RNA isolated from cells incubated with D-glucarate and D-galactarate. On the other hand, no transcripts were detected in cells incubated without D-glucarate and D-galactarate. The 8.3-kb transcripts were not unexpected from the length of the entire operon (ycbCDEFGHJ). In addition, 7.4-kb and 5.9-kb transcripts were detected with the ycbCand ycbG-speci¢c probes. 2.4-kb and 0.8-kb transcripts were also observed with ycbC- and ycbG-speci¢c probes, respectively (Fig. 2B). These results indicate that transcripts of 8.3 kb from P1 and 0.8 kb and 2.3 kb from P2 were induced by D-glucarate and D-galactarate. We could not detect products from P2 in the non-induced condition. However, considering the results of the L-galactosidase assay in Fig. 1A, the basal level of transcription of ycbG, whose product su⁄ciently represses the ycbCDEFGHJ operon, is possibly expressed from P2. The 7.4-kb, 5.9-kb and 2.3-kb products are either transcripts from P1 or the products of posttranscriptional processing of the larger 8.3-kb mRNA. Notably, found in the region between ycbJ and its downstream yczA is a strong termination-like structure, indicating that the ycbCDEFGHJ cluster consists of an operon induced by D-glucarate and D-galactarate.
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
197
Fig. 2. Induction of the ycbCDEFGHJ operon. A: Induction of ycbC-lacZ (in strain YCBCd), ycbH-lacZ (in strain YCBHd), ycbJ-lacZ (in strain YCBJd) by D-glucarate and D-galactarate. Overnight cultures were inoculated in fresh DS medium with no inducer (8), 1 mM inducer (F), and 10 mM inducer (b). B: Northern blotting analysis of the ycbCDEFGHJ transcript. Physical map of the ycbAB genes and the ycbCDEFGHJ operon is shown (upper section). Arrows indicate the observed mRNA species. Lines under the physical map indicate probes. Total RNA extracted from cells of strain 168 at T1 (1 h after the end of the exponential phase) incubated with no compounds (N), D-galactarate (Gal), or D-glucarate (Glu)-containing DS medium (lower section).
FEMSLE 10444 23-5-02
198
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199
3.4. Growth of the mutants of genes in the ycbCDEFGHJ operon with D-glucarate, D-galactarate and D-glycerate as a sole carbon source The utilization of D-glucarate, D-glycerate and D-galactarate in E. coli has been reported [4]. However, in B. subtilis no information is available on the utilization of these compounds. The growth of B. subtilis 168 was investigated on minimum C agar plates containing either of these compounds without glucose. E. coli could grow on either compound. In contrast, B. subtilis could not grow on D-glycerate, but grow on D-glucarate and D-galactarate, suggesting that B. subtilis lacks the metabolic function to utilize D-glycerate. This result is consistent with the inability of the ycbCDEFGHJ operon by the addition of D-glycerate as discussed earlier in this text. We further studied the function of YcbF and YcbH, whose products have high homology with E. coli GudD (72%) and GarD (66%). Both D-glucarate and D-galactarate are converted to 5-keto-4-deoxy-D-glucarate by the respective enzymes GudD and GarD. In the YCBFd strain, in addition to the disruption of the ycbF gene by the insertional vector pMUTIN2mcs, the transcription of ycbGHJ from the major promoter P1 was interrupted, thus anticipating that the full expression of ycbH will be abolished. As shown in Fig. 3, YCBFd could not grow on both D-glucarate and Dgalactarate agar plates. On the other hand, in the YCBHd strain, the ycbH gene was disrupted and transcription of
ycbJ, downstream of ycbH, was interrupted. The ycbJ gene, whose product is 43% similar to macrolide 2P-phosphotransferase, is the last gene of the ycbCDEFGHJ operon. The disruption of the ycbJ gene did not inhibit the growth on both D-glucarate and D-galactarate agar plates. We further observed cell growth in the YCBHd strain on the D-glucarate, but not the D-galactarate plates, indicating that whereas ycbH is essential for the utilization of D-galactarate, ycbJ is not. These results suggest that YcbF and YcbH might have some GudD and GarD functions, respectively. Of the other products of the ycbCDEFGHJ operon, YcbC has 35% similarity to KdgD of Pseudomonas putida. KdgD, known as 5-dehydro-4-deoxyglucarate dehydratase, hydrates 5-keto-4-deoxy-D-glucarate to 2,5dioxopentanoate. YcbD is 40% similar to aldehyde dehydrogenase, which possibly dehydrates D-glucuronolactone to D-glucarate. YcbE contains 12 putative trans-membrane segments, implicating it as a transporter. In E. coli, D-glucarate and D-galactarate are dehydrated to 5-keto-4-deoxy-D-glucarate by GudD and GarD, respectively. Whereas 5-keto-4-deoxy-D-glucarate is converted to tartronate semialdehyde and pyruvate by GarL. Tartronate semialdehyde is reduced to D-glycerate by tartronate semialdehyde reductase and then phosphorylated to 3-phosphoglycerate by glycerate kinase. Interestingly, B. subtilis has no homologue of GarL, and thus cannot utilize D-glycerate. YcbC possibly dehydrates 5-keto-4-deoxy-D-glucarate to 2,5-dioxopentanoate. Based on these evidences, we conclude that the B. subtilis D-glucarate/galactarate utilization pathway di¡ers from that of E. coli. The ¢nal product in this pathway may be 2,5-dioxopentanoate involved in the ycbCDEFGHJ operon.
Acknowledgements We thank Samuel Amiteye for critical reading of the manuscript. This work was supported by a grant-in-aid for scienti¢c research on priority areas (C) ‘Genome Biology’ from the Ministry of Education, Science, Sports, and Culture of Japan.
References
Fig. 3. Contrasting e¡ect of growth of the wild-type strains of E. coli and B. subtilis, and the B. subtilis mutants. The wild-type strains of E. coli JM105, B. subtilis 168, and B. subtilis mutants strains (YCBFd, YCBHd and YCBJd) were grown on minimum C plates at 37‡C for 48 h under conditions of no compounds (a), 10 mM each of D-glucose (b), D-glucarate (e, g), D-galactarate (d, f) and D-glycerate (c).
[1] Kunst, F., Ogasawara, N. and Moszer, I. et al. (1997) The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249^256. [2] Ogasawara, N. (2000) Systematic function analysis of Bacillus subtilis genes. Res. Microbiol. 151, 129^134. [3] Hubbard, K.B., Koch, M., Palmer, D.R.J., Babbitt, P.C. and Gerlt, J.A. (1998) Evolution of enzymatic activities in the enolase superfamily: characterization of the (D)-glucarate/galactarate catabolic pathway in Escherichia coli. Biochemistry 37, 14369^14375. [4] Monterrubio, R., Baldoma, L., Obradors, N., Aguilar, J. and Badia, J. (2000) A common regulator for the operons encoding the enzymes
FEMSLE 10444 23-5-02
S. Hosoya et al. / FEMS Microbiology Letters 210 (2002) 193^199 involved in D-galactarate, D-glucarate, and D-glycerate utilization in Escherichia coli. J. Bacteriol. 182, 2672^2674. [5] Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103^119. [6] Dubnau, D. and Davido¡-Abelson, R. (1971) Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor^recipient complex. J. Mol. Biol. 56, 209^ 221.
199
[7] Schae¡er, P., Millet, J. and Aubert, J.P. (1965) Catabolic repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA 54, 704^ 711. [8] Pergo, M. (1993) Integrational vectors for genetic manipulation in Bacillus subtilis. In: Bacillus subtilis and other Gram-positive Bacteria (Sonenshein, A.L., Hoch, J.H. and Losick, R., Eds.), pp. 615^624. American Society for Microbiology, Washington, DC. [9] Miller, J.H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
FEMSLE 10444 23-5-02