- Email: [email protected]
Identification and complementation of abnormal hyphal branch mutants ahbA1 and ahbB1 in Aspergillus nidulans
Fungal Genetics and Biology 41 (2004) 998–1006 www.elsevier.com/locate/yfgbi
Identification and complementation of abnormal hyphal branch mutants ahbA1 and ahbB1 in Aspergillus nidulansq Xiaorong Lin1, Michelle Momany* Department of Plant Biology, University of Georgia, Athens, GA 30602, USA Received 27 March 2004; accepted 15 July 2004 Available online 28 August 2004
Abstract Branching generates new axes of polar growth in filamentous fungi and is critical for development, reproduction, and pathogenicity. To investigate branching we screened an Aspergillus nidulans temperature-sensitive mutant collection for abnormal hyphal branch (ahb) mutants. We identified two mutants, ahbA1, which showed reduced branching relative to wild type at restrictive temperature, and ahbB1, which showed increased branching relative to wild type at restrictive temperature. Both mutants also showed abnormal conidiophore development at restrictive temperature. The ahbA1 hypobranching mutant showed defects in nuclear division and hydroxyurea resistance. Complementation and sequencing showed that ahbA1 is a previously identified allele of the cell cycle regulator nimX. The ahbB1 hyperbranching mutant had an increased number of nuclei, was osmotically remedial and Calcofluor resistant. The ahbB gene is predicted to encode a novel protein that has homologues exclusively in filamentous fungi. The Cterminal domain of the predicted AhbB protein showed homology with the heme-binding domain of a cytochrome P450 protein and sequencing of the ahbB1 mutant allele showed that the lesion lies just before this putative heme-binding domain. The ahbB1 mutant showed increased sensitivity to the ergosterol biosynthesis inhibitor imidazole. Our results suggest a link between nuclear division and branching and a possible role for membrane synthesis in branching. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Branch; nimX; Conidiation; Cytochrome P450; Heme-binding domain
1. Introduction Like other filamentous fungi Aspergillus nidulans grows by highly polar tip extension. Once a hypha has been partitioned by septa, growth and mitosis occur only in the apical cell. The subapical cells are arrested until branching initiates new tip growth and nuclear divisions (Fiddy and Trinci, 1976; Kaminskyj and Hamer, 1998; Momany, 2002). Hyphal branching is imporq Sequence data from this article have been deposited with GenBank Data Libraries under Accession No. AY363053. * Corresponding author. Fax: +1 706 542 1805. E-mail address: [email protected] (M. Momany). 1 Present address: Department of Molecular Genetics and Microbiology, Duke University Medical Center, USA.
1087-1845/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2004.07.005
tant for reproduction, exploring the environment in search of nutrients and, in the case of pathogens, host penetration. Although variations in temperature, light and nutrition have long been known to perturb branching (Kretschmer, 1978, 1985; Lauter et al., 1998; Park et al., 2002), branch formation is poorly understood at the molecular level. Previous studies have shown that regulators involved in polar tip growth also play important roles in branch formation. Protein kinases, cytoskeletal components, secondary messengers, and spectrin-like proteins have been shown to play important roles in hyphal branching (Bachewich and Heath, 1998; Borgia et al., 1996; Brent Heath et al., 2003; Buhr et al., 1996; Grinberg and Heath, 1997; Kretschmer, 1978; Kritzman et al., 1978; Muller et al., 2002; Grinberg, 1997, #259; Pera et al.,
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
1999; Reynaga-Pena and Bartnicki-Garcia, 1997; Robson et al., 1991; Torralba and Heath, 2001). Vesicle aggregation is observed at the point of branch emergence (Nolan and Bal, 1974; Reynaga-Pena and Bartnicki-Garcia, 1997; Reynaga-Pena et al., 1997; Trinci and Collinge, 1974) and drugs that disturb membrane function or cell wall synthesis have also been shown to affect hyphal branching (Barathova and Betina, 1976; Odds, 1989; Odds et al., 1985; Perez et al., 1983; Prosser and Trinci, 1979). Decreased branching is a rarely reported as a mutant phenotype in filamentous fungi (Watters and Griffiths, 2001), though increased branching mutants are frequently identified (Bocking et al., 1999; Lauter et al., 1998; Propheta et al., 2001; Sone and Griffiths, 1999; Steele and Trinci, 1977; Wiebe et al., 1996), In the present work we describe the identification and characterization of two abnormal hyphal branch mutants: the hypobranching ahbA1 and hyperbranching ahbB1.
999
dard A. nidulans techniques (Harris et al., 1994; Kafer, 1977). For sensitivity tests, hydroxyurea (Sigma, St. Louis, MO), benomyl (Dupont, Wilmington, DE), Calcofluor (American Cyanamid, Wayne, NJ), caspofungin acetate (Merck, Whitehouse Station, NJ) and imidazole (Sigma, St. Louis, MO) were added at indicated concentrations to solid medium and the plates were incubated at indicated temperature for 2 days Table 2. 2.2. Mutant screening Conidial spores from a collection of 1200 ts-mutants (Harris et al., 1994) were inoculated on minimal plates with supplement (paba) and incubated at 30 and 42 °C for 20 h. Strains were observed by stereomicroscope. Thirty strains that showed abnormal branching frequency were selected. Two mutants, ahbA1 and ahbB1, showed stable abnormal branching phenotypes after repeated rounds of streaking on solid medium and microscopic observation at restrictive temperature.
2. Materials and methods 2.3. Growth conditions and microscopic observation 2.1. Strains and media Strains used in this study are listed in Table 1. Media used were as previously reported (Momany et al., 1999). Strain construction and genetic analysis employed stan-
Table 1 Strains used in this study Strain
Genotype
A28a A773a AH12 AXL40b AXL41c AXL42c AXL44b AXL45d AXL46d
biA1; pabaA6 pyrG89; wA3; pyroA4 argB2; chaA1; pabaA6 ahbA1; biA1; pabaA6 ahbA1; pabaA6; pyrG89; wA3 ahbA1; pyroA4; pyrG89 ahbB1; biA1; pabaA6 ahbB1; pabaA6; pyrG89; wA3 ahbB1; pyroA4; wA3
a Available from Fungal Genetics Stock Center, Department of Microbiology, University of Kansas Medical Center (Kansas City, KS). b Isolated by Xiaorong Lin and Dowin Boatright for this study. c Isolated by crossing AXL40 with A773. d Isolated by crossing AXL44 with A773.
2.3.1. Vegetative growth Conditions for vegetative growth and preparation of cells were as previously reported (Momany et al., 1999). Briefly, conidia were inoculated onto coverslips in liquid medium and incubated in a petri dish. Cells were fixed, nuclei were stained with Hoechst 33258 (Sigma, St. Louis, MO) and septa were stained with Calcofluor (American Cyanamid, Wayne, NJ). Microscopic observations were made using a Zeiss Axioplan microscope (Thornwood, NY) and digital images were acquired using an Optronics digital imaging system (Goleta, CA). Images were prepared using Photoshop 5.5 (Adobe, Mountain View, CA). Volume of subapical compartments was calculated as a cylinder based on width and length of compartments measured from photos. 2.3.2. Conidiophores Conidia were inoculated on the edges of a small square of agar medium placed on top of a coverslip, which was placed in a petri dish containing solidified agar to keep it moist. Another coverslip was placed on
Table 2 Drug sensitivity of ahbA1 and ahbB1a Strain
HU (1 mg/ml)
Benomy (0–10 lg/ml)
Calcoflour (10–100 lg/ml)
Caspofungin acetate (0–10 lM)
ahbA1 ahbB1
Resistantb WT
WT WT
Resistant WT
WT WT
a
Conidia of wild type A773, ahbA1 mutant strain AXL41 and ahbB1 mutant strain AXL45 were inoculated on the solid plates with indicated drugs and incubated at permissive and restrictive temperature for 2 days. b WT indicates colony size same as wildtype. Resistant indicates colony size greater than wild type.
1000
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
top of the agar square after inoculation. Plates were sealed with parafilm and incubated inverted. For observation of conidiophore structure, cells attached to coverslips were fixed and stained as described for vegetative growth. 2.4. Identification and sequencing of the complementing genes by transposon tagging A random genomic plasmid library carrying a pryG marker provided by Dr. Greg May (University of Texas, M.D. Anderson Cancer Center, Houston, TX, USA) (Osherov and May, 2000) was transformed into protoplasts of the AXL41 (ahbA1; pyrG) and AXL45 (ahbB1; pyrG) by standard A. nidulans protocols (Yelton et al., 1984). DNA was purified from non-temperature-sensitive pyrG prototrophs and used to transform Escherichia coli XL1-blue. Two plasmids containing the same genomic DNA insert by restriction enzyme mapping were recovered from AXL41 (ahbA1; pyrG) transformant and one (pXL10) was used for sequencing. Three identical plasmids were recovered from AXL45 (ahbB1; pyrG) transformants and one (pXL8) was used for sequencing. Transposons were randomly inserted into the complementing plasmids using the GPS-1 system (New England Biolabs, Beverly, MA). The resulting plasmids, each containing one copy of the transposon at random sites, were sequenced using primers unique for the transposon ends on an ABI 3700 DNA Analyzer (Applied Biosystem, CA) according to the manufacturerÕs instructions. The sequences were assembled and analyzed using Phred (version 0.000925c), Phrap (version 0.990319), and Consed (version 11.0) computer programs (http:// depts.washington.edu/ventures/collabtr/direct/ppccombo. htm) as previously described (Shaw and Momany, 2002). The assembled contigs were used to search the NCBI databases (www.ncbi.nlm.nih.gov) using the Blast program to identify open reading frames (ORFs). Plasmids with transposons inserted within the ORFs were transformed into the branching mutants ahbA1 and ahbB1. Plasmids that failed to rescue the mutants at restrictive temperature were assumed to have transposon insertions disrupting the complementing gene. 2.5. Sequencing of the mutant alleles The ahbA1 mutant allele was amplified from AXL41 genomic DNA by three independent PCR reactions using the Expand High Fidelity PCR System (Roche Diagnostics, IN, USA). Primers used for PCR amplifications were: forward 5 0 CAACCGCTGACGAAGC AGG, forward 5 0 CCGACTGGAGGCTGAAGATG, and reverse 5 0 GCGGGAAACTCATGAGTCATCG, reverse 5 0 GACCGGCAGTGCCTCCATG. After treatment with Qiagen Gel Purification kit (Qiagen, Valencia, CA), the PCR products were sequenced on an
ABI3700 sequencer (Applied Biosystem, CA) according to the manufacturerÕs instructions. The sequences obtained were compared with the wild type allele using GeneDoc (version 2.6.001) (www.psc.edu/biomed/ genedoc) with default parameters. All three reactions gave the same G–A mutation at position 844. The mutant ahbB1 allele was amplified from AXL45 genomic DNA as described above. Primers used for PCR amplifications were: forward 5 0 CCTGCCAGGGA CTTCTCAC, forward 5 0 GGGACTGACGCCACAAG AG, and reverse 5 0 GAAGTTGTCGTCACGGTCCC, reverse 5 0 CTAGGTGCCTCCAGTATCGG, reverse 5 0 CCCCGCATATTTGCACAACTC. All three reactions gave the same G–T mutation at position 1225. 2.6. Protein alignment Sequences of ahbB homologues were obtained from GenBank (http://www.ncbi.nlm.nih.gov/). Predicted protein sequences were aligned using GeneDoc (version 2.6.001) with default parameters.
3. Results and discussion 3.1. Phenotypic characterization of ahbA1 and ahbB1 3.1.1. The ahbA1 and ahbB1 mutants show altered branching frequency A collection of 1200 temperature-sensitive (ts) A. nidulans mutants (Harris et al., 1994) was incubated for 20 h at restrictive temperature (42 °C) and examined by stereomicroscope for increased or decreased branching relative to wildtype. Two strains, AXL40 and AXL44, showed a ts abnormal branching phenotype that segregated 1:1 in crosses with wild-type branching strain AH12 (n = 350 for each). Both mutants formed wild-type colonies at permissive temperature (Figs. 1D–F). At restrictive temperature, however, AXL40 made sparse, barely visible colonies with little or no branching (Figs. 1B and 2B) and AXL44 made compact small colonies (Figs. 1C and 2C) with dramatically increased subapical and tip branching. To determine whether the mutations were dominant or recessive, diploids were made by fusion between wild-type strain A28 and marked mutant strains AXL42 and AXL46. Both diploids showed wild-type branching, indicating that both mutations are recessive. The hypobranching mutant was designated ahbA1 (for abnormal hyphal branch) and the hyperbranching mutant was designated ahbB1. To quantitate branching in the mutants versus wild type, the hypobranching AXL41 (ahbA1), the hyperbranching AXL45 (ahbB1) and the wildtype A28 strains were inoculated to coverslips, incubated at restrictive temperature for 6–18 h, fixed, stained and counted.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Fig. 1. Colony phenotypes of the ahb mutants. Conidia of wild-type strain A28 (A and D), ahbA1 hypobranching strain AXL40 (B and E) and ahbB1 hyperbranching strain AXL44 (C and F) were inoculated to minimal medium with proper supplements and incubated for 2 days at restrictive temperature, 42 °C (A–C) or permissive temperature, 30 °C (D–F).
Fig. 2. Branching of the ahbA1 and ahbB1 mutants at restrictive temperature. Conidia of wildtype A28 (A), ahbA1 mutant AXL40 (B) and ahbB1 mutant AXL44 (C) were inoculated to minimal medium with proper supplements and incubated for 18 h at restrictive temperature (42 °C).
1001
The hypobranching ahbA1 mutant showed a slight reduction in branching relative to wild type even at permissive temperature. At restrictive temperature, ahbA1 mutant cells grew only by elongating a primary germ tube of varied length (up to 200 lm) with no secondary germ tubes or branches observed within 18 h (Fig. 2B). Most ahbA1 mutant cells lysed after 24 h at restrictive temperature (data not shown). In wild type the primary germ tube was 173 lm long when the first branch emerged (n = 150). In the hyperbranching abhB1 strain the primary germ tube was 32.6 lm long when the first branch emerged (n = 150). The average subapical compartment delineated by septa was 45.8 lm long (n = 200) in wildtype and 17 lm long in abhB1. This profuse branching from shorter compartments gave ahbB1 a compact, colonial phenotype relative to wildtype at 42 °C (Fig. 2A and C). The timing of branch emergence was also altered in ahbB1. In wildtype the secondary germ tube emerged from the conidium before the primary germ tube branched (n = 150), however in ahbB1 the primary germ tube branched before the secondary germ tube emerged 84% of the time (n = 150). 3.1.2. Nuclear number correlates with branching frequency Because it has previously been suggested that nuclear position plays a role in branch initiation (Fiddy and Trinci, 1976), we examined nuclei in wildtype and mutants. After incubation at 42 °C for 10 h wild-type A. nidulans had a secondary germ tube and eight nuclei evenly distributed along the hypha (Fig. 3A). The hyp-
Fig. 3. Nuclear number correlates with branching frequency in ahb mutants at restrictive temperature. Conidia of wildtype A28 (A), ahbA1 mutant AXL40 (B) and ahbB1 mutant AXL44 (C) were incubated at restrictive temperature (42 °C) for 10 h, fixed, and stained with Hoechst 33258 and Calcofluor. The upper and lower panels show DIC and fluorescent images of the same field. Bar, 5 lm.
1002
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
obranching ahbA1 mutant had no secondary germ tube and generally a single nucleus (Fig. 3B). In contrast, wildtype contained an average of 3.8 nuclei per 1000 lm3 and the ahbB1 hyperbranching mutant contained an average of 5.8 nuclei per 1000 lm3 of cytoplasm (n = 200) (Fig. 3C). Our observed correlation between nuclear number and branch frequency is consistent with a role for mitosis in the initiation of new tips. Indeed a similar correlation between nuclear number and branching has been reported for A. nidulans cell cycle mutants and led to the suggestion that cell cycle progression might be required for branching (Dynesen and Nielsen, 2003). Our results certainly support the idea that cell cycle progression and branching are connected. It is not clear if nuclear division is a prerequisite for branch emergence or if branch emergence is a prerequisite for resumption of mitosis within the compartment. It is possible that both are true, that nuclear division is needed for initiation of branching and that branch emergence is needed for further mitotic divisions within a compartment. 3.1.3. The ahbA1 and ahbB1 mutants are defective in conidiophore development Aspergillus nidulans conidiophore development starts with the extension of an aerial hypha (Adams et al.,
1998; Timberlake, 1991). The aerial hypha swells at its tip to form a vesicle. Two layers of sterigmata bud from the vesicle. The second (phialide) layer produces chains of uninucleate conidia through repeated rounds of mitosis and cytokinesis. This developmental sequence requires the coordination of nuclear division, nuclear migration and cytokinesis and gives rise to a very regular, ordered conidiophore (Fig. 4A). Both ahb mutants showed defects in conidiation at restrictive temperature (Fig. 4). Though most of the hypobranching ahbA1 cells lysed by 24 h, some survived to form conidiophores. The conidiophores made in the ahbA1 mutant lacked swollen vesicles and showed elongated metulae and phialides. Occasionally extra layers of sterigmata were observed (Fig. 4B). In contrast, the condiophores of the hyperbranching ahbB1 mutant showed a range of phenotypes, appearing to lack one or both layers of sterigmata (Fig. 4C). Although conidiophores of ahbA1 and ahbB1 were abnormal, they did generate uninucleate, viable conidia (Fig. 4 and data not shown). 3.1.4. The ahbA1 mutant is resistant to HU Because branching requires coordination of mitosis, nuclear migration and cell wall synthesis, we tested sensitivity of the mutants to treatments that affect these processes. Consistent with its apparent nuclear division
Fig. 4. Conidiophores are abnormal in the ahb mutants at restrictive temperature. Conidia of wild-type A28 (A), the hypobranching ahbA1 mutant AXL40 (B) and the hyperbranching ahbB1 mutant AXL44 (C) were incubated at restrictive temperature (42 °C) for 2 days. Cells were fixed, stained with Hoechst 33258 and Calcofluor. The upper and lower panels show DIC and fluorescent images of the same field. Bar, 20 lm.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
defect, the hypobranching ahbA1 mutant was resistant to hydroxyurea (HU), a drug that inhibits DNA synthesis by depletion of NTPs (data not shown). The ahbA1 mutant did not show any changed sensitivity towards the microtubule-destabilizing drug benomyl (data not shown). In contrast, the hyperbranching ahbB1 mutant showed wild-type sensitivity towards HU and benomyl (data not shown). 3.1.5. The ahbB1 mutant is osmotic remedial and Calcofluor resistant Mutants with cell wall defects are often osmotic remedial, that is they can be restored to wild-type growth by the addition of osmoticum to the medium. The growth of the hypobranching ahbA1 mutant was only slightly remediated by osmoticum (data not shown). Similarly ahbA1 showed wild-type levels of sensitivity to the chitin-binding dye Calcofluor, and to the b(1-3)-D -glucan synthase inhibitor caspofungin acetate (Georgopapadakou, 2001; Park et al., 2002). In contrast, the compact, colonial hyperbranching ahbB1 mutant was completely restored to wild-type phenotype by addition of osmoticum. The ahbB1 mutant was resistant to Calcofluor, but showed wild-type levels of sensitivity to Caspofungin acetate, suggesting that ahbB1 might be defective in chitin synthesis. Similarly, the A. fumigatus chsG/chsE double mutant (Mellado et al., 2003) and the A. nidulans chsB mutant (Ichinomiya et al., 2002) have a hyperbranching phenotype and altered sensitivity to Calcofluor (Bulawa, 1993; Horiuchi et al., 1999; Muller et al., 2002; Pammer et al., 1992). 3.2. Cloning and sequencing of ahbA and ahbB 3.2.1. nimX complements the ahbA1 mutant The ahbA gene was cloned by complementation of the ahbA1 mutant phenotype. An A. nidulans genomic library carrying a pryG marker (Osherov and May, 2000) was used to transform AXL41 (ahbA1; pyrG). Fifteen thousand transformants were selected on minimal medium at restrictive temperature and two complementing plasmids were rescued by transformation of E. coli. Both complementing plasmids had the same genomic DNA insert by restriction enzyme mapping. The complementing plasmid pXL10 was sequenced using a transposon tag strategy. Two ORFs were found in pXL10. The ahbA1 gene was identified based on the fact that two transposon insertions in this ORF disrupted pXL10Õs ability to complement the ahbA1 mutant, while transposons inserted in other regions had no effect (data not shown). A BLAST search against the A. nidulans genome database at the Whitehead Institute Center for Genome Research (http://www-genome.wi.mit.edu/annotation/ fungi/aspergillus/) placed ahbA in scaffold 4 on chromosome II. A search of the NCBI database (www.ncbi.nlm.nih.gov) showed that the complementing
1003
ORF is identical to the previously identified nimX gene (Osmani et al., 1994). NimX is the p34cdc2 cyclin-dependent kinase in A. nidulans, a highly conserved cell cycle regulator (Nurse, 1990). Using high fidelity Taq and three independent PCR amplifications, we sequenced the ahbA1 mutant allele and found that it showed a single G225S change in ahbA1, identical to a previously identified ts-allele of nimX (Osmani et al., 1994). The hypobranching phenotype of nimX was not noted in previous work because these studies focused on germlings too young to branch. The reduced nuclear number we noted in ahbA1 is consistent with the reported nimX phenotype and once more suggests an as yet undefined connection between nuclear division and branching. 3.2.2. A novel gene complements the ahbB1 mutant Complementation of the ahbB1 mutant was performed as described above for ahbA1. Out of 7000 transformants, three identical plasmids complemented ahbB1. One plasmid, pXL8, was sequenced using the transposon tag strategy described above. Four ORFs were found in pXL8 and the complementing ORF was identified based on the fact that two transposon insertions within this ORF disrupted the plasmidÕs ability to complement ahbB1, while transposons inserted in other regions had no effect (data not shown). A search of the A. nidulans EST database (http://www.genome. ou.edu/asper_blast.html) indicated that ahbB is expressed (Contig1364) and a search of the A. nidulans genome database (http://www-genome.wi.mit.edu/ annotation/fungi/aspergillus/) placed ahbB in scaffold 6 on chromosome V. A BLAST search of the NCBI database (www.ncbi.nlm.nih.gov) showed that the complementing ORF encodes a novel protein with the only homologue being a hypothetical protein from N. crassa. Protein localization prediction programs PSORT (http://psort.ims.u-tokyo.ac.jp/), TargetP (http:// www.cbs.dtu.dk/services/TargetP/) and MITOPROT (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/ mitofilter) all detected an N-terminal mitochondrial signal cleavage sequence 23 amino acids from the N-terminus and predicted that AhbB would be directed to mitochondria. Though the predicted AhbB protein appears to be novel and specific to filamentous fungi, it does share a region of homology with the heme-binding domain of human oxysterol-7-a-hydroxylase, a member of subfamily VIIB of the cytochrome p450 superfamily (Aoyama et al., 1996) (Fig. 5). Sequencing of the gene from the ahbB1 mutant revealed a G–T change at base 1225 predicted to result in a change of E409 to a stop codon just before the putative heme-binding domain. Because many fungal cytochrome P-450s are involved in steroid and fatty acid metabolism (Bhatnagar et al., 2003; Lupetti et al., 2002; Muijsers et al., 2002; Nelson et al.,
1004
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Fig. 5. Multiple alignment of AhbB homologues. The predicted AhbB sequence is from A. nidulans (An; Accession No. AY363053), hypothetical protein from N. crassa (Nc; Accession No. BX284763), oxysterol 7a-hydroxylase from H. sapiens (Hs; Accession No. NM004820). Black shading indicates identical or highly similar residues. Dark and light gray indicate 75% and 50% shared similar residues, respectively. Position of ahbB1 mutation is indicated by stop symbol below the sequence. The predicted heme-binding region is indicated by stars below the sequence (Aoyama et al., 1996).
1996), we tested the sensitivity of ahbB1 to imidazole, a drug that damages cell membranes and inhibits ergosterol biosynthesis (Bammert and Fostel, 2000; Hori et al., 2000) (Fig. 6). AhbB1 was more sensitive than wildtype to imidazole. It has previously been shown that membrane composition affects the synthesis of chitin in A. nidulans (Markham et al., 1993). Taken together the sensitivity to imidazole and resistance to calcoflour suggest that ahbB
could have a role in the synthesis or regulation of membranes. Though such a connection is speculative, it would not be surprising to find coordination between branching and membrane synthesis. Indeed, inhibition of the synthesis of sphingolipids, a major membrane component, gives a phenotype very similar to the ahbB mutant (Cheng et al., 2001). Future experiments will address the possible role of ahbB in membrane synthesis and branching.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
1005
Fig. 6. The ahbB1 mutant is sensitive to imidazole. Conidia of wild type A28 (upper row), hypobranching ahbA1 mutant AXL40 (middle row) and hyperbranching ahbB1 mutant AXL44 (lower row) were incubated on supplemented minimal medium with indicated concentration of imidazole for two days at 30 °C.
Acknowledgments This work was sponsored by Department of Energy Biosciences Grant DE-FG02-97ER20275 and National Science Foundation grant MCB9904629 to M.M. We thank Dowin Boatright for assistance in the first round screening of the ts-collection and Greg May for providing the plasmid library used in this work. References Adams, T.H., Wieser, J.K., Yu, J.H., 1998. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62, 35–54. Aoyama, Y., Noshiro, M., Gotoh, O., Imaoka, S., Funae, Y., Kurosawa, N., Horiuchi, T., Yoshida, Y., 1996. Sterol 14-demethylase P450 (P45014DM*) is one of the most ancient and conserved P450 species. J. Biochem. (Tokyo) 119, 926–933. Bachewich, C., Heath, I.B., 1998. Radial F-actin arrays precede new hypha formation in Saprolegnia: implications for establishing polar growth and regulating tip morphogenesis. J. Cell Sci. 111 (Pt. 14), 2005–2016. Bammert, G.F., Fostel, J.M., 2000. Genome-wide expression patterns in Saccharomyces cerevisiae: comparison of drug treatments and genetic alterations affecting biosynthesis of ergosterol. Antimicrob. Agents Chemother. 44, 1255–1265. Barathova, H., Betina, V., 1976. Antibiotic-induced changes of mycelial growth of Botrytis cinerea. Folia Microbiol. (Praha) 21, 355–361. Bhatnagar, D., Ehrlich, K.C., Cleveland, T.E., 2003. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 61, 83–93. Bocking, S.P., Wiebe, M.G., Robson, G.D., Hansen, K., Christiansen, L.H., Trinci, A.P., 1999. Effect of branch frequency in Aspergillus oryzae on protein secretion and culture viscosity. Biotechnol. Bioeng. 65, 638–648.
Borgia, P.T., Iartchouk, N., Riggle, P.J., Winter, K.R., Koltin, Y., Bulawa, C.E., 1996. The chsB gene of Aspergillus nidulans is necessary for normal hyphal growth and development. Fungal Genet. Biol. 20, 193–203. Brent Heath, I., Bonham, M., Akram, A., Gupta, G.D., 2003. The interrelationships of actin and hyphal tip growth in the ascomycete Geotrichum candidum. Fungal Genet. Biol. 38, 85–97. Buhr, T.L., Oved, S., Truesdell, G.M., Huang, C., Yarden, O., Dickman, M.B., 1996. A kinase-encoding gene from Colletotrichum trifolii complements a colonial growth mutant of Neurospora crassa. Mol. Gen. Genet. 251, 565–572. Bulawa, C.E., 1993. Genetics and molecular biology of chitin synthesis in fungi. Annu. Rev. Microbiol. 47, 505–534. Cheng, J., Park, T.S., Fischl, A.S., Ye, X.S., 2001. Cell cycle progression and cell polarity require sphingolipid biosynthesis in Aspergillus nidulans. Mol. Cell. Biol. 21, 6198–6209. Dynesen, J., Nielsen, J., 2003. Branching is coordinated with mitosis in growing hyphae of Aspergillus nidulans. Fungal Genet. Biol. 40, 15–24. Fiddy, C., Trinci, A.P., 1976. Mitosis, septation, branching and the duplication cycle in Aspergillus nidulans. J. Gen. Microbiol. 97, 169–184. Georgopapadakou, N.H., 2001. Update on antifungals targeted to the cell wall: focus on beta-1,3-glucan synthase inhibitors. Expert. Opin. Invest. Drugs 10, 269–280. Grinberg, A., Heath, I.B., 1997. Direct evidence for Ca2+ regulation of hyphal branch induction. Fungal Genet. Biol. 22, 127–139. Harris, S.D., Morrell, J.L., Hamer, J.E., 1994. Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136, 517–532. Hori, K., Sakaguchi, A., Kudoh, M., Ishida, K., Aoyama, Y., Yoshida, Y., 2000. Structure-activity relationships of a new antifungal imidazole, AFK-108, and related compounds. Chem. Pharm. Bull. (Tokyo) 48, 60–64. Horiuchi, H., Fujiwara, M., Yamashita, S., Ohta, A., Takagi, M., 1999. Proliferation of intrahyphal hyphae caused by disruption of csmA, which encodes a class V chitin synthase with a myosin motor-like domain in Aspergillus nidulans. J. Bacteriol. 181, 3721–3729.
1006
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Ichinomiya, M., Motoyama, T., Fujiwara, M., Takagi, M., Horiuchi, H., Ohta, A., 2002. Repression of chsB expression reveals the functional importance of class IV chitin synthase gene chsD in hyphal growth and conidiation of Aspergillus nidulans. Microbiology 148, 1335–1347. Kafer, E., 1977. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19, 33–131. Kaminskyj, S.G., Hamer, J.E., 1998. hyp loci control cell pattern formation in the vegetative mycelium of Aspergillus nidulans. Genetics 148, 669–680. Kretschmer, S., 1978. Kinetics of vegetative growth of Thermoactinomyces vulgaris. Z. Allg. Mikrobiol. 18, 701–711. Kretschmer, S., 1985. Morphogenetic behaviour of two Streptomyces strains analyzed by the use of chemostats. J. Basic Microbiol. 25, 569–574. Kritzman, G., Chet, I., Henis, Y., 1978. Localization of beta-(1,3)glucanase in the mycelium of Sclerotium rolfsii. J. Bacteriol. 134, 470–475. Lauter, F.R., Marchfelder, U., Russo, V.E.A., Yamashiro, C.T., Yatzkan, E., Yarden, O., 1998. Photoregulation of cot-1, a kinaseencoding gene involved in hyphal growth in Neurospora crassa. Fungal Genet. Biol. 23, 300–310. Lupetti, A., Danesi, R., Campa, M., Del Tacca, M., Kelly, S., 2002. Molecular basis of resistance to azole antifungals. Trends Mol. Med. 8, 76–81. Markham, P., Robson, G.D., Bainbridge, B.W., Trinci, A.P., 1993. Choline: its role in the growth of filamentous fungi and the regulation of mycelial morphology. FEMS Microbiol. Rev. 10, 287–300. Mellado, E., Dubreucq, G., Mol, P., Sarfati, J., Paris, S., Diaquin, M., Holden, D.W., Rodriguez-Tudela, J.L., Latge, J.P., 2003. Cell wall biogenesis in a double chitin synthase mutant (chsG-/chsE-) of Aspergillus fumigatus. Fungal Genet. Biol. 38, 98–109. Momany, M., 2002. Polarity in filamentous fungi: establishment, maintenance and new axes. Curr. Opin. Microbiol. 5, 580–585. Momany, M., Westfall, P.J., Abramowsky, G., 1999. Aspergillus nidulans swo mutants show defects in polarity establishment, polarity maintenance and hyphal morphogenesis. Genetics 151, 557–567. Muijsers, R.B., Goa, K.L., Scott, L.J., 2002. Voriconazole: in the treatment of invasive aspergillosis. Drugs 62, 2655–2664, discussion 2665-6. Muller, C., McIntyre, M., Hansen, K., Nielsen, J., 2002. Metabolic engineering of the morphology of Aspergillus oryzae by altering chitin synthesis. Appl. Environ. Microbiol. 68, 1827–1836. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Nolan, R.A., Bal, A.K., 1974. Cellulase localization in hyphae of Achlya ambisexualis. J. Bacteriol. 117, 840–843. Nurse, P., 1990. Universal control mechanism regulating onset of Mphase. Nature 344, 503–508. Odds, F.C., 1989. Antifungal activity of saperconazole (R 66 905) in vitro. J. Antimicrob. Chemother. 24, 533–537. Odds, F.C., Cockayne, A., Hayward, J., Abbott, A.B., 1985. Effects of imidazole- and triazole-derivative antifungal compounds on the growth and morphological development of Candida albicans hyphae. J. Gen. Microbiol. 131 (Pt 10), 2581–2589. Osherov, N., May, G., 2000. Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155, 647–656.
Osmani, A.H., van Peij, N., Mischke, M., OÕConnell, M.J., Osmani, S.A., 1994. A single p34cdc2 protein kinase (encoded by nimXcdc2) is required at G1 and G2 in Aspergillus nidulans. J. Cell Sci. 107 (Pt 6), 1519–1528. Pammer, M., Briza, P., Ellinger, A., Schuster, T., Stucka, R., Feldmann, H., Breitenbach, M., 1992. DIT101 (CSD2, CAL1), a cell cycle-regulated yeast gene required for synthesis of chitin in cell walls and chitosan in spore walls. Yeast 8, 1089–1099. Park, E.Y., Hamanaka, T., Higashiyama, K., Fujikawa, S., 2002. Monitoring of morphological development of the arachidonic-acidproducing filamentous microorganism Mortierella alpina. Appl. Microbiol. Biotechnol. 59, 706–712. Pera, L.M., Baigori, M.D., Callieri, D., 1999. Influence of environmental conditions on hyphal morphology in pellets of Aspergillus niger: role of b-N-acetyl-D -glucosaminidase. Curr. Microbiol. 39, 65–67. Perez, P., Garcia-Acha, I., Duran, A., 1983. Effect of papulacandin B on the cell wall and growth of Geotrichum lactis. J. Gen. Microbiol. 129 (Pt 2), 245–250. Propheta, O., Vierula, J., Toporowski, P., Gorovits, R., Yarden, O., 2001. The Neurospora crassa colonial temperature-sensitive 3 (cot3) gene encodes protein elongation factor 2. Mol. Gen. Genet. 264, 894–901. Prosser, J.I., Trinci, A.P., 1979. A model for hyphal growth and branching. J. Gen. Microbiol. 111, 153–164. Reynaga-Pena, C.G., Bartnicki-Garcia, S., 1997. Apical branching in a temperature sensitive mutant of Aspergillus niger. Fungal Genet. Biol. 22, 153–167. Reynaga-Pena, C.G., Gierz, G., Bartnicki-Garcia, S., 1997. Analysis of the role of the Spitzenkorper in fungal morphogenesis by computer simulation of apical branching in Aspergillus niger. Proc. Natl. Acad. Sci. USA 94, 9096–9101. Robson, G.D., Wiebe, M.G., Trinci, A.P., 1991. Exogenous cAMP and cGMP modulate branching in Fusarium graminearum. J. Gen. Microbiol. 137 (Pt. 4), 963–969. Shaw, B.D., Momany, M., 2002. Aspergillus nidulans polarity mutant swoA is complemented by protein O-mannosyltransferase pmtA. Fungal Genet. Biol. 37, 263–270. Sone, T., Griffiths, A.J., 1999. The frost gene of Neurospora crassa is a homolog of yeast cdc1 and affects hyphal branching via manganese homeostasis. Fungal Genet. Biol. 28, 227–237. Steele, G.C., Trinci, A.P., 1977. Effect of temperature and temperature shifts on growth and branching of a wild type and a temperature sensitive colonial mutant (Cot 1) of Neurospora crassa. Arch. Microbiol. 113, 43–48. Timberlake, W.E., 1991. Temporal and spatial controls of Aspergillus development. Curr. Opin. Genet. Dev. 1, 351–357. Torralba, S., Heath, I.B., 2001. Cytoskeletal and Ca2+ regulation of hyphal tip growth and initiation. Curr. Top. Dev. Biol. 51, 135– 187. Trinci, A.P., Collinge, A.J., 1974. Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals. Protoplasma 80, 57–67. Watters, M.K., Griffiths, A.J., 2001. Tests of a cellular model for constant branch distribution in the filamentous fungus Neurospora crassa. Appl. Environ. Microbiol. 67, 1788–1792. Wiebe, M.G., Blakebrough, M.L., Craig, S.H., Robson, G.D., Trinci, A.P., 1996. How do highly branched (colonial) mutants of Fusarium graminearum A3/5 arise during Quorn myco-protein fermentations?. Microbiology 142 (Pt 3), 525–532. Yelton, M.M., Hamer, J.E., Timberlake, W.E., 1984. Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81, 1470–1474.
Identification and complementation of abnormal hyphal branch mutants ahbA1 and ahbB1 in Aspergillus nidulansq Xiaorong Lin1, Michelle Momany* Department of Plant Biology, University of Georgia, Athens, GA 30602, USA Received 27 March 2004; accepted 15 July 2004 Available online 28 August 2004
Abstract Branching generates new axes of polar growth in filamentous fungi and is critical for development, reproduction, and pathogenicity. To investigate branching we screened an Aspergillus nidulans temperature-sensitive mutant collection for abnormal hyphal branch (ahb) mutants. We identified two mutants, ahbA1, which showed reduced branching relative to wild type at restrictive temperature, and ahbB1, which showed increased branching relative to wild type at restrictive temperature. Both mutants also showed abnormal conidiophore development at restrictive temperature. The ahbA1 hypobranching mutant showed defects in nuclear division and hydroxyurea resistance. Complementation and sequencing showed that ahbA1 is a previously identified allele of the cell cycle regulator nimX. The ahbB1 hyperbranching mutant had an increased number of nuclei, was osmotically remedial and Calcofluor resistant. The ahbB gene is predicted to encode a novel protein that has homologues exclusively in filamentous fungi. The Cterminal domain of the predicted AhbB protein showed homology with the heme-binding domain of a cytochrome P450 protein and sequencing of the ahbB1 mutant allele showed that the lesion lies just before this putative heme-binding domain. The ahbB1 mutant showed increased sensitivity to the ergosterol biosynthesis inhibitor imidazole. Our results suggest a link between nuclear division and branching and a possible role for membrane synthesis in branching. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Branch; nimX; Conidiation; Cytochrome P450; Heme-binding domain
1. Introduction Like other filamentous fungi Aspergillus nidulans grows by highly polar tip extension. Once a hypha has been partitioned by septa, growth and mitosis occur only in the apical cell. The subapical cells are arrested until branching initiates new tip growth and nuclear divisions (Fiddy and Trinci, 1976; Kaminskyj and Hamer, 1998; Momany, 2002). Hyphal branching is imporq Sequence data from this article have been deposited with GenBank Data Libraries under Accession No. AY363053. * Corresponding author. Fax: +1 706 542 1805. E-mail address: [email protected] (M. Momany). 1 Present address: Department of Molecular Genetics and Microbiology, Duke University Medical Center, USA.
1087-1845/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2004.07.005
tant for reproduction, exploring the environment in search of nutrients and, in the case of pathogens, host penetration. Although variations in temperature, light and nutrition have long been known to perturb branching (Kretschmer, 1978, 1985; Lauter et al., 1998; Park et al., 2002), branch formation is poorly understood at the molecular level. Previous studies have shown that regulators involved in polar tip growth also play important roles in branch formation. Protein kinases, cytoskeletal components, secondary messengers, and spectrin-like proteins have been shown to play important roles in hyphal branching (Bachewich and Heath, 1998; Borgia et al., 1996; Brent Heath et al., 2003; Buhr et al., 1996; Grinberg and Heath, 1997; Kretschmer, 1978; Kritzman et al., 1978; Muller et al., 2002; Grinberg, 1997, #259; Pera et al.,
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
1999; Reynaga-Pena and Bartnicki-Garcia, 1997; Robson et al., 1991; Torralba and Heath, 2001). Vesicle aggregation is observed at the point of branch emergence (Nolan and Bal, 1974; Reynaga-Pena and Bartnicki-Garcia, 1997; Reynaga-Pena et al., 1997; Trinci and Collinge, 1974) and drugs that disturb membrane function or cell wall synthesis have also been shown to affect hyphal branching (Barathova and Betina, 1976; Odds, 1989; Odds et al., 1985; Perez et al., 1983; Prosser and Trinci, 1979). Decreased branching is a rarely reported as a mutant phenotype in filamentous fungi (Watters and Griffiths, 2001), though increased branching mutants are frequently identified (Bocking et al., 1999; Lauter et al., 1998; Propheta et al., 2001; Sone and Griffiths, 1999; Steele and Trinci, 1977; Wiebe et al., 1996), In the present work we describe the identification and characterization of two abnormal hyphal branch mutants: the hypobranching ahbA1 and hyperbranching ahbB1.
999
dard A. nidulans techniques (Harris et al., 1994; Kafer, 1977). For sensitivity tests, hydroxyurea (Sigma, St. Louis, MO), benomyl (Dupont, Wilmington, DE), Calcofluor (American Cyanamid, Wayne, NJ), caspofungin acetate (Merck, Whitehouse Station, NJ) and imidazole (Sigma, St. Louis, MO) were added at indicated concentrations to solid medium and the plates were incubated at indicated temperature for 2 days Table 2. 2.2. Mutant screening Conidial spores from a collection of 1200 ts-mutants (Harris et al., 1994) were inoculated on minimal plates with supplement (paba) and incubated at 30 and 42 °C for 20 h. Strains were observed by stereomicroscope. Thirty strains that showed abnormal branching frequency were selected. Two mutants, ahbA1 and ahbB1, showed stable abnormal branching phenotypes after repeated rounds of streaking on solid medium and microscopic observation at restrictive temperature.
2. Materials and methods 2.3. Growth conditions and microscopic observation 2.1. Strains and media Strains used in this study are listed in Table 1. Media used were as previously reported (Momany et al., 1999). Strain construction and genetic analysis employed stan-
Table 1 Strains used in this study Strain
Genotype
A28a A773a AH12 AXL40b AXL41c AXL42c AXL44b AXL45d AXL46d
biA1; pabaA6 pyrG89; wA3; pyroA4 argB2; chaA1; pabaA6 ahbA1; biA1; pabaA6 ahbA1; pabaA6; pyrG89; wA3 ahbA1; pyroA4; pyrG89 ahbB1; biA1; pabaA6 ahbB1; pabaA6; pyrG89; wA3 ahbB1; pyroA4; wA3
a Available from Fungal Genetics Stock Center, Department of Microbiology, University of Kansas Medical Center (Kansas City, KS). b Isolated by Xiaorong Lin and Dowin Boatright for this study. c Isolated by crossing AXL40 with A773. d Isolated by crossing AXL44 with A773.
2.3.1. Vegetative growth Conditions for vegetative growth and preparation of cells were as previously reported (Momany et al., 1999). Briefly, conidia were inoculated onto coverslips in liquid medium and incubated in a petri dish. Cells were fixed, nuclei were stained with Hoechst 33258 (Sigma, St. Louis, MO) and septa were stained with Calcofluor (American Cyanamid, Wayne, NJ). Microscopic observations were made using a Zeiss Axioplan microscope (Thornwood, NY) and digital images were acquired using an Optronics digital imaging system (Goleta, CA). Images were prepared using Photoshop 5.5 (Adobe, Mountain View, CA). Volume of subapical compartments was calculated as a cylinder based on width and length of compartments measured from photos. 2.3.2. Conidiophores Conidia were inoculated on the edges of a small square of agar medium placed on top of a coverslip, which was placed in a petri dish containing solidified agar to keep it moist. Another coverslip was placed on
Table 2 Drug sensitivity of ahbA1 and ahbB1a Strain
HU (1 mg/ml)
Benomy (0–10 lg/ml)
Calcoflour (10–100 lg/ml)
Caspofungin acetate (0–10 lM)
ahbA1 ahbB1
Resistantb WT
WT WT
Resistant WT
WT WT
a
Conidia of wild type A773, ahbA1 mutant strain AXL41 and ahbB1 mutant strain AXL45 were inoculated on the solid plates with indicated drugs and incubated at permissive and restrictive temperature for 2 days. b WT indicates colony size same as wildtype. Resistant indicates colony size greater than wild type.
1000
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
top of the agar square after inoculation. Plates were sealed with parafilm and incubated inverted. For observation of conidiophore structure, cells attached to coverslips were fixed and stained as described for vegetative growth. 2.4. Identification and sequencing of the complementing genes by transposon tagging A random genomic plasmid library carrying a pryG marker provided by Dr. Greg May (University of Texas, M.D. Anderson Cancer Center, Houston, TX, USA) (Osherov and May, 2000) was transformed into protoplasts of the AXL41 (ahbA1; pyrG) and AXL45 (ahbB1; pyrG) by standard A. nidulans protocols (Yelton et al., 1984). DNA was purified from non-temperature-sensitive pyrG prototrophs and used to transform Escherichia coli XL1-blue. Two plasmids containing the same genomic DNA insert by restriction enzyme mapping were recovered from AXL41 (ahbA1; pyrG) transformant and one (pXL10) was used for sequencing. Three identical plasmids were recovered from AXL45 (ahbB1; pyrG) transformants and one (pXL8) was used for sequencing. Transposons were randomly inserted into the complementing plasmids using the GPS-1 system (New England Biolabs, Beverly, MA). The resulting plasmids, each containing one copy of the transposon at random sites, were sequenced using primers unique for the transposon ends on an ABI 3700 DNA Analyzer (Applied Biosystem, CA) according to the manufacturerÕs instructions. The sequences were assembled and analyzed using Phred (version 0.000925c), Phrap (version 0.990319), and Consed (version 11.0) computer programs (http:// depts.washington.edu/ventures/collabtr/direct/ppccombo. htm) as previously described (Shaw and Momany, 2002). The assembled contigs were used to search the NCBI databases (www.ncbi.nlm.nih.gov) using the Blast program to identify open reading frames (ORFs). Plasmids with transposons inserted within the ORFs were transformed into the branching mutants ahbA1 and ahbB1. Plasmids that failed to rescue the mutants at restrictive temperature were assumed to have transposon insertions disrupting the complementing gene. 2.5. Sequencing of the mutant alleles The ahbA1 mutant allele was amplified from AXL41 genomic DNA by three independent PCR reactions using the Expand High Fidelity PCR System (Roche Diagnostics, IN, USA). Primers used for PCR amplifications were: forward 5 0 CAACCGCTGACGAAGC AGG, forward 5 0 CCGACTGGAGGCTGAAGATG, and reverse 5 0 GCGGGAAACTCATGAGTCATCG, reverse 5 0 GACCGGCAGTGCCTCCATG. After treatment with Qiagen Gel Purification kit (Qiagen, Valencia, CA), the PCR products were sequenced on an
ABI3700 sequencer (Applied Biosystem, CA) according to the manufacturerÕs instructions. The sequences obtained were compared with the wild type allele using GeneDoc (version 2.6.001) (www.psc.edu/biomed/ genedoc) with default parameters. All three reactions gave the same G–A mutation at position 844. The mutant ahbB1 allele was amplified from AXL45 genomic DNA as described above. Primers used for PCR amplifications were: forward 5 0 CCTGCCAGGGA CTTCTCAC, forward 5 0 GGGACTGACGCCACAAG AG, and reverse 5 0 GAAGTTGTCGTCACGGTCCC, reverse 5 0 CTAGGTGCCTCCAGTATCGG, reverse 5 0 CCCCGCATATTTGCACAACTC. All three reactions gave the same G–T mutation at position 1225. 2.6. Protein alignment Sequences of ahbB homologues were obtained from GenBank (http://www.ncbi.nlm.nih.gov/). Predicted protein sequences were aligned using GeneDoc (version 2.6.001) with default parameters.
3. Results and discussion 3.1. Phenotypic characterization of ahbA1 and ahbB1 3.1.1. The ahbA1 and ahbB1 mutants show altered branching frequency A collection of 1200 temperature-sensitive (ts) A. nidulans mutants (Harris et al., 1994) was incubated for 20 h at restrictive temperature (42 °C) and examined by stereomicroscope for increased or decreased branching relative to wildtype. Two strains, AXL40 and AXL44, showed a ts abnormal branching phenotype that segregated 1:1 in crosses with wild-type branching strain AH12 (n = 350 for each). Both mutants formed wild-type colonies at permissive temperature (Figs. 1D–F). At restrictive temperature, however, AXL40 made sparse, barely visible colonies with little or no branching (Figs. 1B and 2B) and AXL44 made compact small colonies (Figs. 1C and 2C) with dramatically increased subapical and tip branching. To determine whether the mutations were dominant or recessive, diploids were made by fusion between wild-type strain A28 and marked mutant strains AXL42 and AXL46. Both diploids showed wild-type branching, indicating that both mutations are recessive. The hypobranching mutant was designated ahbA1 (for abnormal hyphal branch) and the hyperbranching mutant was designated ahbB1. To quantitate branching in the mutants versus wild type, the hypobranching AXL41 (ahbA1), the hyperbranching AXL45 (ahbB1) and the wildtype A28 strains were inoculated to coverslips, incubated at restrictive temperature for 6–18 h, fixed, stained and counted.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Fig. 1. Colony phenotypes of the ahb mutants. Conidia of wild-type strain A28 (A and D), ahbA1 hypobranching strain AXL40 (B and E) and ahbB1 hyperbranching strain AXL44 (C and F) were inoculated to minimal medium with proper supplements and incubated for 2 days at restrictive temperature, 42 °C (A–C) or permissive temperature, 30 °C (D–F).
Fig. 2. Branching of the ahbA1 and ahbB1 mutants at restrictive temperature. Conidia of wildtype A28 (A), ahbA1 mutant AXL40 (B) and ahbB1 mutant AXL44 (C) were inoculated to minimal medium with proper supplements and incubated for 18 h at restrictive temperature (42 °C).
1001
The hypobranching ahbA1 mutant showed a slight reduction in branching relative to wild type even at permissive temperature. At restrictive temperature, ahbA1 mutant cells grew only by elongating a primary germ tube of varied length (up to 200 lm) with no secondary germ tubes or branches observed within 18 h (Fig. 2B). Most ahbA1 mutant cells lysed after 24 h at restrictive temperature (data not shown). In wild type the primary germ tube was 173 lm long when the first branch emerged (n = 150). In the hyperbranching abhB1 strain the primary germ tube was 32.6 lm long when the first branch emerged (n = 150). The average subapical compartment delineated by septa was 45.8 lm long (n = 200) in wildtype and 17 lm long in abhB1. This profuse branching from shorter compartments gave ahbB1 a compact, colonial phenotype relative to wildtype at 42 °C (Fig. 2A and C). The timing of branch emergence was also altered in ahbB1. In wildtype the secondary germ tube emerged from the conidium before the primary germ tube branched (n = 150), however in ahbB1 the primary germ tube branched before the secondary germ tube emerged 84% of the time (n = 150). 3.1.2. Nuclear number correlates with branching frequency Because it has previously been suggested that nuclear position plays a role in branch initiation (Fiddy and Trinci, 1976), we examined nuclei in wildtype and mutants. After incubation at 42 °C for 10 h wild-type A. nidulans had a secondary germ tube and eight nuclei evenly distributed along the hypha (Fig. 3A). The hyp-
Fig. 3. Nuclear number correlates with branching frequency in ahb mutants at restrictive temperature. Conidia of wildtype A28 (A), ahbA1 mutant AXL40 (B) and ahbB1 mutant AXL44 (C) were incubated at restrictive temperature (42 °C) for 10 h, fixed, and stained with Hoechst 33258 and Calcofluor. The upper and lower panels show DIC and fluorescent images of the same field. Bar, 5 lm.
1002
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
obranching ahbA1 mutant had no secondary germ tube and generally a single nucleus (Fig. 3B). In contrast, wildtype contained an average of 3.8 nuclei per 1000 lm3 and the ahbB1 hyperbranching mutant contained an average of 5.8 nuclei per 1000 lm3 of cytoplasm (n = 200) (Fig. 3C). Our observed correlation between nuclear number and branch frequency is consistent with a role for mitosis in the initiation of new tips. Indeed a similar correlation between nuclear number and branching has been reported for A. nidulans cell cycle mutants and led to the suggestion that cell cycle progression might be required for branching (Dynesen and Nielsen, 2003). Our results certainly support the idea that cell cycle progression and branching are connected. It is not clear if nuclear division is a prerequisite for branch emergence or if branch emergence is a prerequisite for resumption of mitosis within the compartment. It is possible that both are true, that nuclear division is needed for initiation of branching and that branch emergence is needed for further mitotic divisions within a compartment. 3.1.3. The ahbA1 and ahbB1 mutants are defective in conidiophore development Aspergillus nidulans conidiophore development starts with the extension of an aerial hypha (Adams et al.,
1998; Timberlake, 1991). The aerial hypha swells at its tip to form a vesicle. Two layers of sterigmata bud from the vesicle. The second (phialide) layer produces chains of uninucleate conidia through repeated rounds of mitosis and cytokinesis. This developmental sequence requires the coordination of nuclear division, nuclear migration and cytokinesis and gives rise to a very regular, ordered conidiophore (Fig. 4A). Both ahb mutants showed defects in conidiation at restrictive temperature (Fig. 4). Though most of the hypobranching ahbA1 cells lysed by 24 h, some survived to form conidiophores. The conidiophores made in the ahbA1 mutant lacked swollen vesicles and showed elongated metulae and phialides. Occasionally extra layers of sterigmata were observed (Fig. 4B). In contrast, the condiophores of the hyperbranching ahbB1 mutant showed a range of phenotypes, appearing to lack one or both layers of sterigmata (Fig. 4C). Although conidiophores of ahbA1 and ahbB1 were abnormal, they did generate uninucleate, viable conidia (Fig. 4 and data not shown). 3.1.4. The ahbA1 mutant is resistant to HU Because branching requires coordination of mitosis, nuclear migration and cell wall synthesis, we tested sensitivity of the mutants to treatments that affect these processes. Consistent with its apparent nuclear division
Fig. 4. Conidiophores are abnormal in the ahb mutants at restrictive temperature. Conidia of wild-type A28 (A), the hypobranching ahbA1 mutant AXL40 (B) and the hyperbranching ahbB1 mutant AXL44 (C) were incubated at restrictive temperature (42 °C) for 2 days. Cells were fixed, stained with Hoechst 33258 and Calcofluor. The upper and lower panels show DIC and fluorescent images of the same field. Bar, 20 lm.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
defect, the hypobranching ahbA1 mutant was resistant to hydroxyurea (HU), a drug that inhibits DNA synthesis by depletion of NTPs (data not shown). The ahbA1 mutant did not show any changed sensitivity towards the microtubule-destabilizing drug benomyl (data not shown). In contrast, the hyperbranching ahbB1 mutant showed wild-type sensitivity towards HU and benomyl (data not shown). 3.1.5. The ahbB1 mutant is osmotic remedial and Calcofluor resistant Mutants with cell wall defects are often osmotic remedial, that is they can be restored to wild-type growth by the addition of osmoticum to the medium. The growth of the hypobranching ahbA1 mutant was only slightly remediated by osmoticum (data not shown). Similarly ahbA1 showed wild-type levels of sensitivity to the chitin-binding dye Calcofluor, and to the b(1-3)-D -glucan synthase inhibitor caspofungin acetate (Georgopapadakou, 2001; Park et al., 2002). In contrast, the compact, colonial hyperbranching ahbB1 mutant was completely restored to wild-type phenotype by addition of osmoticum. The ahbB1 mutant was resistant to Calcofluor, but showed wild-type levels of sensitivity to Caspofungin acetate, suggesting that ahbB1 might be defective in chitin synthesis. Similarly, the A. fumigatus chsG/chsE double mutant (Mellado et al., 2003) and the A. nidulans chsB mutant (Ichinomiya et al., 2002) have a hyperbranching phenotype and altered sensitivity to Calcofluor (Bulawa, 1993; Horiuchi et al., 1999; Muller et al., 2002; Pammer et al., 1992). 3.2. Cloning and sequencing of ahbA and ahbB 3.2.1. nimX complements the ahbA1 mutant The ahbA gene was cloned by complementation of the ahbA1 mutant phenotype. An A. nidulans genomic library carrying a pryG marker (Osherov and May, 2000) was used to transform AXL41 (ahbA1; pyrG). Fifteen thousand transformants were selected on minimal medium at restrictive temperature and two complementing plasmids were rescued by transformation of E. coli. Both complementing plasmids had the same genomic DNA insert by restriction enzyme mapping. The complementing plasmid pXL10 was sequenced using a transposon tag strategy. Two ORFs were found in pXL10. The ahbA1 gene was identified based on the fact that two transposon insertions in this ORF disrupted pXL10Õs ability to complement the ahbA1 mutant, while transposons inserted in other regions had no effect (data not shown). A BLAST search against the A. nidulans genome database at the Whitehead Institute Center for Genome Research (http://www-genome.wi.mit.edu/annotation/ fungi/aspergillus/) placed ahbA in scaffold 4 on chromosome II. A search of the NCBI database (www.ncbi.nlm.nih.gov) showed that the complementing
1003
ORF is identical to the previously identified nimX gene (Osmani et al., 1994). NimX is the p34cdc2 cyclin-dependent kinase in A. nidulans, a highly conserved cell cycle regulator (Nurse, 1990). Using high fidelity Taq and three independent PCR amplifications, we sequenced the ahbA1 mutant allele and found that it showed a single G225S change in ahbA1, identical to a previously identified ts-allele of nimX (Osmani et al., 1994). The hypobranching phenotype of nimX was not noted in previous work because these studies focused on germlings too young to branch. The reduced nuclear number we noted in ahbA1 is consistent with the reported nimX phenotype and once more suggests an as yet undefined connection between nuclear division and branching. 3.2.2. A novel gene complements the ahbB1 mutant Complementation of the ahbB1 mutant was performed as described above for ahbA1. Out of 7000 transformants, three identical plasmids complemented ahbB1. One plasmid, pXL8, was sequenced using the transposon tag strategy described above. Four ORFs were found in pXL8 and the complementing ORF was identified based on the fact that two transposon insertions within this ORF disrupted the plasmidÕs ability to complement ahbB1, while transposons inserted in other regions had no effect (data not shown). A search of the A. nidulans EST database (http://www.genome. ou.edu/asper_blast.html) indicated that ahbB is expressed (Contig1364) and a search of the A. nidulans genome database (http://www-genome.wi.mit.edu/ annotation/fungi/aspergillus/) placed ahbB in scaffold 6 on chromosome V. A BLAST search of the NCBI database (www.ncbi.nlm.nih.gov) showed that the complementing ORF encodes a novel protein with the only homologue being a hypothetical protein from N. crassa. Protein localization prediction programs PSORT (http://psort.ims.u-tokyo.ac.jp/), TargetP (http:// www.cbs.dtu.dk/services/TargetP/) and MITOPROT (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/ mitofilter) all detected an N-terminal mitochondrial signal cleavage sequence 23 amino acids from the N-terminus and predicted that AhbB would be directed to mitochondria. Though the predicted AhbB protein appears to be novel and specific to filamentous fungi, it does share a region of homology with the heme-binding domain of human oxysterol-7-a-hydroxylase, a member of subfamily VIIB of the cytochrome p450 superfamily (Aoyama et al., 1996) (Fig. 5). Sequencing of the gene from the ahbB1 mutant revealed a G–T change at base 1225 predicted to result in a change of E409 to a stop codon just before the putative heme-binding domain. Because many fungal cytochrome P-450s are involved in steroid and fatty acid metabolism (Bhatnagar et al., 2003; Lupetti et al., 2002; Muijsers et al., 2002; Nelson et al.,
1004
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Fig. 5. Multiple alignment of AhbB homologues. The predicted AhbB sequence is from A. nidulans (An; Accession No. AY363053), hypothetical protein from N. crassa (Nc; Accession No. BX284763), oxysterol 7a-hydroxylase from H. sapiens (Hs; Accession No. NM004820). Black shading indicates identical or highly similar residues. Dark and light gray indicate 75% and 50% shared similar residues, respectively. Position of ahbB1 mutation is indicated by stop symbol below the sequence. The predicted heme-binding region is indicated by stars below the sequence (Aoyama et al., 1996).
1996), we tested the sensitivity of ahbB1 to imidazole, a drug that damages cell membranes and inhibits ergosterol biosynthesis (Bammert and Fostel, 2000; Hori et al., 2000) (Fig. 6). AhbB1 was more sensitive than wildtype to imidazole. It has previously been shown that membrane composition affects the synthesis of chitin in A. nidulans (Markham et al., 1993). Taken together the sensitivity to imidazole and resistance to calcoflour suggest that ahbB
could have a role in the synthesis or regulation of membranes. Though such a connection is speculative, it would not be surprising to find coordination between branching and membrane synthesis. Indeed, inhibition of the synthesis of sphingolipids, a major membrane component, gives a phenotype very similar to the ahbB mutant (Cheng et al., 2001). Future experiments will address the possible role of ahbB in membrane synthesis and branching.
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
1005
Fig. 6. The ahbB1 mutant is sensitive to imidazole. Conidia of wild type A28 (upper row), hypobranching ahbA1 mutant AXL40 (middle row) and hyperbranching ahbB1 mutant AXL44 (lower row) were incubated on supplemented minimal medium with indicated concentration of imidazole for two days at 30 °C.
Acknowledgments This work was sponsored by Department of Energy Biosciences Grant DE-FG02-97ER20275 and National Science Foundation grant MCB9904629 to M.M. We thank Dowin Boatright for assistance in the first round screening of the ts-collection and Greg May for providing the plasmid library used in this work. References Adams, T.H., Wieser, J.K., Yu, J.H., 1998. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62, 35–54. Aoyama, Y., Noshiro, M., Gotoh, O., Imaoka, S., Funae, Y., Kurosawa, N., Horiuchi, T., Yoshida, Y., 1996. Sterol 14-demethylase P450 (P45014DM*) is one of the most ancient and conserved P450 species. J. Biochem. (Tokyo) 119, 926–933. Bachewich, C., Heath, I.B., 1998. Radial F-actin arrays precede new hypha formation in Saprolegnia: implications for establishing polar growth and regulating tip morphogenesis. J. Cell Sci. 111 (Pt. 14), 2005–2016. Bammert, G.F., Fostel, J.M., 2000. Genome-wide expression patterns in Saccharomyces cerevisiae: comparison of drug treatments and genetic alterations affecting biosynthesis of ergosterol. Antimicrob. Agents Chemother. 44, 1255–1265. Barathova, H., Betina, V., 1976. Antibiotic-induced changes of mycelial growth of Botrytis cinerea. Folia Microbiol. (Praha) 21, 355–361. Bhatnagar, D., Ehrlich, K.C., Cleveland, T.E., 2003. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 61, 83–93. Bocking, S.P., Wiebe, M.G., Robson, G.D., Hansen, K., Christiansen, L.H., Trinci, A.P., 1999. Effect of branch frequency in Aspergillus oryzae on protein secretion and culture viscosity. Biotechnol. Bioeng. 65, 638–648.
Borgia, P.T., Iartchouk, N., Riggle, P.J., Winter, K.R., Koltin, Y., Bulawa, C.E., 1996. The chsB gene of Aspergillus nidulans is necessary for normal hyphal growth and development. Fungal Genet. Biol. 20, 193–203. Brent Heath, I., Bonham, M., Akram, A., Gupta, G.D., 2003. The interrelationships of actin and hyphal tip growth in the ascomycete Geotrichum candidum. Fungal Genet. Biol. 38, 85–97. Buhr, T.L., Oved, S., Truesdell, G.M., Huang, C., Yarden, O., Dickman, M.B., 1996. A kinase-encoding gene from Colletotrichum trifolii complements a colonial growth mutant of Neurospora crassa. Mol. Gen. Genet. 251, 565–572. Bulawa, C.E., 1993. Genetics and molecular biology of chitin synthesis in fungi. Annu. Rev. Microbiol. 47, 505–534. Cheng, J., Park, T.S., Fischl, A.S., Ye, X.S., 2001. Cell cycle progression and cell polarity require sphingolipid biosynthesis in Aspergillus nidulans. Mol. Cell. Biol. 21, 6198–6209. Dynesen, J., Nielsen, J., 2003. Branching is coordinated with mitosis in growing hyphae of Aspergillus nidulans. Fungal Genet. Biol. 40, 15–24. Fiddy, C., Trinci, A.P., 1976. Mitosis, septation, branching and the duplication cycle in Aspergillus nidulans. J. Gen. Microbiol. 97, 169–184. Georgopapadakou, N.H., 2001. Update on antifungals targeted to the cell wall: focus on beta-1,3-glucan synthase inhibitors. Expert. Opin. Invest. Drugs 10, 269–280. Grinberg, A., Heath, I.B., 1997. Direct evidence for Ca2+ regulation of hyphal branch induction. Fungal Genet. Biol. 22, 127–139. Harris, S.D., Morrell, J.L., Hamer, J.E., 1994. Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136, 517–532. Hori, K., Sakaguchi, A., Kudoh, M., Ishida, K., Aoyama, Y., Yoshida, Y., 2000. Structure-activity relationships of a new antifungal imidazole, AFK-108, and related compounds. Chem. Pharm. Bull. (Tokyo) 48, 60–64. Horiuchi, H., Fujiwara, M., Yamashita, S., Ohta, A., Takagi, M., 1999. Proliferation of intrahyphal hyphae caused by disruption of csmA, which encodes a class V chitin synthase with a myosin motor-like domain in Aspergillus nidulans. J. Bacteriol. 181, 3721–3729.
1006
X. Lin, M. Momany / Fungal Genetics and Biology 41 (2004) 998–1006
Ichinomiya, M., Motoyama, T., Fujiwara, M., Takagi, M., Horiuchi, H., Ohta, A., 2002. Repression of chsB expression reveals the functional importance of class IV chitin synthase gene chsD in hyphal growth and conidiation of Aspergillus nidulans. Microbiology 148, 1335–1347. Kafer, E., 1977. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19, 33–131. Kaminskyj, S.G., Hamer, J.E., 1998. hyp loci control cell pattern formation in the vegetative mycelium of Aspergillus nidulans. Genetics 148, 669–680. Kretschmer, S., 1978. Kinetics of vegetative growth of Thermoactinomyces vulgaris. Z. Allg. Mikrobiol. 18, 701–711. Kretschmer, S., 1985. Morphogenetic behaviour of two Streptomyces strains analyzed by the use of chemostats. J. Basic Microbiol. 25, 569–574. Kritzman, G., Chet, I., Henis, Y., 1978. Localization of beta-(1,3)glucanase in the mycelium of Sclerotium rolfsii. J. Bacteriol. 134, 470–475. Lauter, F.R., Marchfelder, U., Russo, V.E.A., Yamashiro, C.T., Yatzkan, E., Yarden, O., 1998. Photoregulation of cot-1, a kinaseencoding gene involved in hyphal growth in Neurospora crassa. Fungal Genet. Biol. 23, 300–310. Lupetti, A., Danesi, R., Campa, M., Del Tacca, M., Kelly, S., 2002. Molecular basis of resistance to azole antifungals. Trends Mol. Med. 8, 76–81. Markham, P., Robson, G.D., Bainbridge, B.W., Trinci, A.P., 1993. Choline: its role in the growth of filamentous fungi and the regulation of mycelial morphology. FEMS Microbiol. Rev. 10, 287–300. Mellado, E., Dubreucq, G., Mol, P., Sarfati, J., Paris, S., Diaquin, M., Holden, D.W., Rodriguez-Tudela, J.L., Latge, J.P., 2003. Cell wall biogenesis in a double chitin synthase mutant (chsG-/chsE-) of Aspergillus fumigatus. Fungal Genet. Biol. 38, 98–109. Momany, M., 2002. Polarity in filamentous fungi: establishment, maintenance and new axes. Curr. Opin. Microbiol. 5, 580–585. Momany, M., Westfall, P.J., Abramowsky, G., 1999. Aspergillus nidulans swo mutants show defects in polarity establishment, polarity maintenance and hyphal morphogenesis. Genetics 151, 557–567. Muijsers, R.B., Goa, K.L., Scott, L.J., 2002. Voriconazole: in the treatment of invasive aspergillosis. Drugs 62, 2655–2664, discussion 2665-6. Muller, C., McIntyre, M., Hansen, K., Nielsen, J., 2002. Metabolic engineering of the morphology of Aspergillus oryzae by altering chitin synthesis. Appl. Environ. Microbiol. 68, 1827–1836. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Nolan, R.A., Bal, A.K., 1974. Cellulase localization in hyphae of Achlya ambisexualis. J. Bacteriol. 117, 840–843. Nurse, P., 1990. Universal control mechanism regulating onset of Mphase. Nature 344, 503–508. Odds, F.C., 1989. Antifungal activity of saperconazole (R 66 905) in vitro. J. Antimicrob. Chemother. 24, 533–537. Odds, F.C., Cockayne, A., Hayward, J., Abbott, A.B., 1985. Effects of imidazole- and triazole-derivative antifungal compounds on the growth and morphological development of Candida albicans hyphae. J. Gen. Microbiol. 131 (Pt 10), 2581–2589. Osherov, N., May, G., 2000. Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155, 647–656.
Osmani, A.H., van Peij, N., Mischke, M., OÕConnell, M.J., Osmani, S.A., 1994. A single p34cdc2 protein kinase (encoded by nimXcdc2) is required at G1 and G2 in Aspergillus nidulans. J. Cell Sci. 107 (Pt 6), 1519–1528. Pammer, M., Briza, P., Ellinger, A., Schuster, T., Stucka, R., Feldmann, H., Breitenbach, M., 1992. DIT101 (CSD2, CAL1), a cell cycle-regulated yeast gene required for synthesis of chitin in cell walls and chitosan in spore walls. Yeast 8, 1089–1099. Park, E.Y., Hamanaka, T., Higashiyama, K., Fujikawa, S., 2002. Monitoring of morphological development of the arachidonic-acidproducing filamentous microorganism Mortierella alpina. Appl. Microbiol. Biotechnol. 59, 706–712. Pera, L.M., Baigori, M.D., Callieri, D., 1999. Influence of environmental conditions on hyphal morphology in pellets of Aspergillus niger: role of b-N-acetyl-D -glucosaminidase. Curr. Microbiol. 39, 65–67. Perez, P., Garcia-Acha, I., Duran, A., 1983. Effect of papulacandin B on the cell wall and growth of Geotrichum lactis. J. Gen. Microbiol. 129 (Pt 2), 245–250. Propheta, O., Vierula, J., Toporowski, P., Gorovits, R., Yarden, O., 2001. The Neurospora crassa colonial temperature-sensitive 3 (cot3) gene encodes protein elongation factor 2. Mol. Gen. Genet. 264, 894–901. Prosser, J.I., Trinci, A.P., 1979. A model for hyphal growth and branching. J. Gen. Microbiol. 111, 153–164. Reynaga-Pena, C.G., Bartnicki-Garcia, S., 1997. Apical branching in a temperature sensitive mutant of Aspergillus niger. Fungal Genet. Biol. 22, 153–167. Reynaga-Pena, C.G., Gierz, G., Bartnicki-Garcia, S., 1997. Analysis of the role of the Spitzenkorper in fungal morphogenesis by computer simulation of apical branching in Aspergillus niger. Proc. Natl. Acad. Sci. USA 94, 9096–9101. Robson, G.D., Wiebe, M.G., Trinci, A.P., 1991. Exogenous cAMP and cGMP modulate branching in Fusarium graminearum. J. Gen. Microbiol. 137 (Pt. 4), 963–969. Shaw, B.D., Momany, M., 2002. Aspergillus nidulans polarity mutant swoA is complemented by protein O-mannosyltransferase pmtA. Fungal Genet. Biol. 37, 263–270. Sone, T., Griffiths, A.J., 1999. The frost gene of Neurospora crassa is a homolog of yeast cdc1 and affects hyphal branching via manganese homeostasis. Fungal Genet. Biol. 28, 227–237. Steele, G.C., Trinci, A.P., 1977. Effect of temperature and temperature shifts on growth and branching of a wild type and a temperature sensitive colonial mutant (Cot 1) of Neurospora crassa. Arch. Microbiol. 113, 43–48. Timberlake, W.E., 1991. Temporal and spatial controls of Aspergillus development. Curr. Opin. Genet. Dev. 1, 351–357. Torralba, S., Heath, I.B., 2001. Cytoskeletal and Ca2+ regulation of hyphal tip growth and initiation. Curr. Top. Dev. Biol. 51, 135– 187. Trinci, A.P., Collinge, A.J., 1974. Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals. Protoplasma 80, 57–67. Watters, M.K., Griffiths, A.J., 2001. Tests of a cellular model for constant branch distribution in the filamentous fungus Neurospora crassa. Appl. Environ. Microbiol. 67, 1788–1792. Wiebe, M.G., Blakebrough, M.L., Craig, S.H., Robson, G.D., Trinci, A.P., 1996. How do highly branched (colonial) mutants of Fusarium graminearum A3/5 arise during Quorn myco-protein fermentations?. Microbiology 142 (Pt 3), 525–532. Yelton, M.M., Hamer, J.E., Timberlake, W.E., 1984. Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81, 1470–1474.