Identification and expression analysis of a novel transcript of the human PRMT2 gene resulted from alternative polyadenylation in breast cancer

Gene 487 (2011) 1–9

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e

Identification and expression analysis of a novel transcript of the human PRMT2 gene resulted from alternative polyadenylation in breast cancer Jing Zhong a, b, Ren-Xian Cao a, b, Tao Hong a, b, Jing Yang a, b, Xu-Yu Zu a, Xin-Hua Xiao a, Jiang-Hua Liu a, Ge-Bo Wen a, b,⁎ a b

Clinical medical research institute of the first affiliated hospital, University of South China, Hengyang 421001, China Department of Pathophysiology, University of South China, Changsheng Road, Hengyang 421001, China

a r t i c l e

i n f o

Article history: Accepted 18 June 2011 Available online 18 July 2011 Received by A.J. van Wijnen Keywords: PRMT2 Splicing Polyadenylation Intron retention Subcellular localization Up-regulated expression

a b s t r a c t The arginine N-methyltransferase 2 protein (PRMT2, also known as HRMT1L1) is thought to act as a coactivator of ERα. The present results show the occurrence of a novel transcript by alternative polyadenylation in the human PRMT2 gene. We demonstrated that the newly identified intron-retaining PRMT2L2 transcript is functionally intact, efficiently translated into protein in vivo. PRMT2 and PRMT2L2 mRNA expression profiles overlap with the distribution of ERα, with the strongest abundance in estrogen target tissues. Transient co-transfection assays demonstrated that PRMT2L2 enhance ERα-mediated transactivation activity of ERE-Luc in a ligand-dependent manner. Confocal microscopy scanning revealed a distinct intra-cellular localization of their fusion proteins, suggesting that the C-terminal region absent in PRMT2L2 is critical for the localization. Statistical analysis further showed that both PRMT2 and PRMT2L2 mRNAexpressions were up-regulated in breast cancer tissues, and significantly associated with ERα positivity status. Thus, post-transcriptional processing mechanism as alternative polyadenylation and splicing may play a crucial role in regulating human PRMT2 gene expression. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Protein arginine N-methyltransferases (PRMTs) are eukaryotic enzymes that catalyze the transfer of methyl groups from S-adenosylmethionine (SAM) to arginine residues of numerous PRMT substrates (Bedford, 2007; Krause et al., 2007). Their activities influence a wide range of cellular processes, including cell growth (Lin et al., 1996), nuclear/cytoplasmic protein shuttling (McBride and Silver, 2001), differentiation and embryogenesis (Chen et al., 2002; Torres-Padilla et al., 2007), RNA splicing and transport (Meister and Fischer, 2002; Lukong and Richard, 2004), and posttranscriptional regulation (Li et al., 2002). Two different types of PRMTs are present in eukaryotes. Type I PRMTs catalyze the formation of both monomethyl Arg (MMA) and asymmetric dimethyl Arg (ADMA), whereas Type II PRMTs catalyze the formation of MMA and symmetric dimethyl Arg (SDMA). In higher eukaryotes, 11 putative isozymes are present. PRMTs 1, 3, 4, 6, and 8 belong to Type I, PRMTs 5, 7, and 9 belong to Type II, whereas PRMTs 10

Abbreviations: PRMT2, Arginine N-methyltransferase 2; ERα, Estrogen receptor alpha; RACE, rapid-amplification of cDNA ends; GFP, green fluorescent protein; DIG, digoxigenin; ERE-LUC, estrogen-responsive element-containing luciferase reporter. ⁎ Corresponding author at: Clinical medical research institute of the first affiliated hospital, University of South China, Hengyang 421001, China. Tel.: + 86 734 827 9392; fax: + 86 734 827 9009. E-mail address: [email protected] (G.-B. Wen). 0378-1119/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.06.022

and 11 are unclassified because they have not demonstrated any enzymatic activity (Bedford, 2007; Krause et al., 2007). Recently, PRMT2 has been demonstrated to have weak enzymatic activity (Herrmann et al., 2009; Lakowski and Frankel, 2009). Arginine N-methyltransferase 2 (PRMT2, HRMT1L1) is a protein that belongs to the arginine methyltransferase family, which was identified due to its identity to PRMT1 in amino acid sequence (Katsanis et al., 1997; Scott et al., 1998), and acts as an ERα and a ligand-dependent androgen receptor (AR) coactivator (Qi et al., 2002; Meyer et al., 2007). Reports have shown that it is clearly involved in lung function or the inflammatory response (Yildirim et al., 2006; Besson et al., 2007), promotes apoptosis (Ganesh et al., 2006), as well as leptin signaling and Wnt signaling regulation (Blythe et al.,2010; Iwasaki et al., 2010). In eukaryotic cells, a single gene may give rise to various mRNA isoforms using alternative initiation, splicing, termination, and polyadenylation mechanisms (Modrek and Lee, 2002). The mRNA isoforms could code for different products, thereby increasing protein diversity. In mammals, however, no study has yet addressed the alternative splicing events in the processing of the primary intron containing the PRMT2 transcript and no spliced PRMT2 variants have been reported (Katsanis et al., 1997; Scott et al., 1998). In this paper, we identified a shorter PRMT2 transcript, which is terminated by different polyadenylation signal sequences within intron 7. Our data indicate that PRMT2 and its novel transcript are associated with ERα positivity status, and may play a role in the

2

J. Zhong et al. / Gene 487 (2011) 1–9

formation and development of breast cancer by modulating the estrogen-ERα signaling pathway. 2. Materials and methods 2.1. Identification and molecular cloning of PRMT2 splice variant Our previous study showed that the expressed sequence tag (EST, CF569048) was expressed differently in breast cancer cell lines. Using the BLAST network services, it was listed as similar to the human genomic clone containing the HRMT1L1 gene (GenBank accession number: NT_011515.11, PRMT2). Considering that the nucleotide position corresponds to the boundary of exons 7 and 8 of the human PRMT2 gene, this EST clone could represent a splice variant of PRMT2. Oligonucleotide primers were designed to amplify this potential splice variant from human breast cancer T47D cells using the SMART RACE cDNA Amplification kit (Clontech; K1811-1). Briefly, according to the manufacturer's protocol, double-stranded cDNA were synthesized from 1.0 μg of mRNA and its 5′- and 3′-cDNA ends were subjected to rapid amplification (RACE) using gene specific primers (GSP) and nested gene specific primers (NGSP), as described in Table 1. The PCR reaction, performed using Advantage cDNA Polymerase Mix (Clontech), generated nested products of 5′- and 3′-RACE PCR, which were subcloned into the pGEM-T Easy vector (Promega) and sequenced by automated DNA sequence (ABI PRISM 310 Analyzer). The full length was amplified by end-to-end PCR using upstream and downstream primers as described in Table 1. At least four different clones were sequenced to ensure the fidelity of the Taq polymerase. 2.2. Northern blot analysis A human multiple tissue Northern blot (Innogent) was hybridized with digitoxin (DIG)-labeled cDNA probes of PRMT2 and PRMT2L2. The probes were either a 538 bp PCR product containing the 3′-UTR of PRMT2 (primers, F1: 5′-CTG GAG ATG ACA GTT GAT GCT TTA-3′ and R1: 5′-AGA GTC CCA TCG CAT ACA TCG CCA-3′) or a 956 bp PCR product containing the 3′-UTR of PRMT2L2 (primers, F2: 5′-GCA TTA CGA TTA GGA GGG AGT GAG-3′ and R2: 5′-AGA TTC CAC TAT ATT TAC ACA TTT-3′). The equivalent loading of mRNA in each lane was confirmed by the hybridization of the same blot with a DIG-labeled β-actin cDNA probe. Hybridization and detection were performed with a DIG-labeling and detection kit (Roche Applied Science). 2.3. Western blot analysis Total cell and tissue lysates were lysed on ice for 30 min with lysis buffer (10 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid, 10 mM KCl, 1 mM ethylenediaminetetraacetic acid [EDTA] [pH 8.0], 0.1% NP-40, 1 mM DTT, 1 mM PMSF, and 0.5 mM Na3VO4). The cell cytoplasm (C) and nuclei (N) were fractionated using the QProteome nuclear

proteins kit (Qiagen) according to manufacturer's instructions. Soluble protein (30 μg) was separated on 12% SDS-PAGE gels, and Western blot was conducted using anti-PRMT2-N-terminal antibodies (1:1000, ARP40196_T100; Aviva Systems Biology). The same membrane was reprobed for GAPDH, which served as the loading control for the experiment. 2.4. Cell culture All cells were obtained from the American Type Culture Collection. MCF7, BT474, SK-BR-3, 293T, HepG2, and HeLa were routinely cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (FBS). T47D and ZR-75-1 were cultured in RPMI 1640 with 10% FBS. All cells were maintained under a 5% CO2 atmosphere at 37 °C. MDA-MB-231 and MDA-MB-453 were cultured in Leibovitz's L-15 medium with 10% FBS and were maintained under an atmosphere without CO2 at 37 °C. 2.5. Plasmid construction pcDNA3-ERα, pRL-TK, and the ERE-LUC (estrogen-responsive element-containing luciferase reporter) were kindly provided by P. Qinong Ye (Beijing Institute of Biotechnology, China). Full-length of PRMT2 and PRMT2L2 was cloned from T47D cells and generated by PCR amplification. Expression plasmids for GFP were constructed by inserting the cDNA into the pcDNA3.1/NT-GFP (Invitrogen) following the manufacturer's protocol. Expression plasmids for V5-tagged proteins were constructed by inserting the cDNA into the pcDNA3.2/V5/GW/D-TOPO vector (Invitrogen) following the manufacturer's protocol. All constructs were sequenced to ensure proper in-frame ligation and Taq polymerase fidelity. The constructs were subcloned and the plasmid cDNAs were purified by Midi plasmid preparation kit (Qiagen). 2.6. Mammalian cell transfection and dual luciferase reporter assays MCF7 and MDA-MB-231 cells were cultured as described above. For transfection, cells were seeded in 12-well plates containing phenol redfree DMEM (Invitrogen) supplemented with 10% FBS (charcoal/dextran treated FBS, Hyclone). The cells were transfected using Lipofectamine 2000 (Invitrogen) with 0.2 μg of ERE-LUC reporter plasmid, 25 ng of pRL-TK Renilla luciferase vector, and 0.1–0.4 μg of PRMT2 or PRMT2L2 (50 ng pcDNA3-ERα were co-transfected in MDA-MB-231), and the respective empty vector was used to adjust the total amount of DNA. After treatment with 10 nM 17β-estradiol (E2), the cells were harvested and firefly luciferase and Renilla luciferase assays were performed using the Promega Dual-Luciferase Reporter Assay System. The activities of the luciferase constructs were normalized to the Renilla luciferase activity of the pRL-TK construct. All transfections were done in triplicate and repeated at least thrice.

Table 1 Primers and oligonucleotides used for cloning and cDNA amplification of PRMT2L2. Name Smart II 5′-CDS 3′-CDS Universal Primer mix 5′-GSP 3′-GSP 5′-NGSP 3′-NGSP PRMT2L2-FR PRMT2L2-FF

Nucleotide sequences

Used

5′-AAGCAGTGGTAACAACGCAGAGTACGCGGG-3′ 5′-(T)25(A, G, or C)(A, C, G, or T)-3′ 5′-AAGCAGTGGTAACAACGCAGAGTAC(T)30(A, G, or C)(A, C, G, or T)-3′ 5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′ 5′-CTAATACGACTCACTATAGGGC-3′ 5′-GCCCTCACTCCCTCCTAATCGTAATGC-3′ (antisense) 5′-CAAGACAGATGGGCAGAGCAGGGTAGA-3′ (sense) 5′-CCCTGCTCTGCCCATCTGTCTTGTTAT-3′ (antisense) 5′-GCATTACGATTAGGAGGGAGTGAGGGC-3′ (sense) 5′-GAA AGA TTC CAC TAT ATT TAC ACA TTT-3′ (antisense) 5′-GCG TGC ACT GCG CTT GCG CGG GTT-3′ (sense)

cDNA synthesis cDNA synthesis cDNA synthesis cDNA synthesis 5′-RACE PCR 3′-RACE PCR 5′-RACE PCR 3′-RACE PCR Full length-PCR Full length-PCR

J. Zhong et al. / Gene 487 (2011) 1–9

2.7. Confocal microscopy Transfections were performed using the Lipofectamine Plus transfection reagent (Invitrogen) according to manufacturer's instructions. Plasmid constructs expressing the different PRMT2 variants fused to an N-terminal GFP tag were generated and used to transiently transfect the T47D cells grown on glass coverslips. At 48 h post-transfection, the cells were incubated with 2 μM Mito Tracker Red CM-H2XROS (Molecular Probes, M7513, Invitrogen) for 30 min, then fixed in paraformaldehyde, permeabilized with Triton X-100, and transfected. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) and viewed under a Zeiss LSM 510 confocal microscope. 2.8. Quantitative real-time RT-PCR Isolated RNA was reverse transcribed using SuperScript II reverse transcriptase (Invitrogen). Q-RT-PCR was performed on a Light Cycler Real Time PCR Sequence detector (Roche Diagnostics). DNA containing the PRMT2 variants or the GAPDH cDNA inserts was used as template plasmids. The PCR reactions were initiated with incubation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s. For each reaction, the standard curves for the reference gene were constructed using six tenfold serial dilutions of plasmids. All samples were run in triplicate and reported as PRMT2 variant expression levels relative to GAPDH in the cell lines. 2.9. Statistical analysis All the experiments were conducted in triplicate and the results were expressed as the mean ± S.E.M. Statistical analysis was done using SPSS version 13.0. Fisher's exact and χ 2 tests were applied to assess the statistical significance. P values b0.05 were considered significant. 3. Results 3.1. Cloning and sequence analysis of novel alternative-transcript of human PRMT2 According to the manufacturer's protocol, full-length cDNA (2225 bp) coding for the PRMT2L2 variant was obtained by 5′–3′ RACE PCR (Fig. 1A). Nucleotide and protein databases were searched using the BLAST network services, showing the splice variant PRMT2L2 aligned with nucleotides 4–1000 of the human PRMT2 cDNA sequence

Fig. 1. Identification of new PRMT2 variant. A: Agarose gel electrophoresis of RACE product. M. 1 kb ladder marker; 1. 5′-RACE product of the first amplification; 2. 5′-RACE product of the second amplification; 3. 3′-RACE product of the first amplification; 4. 3′RACE product of the second amplification. The target products are designated by asterisks. B: Schematic representation of human PRMT2 and PRMT2L2 genomic structure. The same segments of PRMT2L2 and PRMT2 are indicated by double lines. Exons are indicated by black boxes and introns are shown by lines. TC-termination/stop codon.

3

(X99209.1) 10–1006 (99% identity), and 1004–2225 (100% identity) with the intron 7 sequence of the human PRMT2 gene. The analysis of the genomic structure indicated that the PRMT2L2 variant retains the entire exon 7 and the main part of intron 7 by using a novel polyadenylation site, the 5′-splicing site of exon 7 is silent, causing it to behave as 3′-terminal exon. The results of the sequencing showed a premature termination codon (TAA), and consequently generated a distinct, shorter C-terminal domain (Fig. 1B). The amino acid sequence deduced from the original reading frame revealed that it might encode a 277-amino acid protein identified to the N terminus of the PRMT2 protein. Fig. 2 shows the nucleotide and deduced amino acid sequences (GenBank accession number: AY786414). 3.2. Overall PRMT2 mRNA expression is high in estrogen target organs and relatively low in androgen target organs To address the expression profile of the newly isolated variant, a human multiple tissue expression northern blot was analyzed, as shown in Fig. 3A. Consistent with previous reports (Katsanis et al., 1997; Scott et al., 1998), the probe of the wild-type PRMT2 revealed a single approximately 2.4 kb transcript in the fetal brain, thyroid gland, uterus, and ovary. A faint band also appeared in the adult liver and testes. In the mammary glands, a strong, broad signal was detected (Fig. 3A, top), indicating that it may contain other PRMT2 splice variants with the same 3′ UTR. Remarkably, two of these bands (2.2 and 3.1 kb) were also detected with the 3′ UTR probe of the PRMT2L2 (Fig. 3A, middle). The single transcript of approximately 2.2 kb PRMT2L2 mRNA, consistent with the result of the RACE, was widely expressed in several estrogen target organs (e.g., uterus, ovary, fetal brain, and placenta); the strongest expression was documented in the mammary and thyroid glands, and a weak signal was detected in the adult liver and testes. The 3.1 kb band, although faint, was detected in corresponding human tissues and may have resulted from an uncharacterized alternative splicing event or overlapping transcripts. In summary, these results show that multiple forms of the PRMT2 mRNA, which arise from the alternative processing of the primary transcripts, are present in humans, that tissue type variations may be present in the relative amounts of the PRMT2 mRNA variants, and that the PRMT2 variants exist remarkably in human breast tissues. 3.3. Western blot indicates the existence of PRMT2L2 protein isoform To evaluate whether the observed PRMT2 variant mRNA profiles correlate with the protein levels, we immunoblotted human cancer cell lines (HepG2, Jurkat, MCF7, B-LCL 721, HeLa, and 293T) and normal human fetal tissue (fetal brain, fetal heart, fetal lung, fetal liver, fetal muscle, and placenta) protein extracts with our anti-PRMT2-N-terminal antibodies. Given that this antibody is directed against the common Nterminal domain, it should recognize all variants including PRMT2L2. Three major bands were detected/resolved using this antibody in the protein extracts (Fig. 3B). Based on its predicted molecular mass, the upper band should correspond to the wild-type PRMT2 (48.5 kDa) and is predominantly expressed in almost all of the protein extracts. The second band should correspond to the PRMT2L2 (32 kDa), and the variant is present in several human cell lines and tissues (e.g., Jurkat, MCF7, HeLa, fetal liver, and placenta). High abundance was found in the fetal brain and fetal heart; the strongest expression was documented in the B-LCL 721, even stronger than that of the wild-type, consistent with the profile observed for mRNA levels. Strangely, two binds in Jurkat and MCF7 cannot be resolved from each other and migrate as part of the band, because of their very small difference, although the possibility that an increase in PRMT2L2 could be masked by co-migration with other variants cannot be ruled out. Another predominant band (28 kDa), smaller than the variants above, was observed in the fetal brain, fetal heart, fetal liver, and placenta. The possibility that other unknown variants may exist cannot be ruled out. Obviously, the intensity of the

4

J. Zhong et al. / Gene 487 (2011) 1–9

Fig. 2. Nucleotide and deduced amino acid sequence of human PRMT2L2. First line, nucleotide sequence of the cDNA for PRMT2L2 follows the ATG (171–173) codon closest to the 5′ end and indicated by a black frame, the stop codon of translation is designated by an asterisk; second line, the deduced amino acid sequence of PRMT2L2. Sequence shadowed is EST CF569048 and the black letters of the sequence with arrows are the 5′-GSP and 3′-GSP. The consensus sequences of mRNA instability and polyadenylation signal in the 3′ non-coding region are indicated by solid and dashed underlines, respectively.

protein species also slightly varies between the various samples, but these changes do not affect the profile observed in protein expression. To confirm whether the species labeled as “PRMT2L2” in Fig. 3B really is variant PRMT2L2, 293T cells were transfected with the V5tagged pcDNA3.2/V5/PRMT2L2 vectors. The whole-cell extracts and untransfected 293T and MCF7 cell extracts were immunoblotted with anti-PRMT2-N-Terminal antibody. As showed in Fig. 3C, a predominant band, slightly bigger than the endogenous PRMT2L2 was detected, which is the V5-tagged PRMT2L2, and it was not detected in untransfected 293T and MCF7 cells. 3.4. Overexpression of PRMT2L2 enhance ERα-mediated transactivation activity In this study we evaluated the regulatory activity of the PRMT2L2 using human breast cancer cells MCF7 and MDA-MB-231. Using this cell

system, we tested the effect of PRMT2 variants on ERE-LUC activity. As shown in Fig. 4A, in the presence of estrogen, the PRMT2 variants stimulated ERE-LUC activity in a dose-dependent manner. In particular, PRMT2 (0.4 μg) and PRMT2L2 (0.4 μg) enhanced the transcriptional activity of ERE-LUC by 2.7 and 2.1-fold, respectively. Differentially, PRMT2L2 demonstrated relatively weaker stimulatory activity compared to the wild type PRMT2 (Pb 0.05; Fig. 4A). To further understand the transactivation role of PRMT2L2, the co-transfection assay was performed. As shown in Fig. 4A, no obvious difference was observed when co-transfecting PRMT2L2 variant 100 ng together with the wild PRMT2 plasmid 300 ng was compared to that with wild PRMT2 plasmids alone. Whereas, co-transfecting PRMT2L2 variant 300 ng together with the wild PRMT2 plasmid 100 ng significantly decreased the level of ERE-LUC activation compared with the co-transfection of PRMT2L2 variant 100 ng together with the wild PRMT2 plasmid 300 ng. In addition, this transactivation activity of them was estrogen

J. Zhong et al. / Gene 487 (2011) 1–9

5

Fig. 3. PRMT2 variant mRNA and protein expression in human normal tissues and malignant tumor cell lines. A: Total RNAs isolated from the human normal tissues, northern blot analysis of the differential expression of human PRMT2 and PRMT2L2 in hormone target organs. A human multiple-tissue mRNA blot was hybridized with DIGlabeled PRMT2, PRMT2L2, and β-actin cDNA probes. B: Differential expression of the human PRMT2 variants in human cancer cell lines and human fetal tissues. Total protein extracts from human cancer cell lines and human fetal tissues were analyzed by immunoblotting with anti-N-PRMT2 antibodies. C: 293T cells were transfected with 0.5 μg of pcDNA3.2/V5/PRMT2L2 vectors. Whole-cell extracts were prepared, and equivalent amounts of untransfected 293T and MCF7 cell extracts were probed with anti-GAPDH antibody or anti-PRMT2-N-Terminal antibody.

dependent. In the absence of estrogen, PRMT2 and PRMT2L2 had no activity to ERE-LUC. To examine whether the transactivation activity of PRMT2 and PRMT2L2 is MCF7 cell-specific, this co-transfection study was conducted in ERα negative MDA-MB-231 breast cancer cells, and similar results were observed, but relatively weaker compared to the MCF7 cells (Fig. 4B). The regulatory activity of PRMT2 variants on ERE-LUC was also ERα dependent. Without co-transfection of ERα, the co-activation activity of PRMT2 and PRMT2L2 was negligible, even in the presence of estrogen (Fig. 4C). Taken together, our results suggest that PRMT2L2 could function as a co-regulator to enhance ERα-mediated transactivation activity in a ligand-dependent manner. 3.5. C-terminal sequences of PRMT2 can influence subcellular localization The previously described PRMTs are either essentially located in the cytoplasm (PRMT 3) or in the nucleus (PRMTs 1, 4, and 6) (Tang et al.,

Fig. 4. Overexpression of PRMT2L2 enhances ERα-mediated transactivation in breast cancer cells. A: MCF7 cells were co-transfected with 0.2 μg of ERE-LUC and different amounts of either PRMT2 or PRMT2L2 as indicated. Cells were then treated with control (0.1% ethanol) or 10 nM E2 for 24 h before luciferase assay. The LUC activity obtained on transfection of ERE-LUC without exogenous PRMT2 and PRMT2L2 in the absence of E2 was set as 1. Results are expressed as means ± SE for three independent experiments. B: MDA-MB-231 cells were co-transfected with 0.2 μg of ERE-LUC, 50 ng of ERα, and different amounts of either PRMT2 or PRMT2L2 as indicated. Cells were then treated and analyzed as in A. C: Effect of ERα on ERE-LUC reporter activity by PRMT2 and PRMT2L2. MDA-MB-231 cells were cotransfected with 0.2 μg of ERE-LUC and 0.4 μg of PRMT2 or PRMT2L2 in the absence or presence of ERα. Cells were then treated and analyzed as in B. *P b 0.05, vs transfect the wild PRMT2 400 ng alone; #P b 0.05, vs cotransfection of the wild PRMT2 300 ng together with PRMT2L2 plasmid 100 ng.

1998; Rho et al., 2001; Frankel et al., 2002) or in both (PRMTs 5, and 9) (Cook et al., 2006; Eckert et al., 2008; Wang et al., 2008; Herrmann et al., 2009). We then wanted to compare the subcellular localization of PRMT2 and PRMT2L2. Presently, reliable antibodies recognizing the different PRMT2 variants are not available. We therefore utilized GFP fusion proteins to study the expression of the PRMT2 variant proteins. As shown in Fig. 5A, cells expressing pcDNA3.1/NT-GFP as a control

6

J. Zhong et al. / Gene 487 (2011) 1–9

showed an even distribution of the GFP fusion proteins between the nucleus and the cytoplasm (Fig. 5Aa). Cells expressing wild-type PRMT2, appear to be largely localized to the nucleus excluding the nucleoli and diffused in the nucleoplasm with additional concentration in speckles; however, a faint fluorescence was detected in the cytosol (Fig. 5Ab) as described previously (Frankel et al., 2002; Herrmann et al., 2009). Strikingly, the GFP-PRMT2L2 fusion protein expression resulted in a predominantly cytoplasmic staining concentrated around the nuclear compartment (Fig. 5Ac). To confirm that the observed differential subcellular localization of PRMT2 variants was not due to overexpression and/or the GFP tag, we

used western blot to monitor the relative expression of the GFP-fusion protein compared to endogenous protein. T47D cells with transiently transfect GFP tag plasmids were fractionated, and an equal proportion of each was resolved by SDS-PAGE, transferred to a nitrocellulose membrane, and immunoblotted using the polyclonal anti-PRMT2-Nterminal antibodies described above. Consistent with the distribution observed above, GFP-fusion protein and endogenous protein are detected in T47D cells (Fig. 5B). To further confirm whether the endogenous PRMT2 and PRMT2L2 are nuclear, cytoplasmic, or both, we examine their protein levels in HepG2, T47D and HeLa cells. As shown in Fig. 5C, two major bands were detected with molecular

Fig. 5. PRMT2 C-terminal unique sequences affect intracellular localization. A: T47D cells were transiently transfected with N-terminal GFP-tagged PRMT2 variants for 48 h, cells were viewed under a Zeiss LSM 510 confocal microscope. Green represents the pixel intensity distribution of the GFP signal, blue depicts the profile of the exclusively nuclear DAPI staining, and red depicts the profile of the exclusively mitochondrion MitoTracker Red CM-H2XRos staining. pcDNA3.1/NT-GFP as the control (a), wild-type PRMT2 (b), PRMT2L2 (c). B: total cell lysates of T47D cells transiently expressing the GFP-tagged PRMT2 and PRMT2L2 were resolved by SDS-PAGE, transferred on a polyvinylidene difluoride membrane, and immunoblotted with anti-N-PRMT2 antibodies. A pcDNA3.1/NT-GFP expression plasmid was used as a control. C: Distributions of endogenous PRMT2 and PRMT2L2 in the total protein extracts (T), cytoplasm (C) and nuclei (N) were examined by western blotting using anti-PRMT2-N-Terminal antibody. Immunoblots with antibodies directed against the nuclear protein Sam68 and/or against the cytoplasmic protein GAPDH are shown to confirm cellular fractionation.

J. Zhong et al. / Gene 487 (2011) 1–9

7

weight at 48.5 kDa (PRMT2) and 32 kDa (PRMT2L2), consistent with the results of Fig. 3B. According to the band density, wild type PRMT2 is the predominant form expressed in almost all cell fractions except the cytoplasm of HepG2. PRMT2L2 expressed only in the cytoplasm of T47D and HeLa cells, and nearly vanished in the nuclei. Differently, PRMT2L2 was detected faintly only in the nuclear of HepG2 cells. Taken together, these results show that the alternatively spliced C terminus of PRMT2 can directly influence its intracellular localization. 3.6. Overexpression of PRMT2 and PRMT2L2 mRNA in breast cancer is associated with ERα positivity To assess whether the expression of PRMT2 C-terminal variant is distinct in breast cancer cells, we examined the expression of the PRMT2 gene in breast cancer cell lines using real-time PCR. GAPDH mRNA was used as the control. The primer design allowed us to distinguish between the alternative splice forms (Table 2 for the sequences). PRMT2 and PRMT2L2 expressions in ERα-positive breast cancer cells are higher than that in the ERα-negative cells. Specifically, the expression of the PRMT2L2 variant is relatively higher in MCF7 cells than that of the wild-type PRMT2 (Fig. 6A). To obtain data regarding the relative expression of PRMT2 variants in breast carcinoma, 61 clinical breast cancer samples were analyzed by real-time PCR. In absolute terms, breast cancer tissues expressed PRMT2 mRNA levels similar to, but less than, that of PRMT2L2. Overexpression of the transcripts encoding PRMT2L2 and PRMT2 was seen in 46% and 38% of the patients, respectively, compared with normal tissues (P b 0.001; Fig. 6B). Both PRMT2 and PRMT2L2 expression in ERα-negative breast cancer tissues are higher than that in the normal tissues (P b 0.01; Fig. 6B). PRMT2 mRNA expression was also associated with tumor ERα expression (P b 0.001; Fig. 6B). Similar results were obtained for the PRMT2L2 mRNA in these specimens. These results show that their mRNA levels are consistent with the presence of ERα in majority of the breast carcinoma specimens and in the breast carcinoma cell lines. 4. Discussion Alternative RNA splicing and polyadenylation of genes are sophisticated nuclear processes, which allows the diversification of the protein products of a single gene in terms not only of their structure, but also their function and/or cellular localization (Stamm et al., 2005; Liu et al., 2009). PRMTs play a role in the control of mRNA processing and maturation by modulating the activity of RNA-binding proteins. In previous studies, the human HRMT1L1 (PRMT2) gene was mapped to chromosome 21 at 21q22.3. It was shown to cover 30 kb of the genome sequence and to contain at least 11 exons (Katsanis et al., 1997). This study reports for the first time the structural character-

Table 2 Sequence of primers and TaqMan® Eclipse probes used in the quantitative real time reverse transcriptase-PCR FAM, 6-carboxyfluoresceine. Gene name

Primers and probes sequences

PRMT2

Forward: 5′-GTCCACTTCCAGAGCCTGCA-3′ Reverse: 5′-CATGAACAGCGTCTGCTTCCA-3′ Probe: 5′-(FAM) AGCCGCCGCAGGTGCTCAGC (Eclipse)-3′ Forward: 5′-GAAGGAGGACGGGGTCATTTG-3′ Reverse: 5′-TGCAGACTGTGGACCAGGAG-3′ Probe: 5′-(FAM) CCACAAGACGGTGCCAGTCCCAGC (Eclipse)-3′ Forward: 5′-GGACCTGACCTGCCGTCTAG-3′ Reverse: 5′-TAGCCCAGGATGCCCTTGAG-3′ Probe: 5′-(FAM) CCTCCGACGCCTGCTTCACCT (Eclipse) -3′

PRMT2L2

GAPDH

Amplicon size(bp) 96

189

99

Fig. 6. Differential expression of the human PRMT2 variants in breast cancer cells and tissues. A: Relative expression of the PRMT2 variant mRNAs in ERα-positive and -negative human breast cancer cells determined by quantitative real time PCR. The experiments were performed in triplicate and the results are expressed as mean ± SD. B: RNA samples representing adjacent normal breast tissues and 61 breast cancer cases were analyzed for transcripts encoding PRMT2 and PRMT2L2. GAPDH mRNA expression was used to normalize their expression. The SDs of three parallel analyses were b5% of the means.

ization and genomic organization of the full-length human PRMT2 gene and its novel transcript PRMT2L2 resulted from alternative polyadenylation site. Currently, the role for this posttranscriptional regulation of PRMT2 mRNA is not well understood. Here we isolated a shorter transcript of PRMT2 that was terminated by different polyadenylation signal sequences, and is consistent with the result of northern blot analysis. Due to silence of 5′-splice site, exon 7 of PRMT2 gene can serve either

8

J. Zhong et al. / Gene 487 (2011) 1–9

as the 3′-terminal exon in PRMT2L2 transcript or as an internal exon in full-length PRMT2 transcript which ends with a normal 3′-terminal exon found further downstream. Thus exon 7 is a composite exon (Edwalds-Gilbert et al., 1997). Alternative polyadenylation sites can lead to mRNAs with variable 3′-UTRs as well as distinct protein products (Chang et al., 2002; Liu et al., 2009). However, it is not understood why transcription of the human PRMT2 gene utilizes multiple poly(A) signal sequences, and this might depend on different cellular and genetic contexts. We examined the differential expression of the PRMT2 variants in normal human tissues and organs. The northern blot results elucidate the expression of PRMT2 and its variant in major estrogen target organs. Meanwhile, the PRMT2 and PRMT2L2 mRNA expression levels in ERαpositive breast cancer cells are higher than that in ERα-negative cells. This indicates that the PRMT2 gene is significantly associated with the ERα signal transmission pathway. We also found that the expressions of PRMT2 and PRMT2L2 mRNA in breast malignant tissues were significantly higher than that in adjacent normal breast tissues, and their expressions were positively correlated to ERα status. Still, in parts of the ERα-negative tumors, their expressions were relatively higher, suggesting that their expressions in human tumors are also associated with other nuclear receptors possibly. However, there is a discrepancy between the results of the northern blot/real-time PCR, showing that the level of PRMT2L2 mRNA is significantly higher than that of PRMT2, and the results from the western blotting, showing the wild-type PRMT2 is clearly present at higher levels in the human cancer cell lines and normal human fetal tissue protein extracts. The variant PRMT2L2 is present in several human cell lines and tissues, and even stronger than that of the wildtype, in the B-LCL 721 (Fig. 3B). A possible explanation is that PRMT2L2 is associated with protein degradation. Other possible factors that may contribute to different cellular backgrounds and the reduction in protein levels include translational repression and/or inefficient mRNA transport or a miRNA action. Determining which option is more probable is difficult at this point. In addition, a novel variant possibly appeared in several normal human fetal tissues but not observed in the cancer cell lines, suggesting the contribution from distinct regulatory mechanisms at the translational or post-translational level in normal human fetal tissues and cancer cells. It has been reported that the N-terminal region is necessary for PRMT2–ERα interaction (Qi et al., 2002). We characterized the function of the novel variant of PRMT2. Both PRMT2 and PRMT2L2 retain the ability to enhance ERα-mediated transactivation activity. However, PRMT2L2 exhibits lower transcriptional activity to ERα compared with the wild type PRMT2 in transient transfection assays both in ERα-positive MCF7 cells and ERα-negative MDA-MB-231 cells. In the co-transfection assay, the total amount of PRMT2/PRMT2L2 in different groups is 400 ng, no obvious difference were observed when co-transfecting PRMT2L2 variant 100 ng together with the wild PRMT2 plasmid 300 ng was compared to that with wild PRMT2 plasmids alone. Whereas, co-transfecting PRMT2L2 variant 300 ng together with the wild PRMT2 plasmid 100 ng significantly decreased the level of ERE-LUC activation compared with the cotransfection of PRMT2L2 variant 100 ng together with the wild PRMT2 plasmid 300 ng (Pb 0.05; Fig. 4A). Perhaps, PRMT2L2 acts as a dominant sequester and competitor for PRMT2 binding partners based on the SH3 domains and prevents the transcriptional activity of this complex. The lower activity of PRMT2L2 to ERα compared with PRMT2 suggests an unexpected function for the PRMT2-C terminus in transcriptional regulation. The possibility remains that PRMT2-C terminus (278–433) may recruit other proteins that help to mediate PRMT2 co-activator function. Meyer et al. reported that PRMT2 is also a coactivator of the androgen receptor (AR) and the progesterone receptor (PR), moreover, under androgen-free conditions, both AR and PRMT2 are confined to the cytoplasm of HepG2 cells, whereas in the presence of androgen, both proteins colocalize and translocate into the nucleus (Meyer et al., 2007). Our findings of confocal microscopy (Fig. 5A) showed that the wild type

PRMT2 was predominantly localized to the nucleus of T47D cells in physiological conditions, and PRMT2L2 was largely distributed in the cytoplasm, suggesting that the C-terminal region in PRMT2 is critical for the subcellular localization. It could be speculated that PRMT2 might cooperate with numerous nuclear hormone receptors, and the subcellular localization of PRMT2 variants is cell-type specific. This phenomenon was confirmed in the result of our western blot (Fig. 5C), and the significance of this difference remains to be explored. The PRMT2L2 variant has a premature termination codon in the retained intron 7 and thus, it might be targeted for nonsense-mediated decay (NMD) (Lewis et al., 2003). However, it is also reported that NMD does not always happen in the intron retention (Corcoran et al., 2009). PRMT2L2 does not seem to be degraded completely, since it can still be detected by northern blotting/ real-time PCR and western blotting. The ability of the mRNA to exert regulatory functions at the post-transcriptional level is yet to be established. Alternative splicing and polyadenylation of genes can lead to translation of novel isoforms derived from a single gene, thereby expanding the diversity of gene expression and proteomes (Modrek and Lee, 2002; Stamm et al., 2005). Alternative splicing was reported for PRMT1, CARM1, and PRMT7 pre-mRNAs (Ohkura et al., 2005; Gros et al., 2006; Goulet et al., 2007). They are considered coactivators of nuclear receptors and are overexpressed in hormone-dependent cancers, including breast cancer (Bedford, 2007). In this study, we identified a novel PRMT2 transcript resulted from an intron located alternative polyadenylation site. These transcripts showed a tissue specific expression pattern, and their levels are changed during different cells and tissues. All these results indicated that human PRMT2 gene expression may be regulated in post-transcriptional level by using of alternative polyadenylation site and/or alternative splicing. Further investigations are necessary to determine the biological significance of the splice variants. Acknowledgments This work was supported by the National Natural Science Foundation of the People's Republic of China (Grant Nos. 30670993 and 30840052). References Bedford, M.T., 2007. Arginine methylation at a glance. J. Cell Sci. 120, 4243–4246. Besson, V., Brault, V., Duchon, A., Togbe, D., Bizot, J.-C., Quesniaux, V.F.J., et al., 2007. Modeling the monosomy for the telomeric part of human chromosome 21 reveals haploinsufficient genes modulating the inflammatory and airway responses. Hum. Mol. Genet. 16, 2040–2052. Blythe, S.A., Cha, S.W., Tadjuidje, E., Heasman, J., Klein, P.S., 2010. beta-Catenin primes organizer gene expression by recruiting a histone H3 arginine 8 methyltransferase, Prmt2. Dev. Cell 19, 220–231. Chang, L.S., Akhmametyeva, E.M., Wu, Y., Zhu, L., Welling, D.B., 2002. Multiple transcription initiation sites, alternative splicing, and differential polyadenylation contribute to the complexity of human neurofibromatosis 2 transcripts. Genomics 79, 63–76. Chen, S.L., Loffler, K.A., Chen, D., Stallcup, M.R., Muscat, G.E.O., 2002. The coactivatorassociated arginine methyltransferase is necessary for muscle differentiation. Carm1 coactivates myocyte enhancer factor-2. J. Biol. Chem. 277, 4324–4333. Cook, J.R., Lee, J.H., Yang, Z.H., Krause, C.D., Herth, N., Hoffmann, R., et al., 2006. FBXO11/ PRMT9, a new protein arginine methyltransferase, symmetrically dimethylates arginine residues. Biochem. Biophys. Res. Commun. 342, 472–481. Corcoran, C.A., Montalbano, J., Sun, H., He, Q., Huang, Y., Sheikh, M.S., 2009. Identification and characterization of two novel isoforms of Pirh2 ubiquitin ligase that negatively regulate p53 independent of ring finger domains. J. Biol. Chem. 284, 21955–21970. Eckert, D., Biermann, K., Nettersheim, D., Gillis, A.J., Steger, K., Jack, H.M., et al., 2008. Expression of BLIMP1/PRMT5 and concurrent histone H2A/H4 arginine 3 dimethylation in fetal germ cells, CIS/IGCNU and germ cell tumors. BMC Dev. Biol. 8, 106. Edwalds-Gilbert, G., Veraldi, K.L., Milcarek, C., 1997. Alternative poly(A) site selection in complex transcription units: means to an end? Nucleic Acids Res. 25, 2547–2561. Frankel, A., Yadav, N., Lee, J., Branscombe, T.L., Clarke, S., Bedford, M.T., 2002. The novel human protein arginine n-methyltransferase PRMT6 is a nuclear enzyme displaying unique substrate specificity. J. Biol. Chem. 277, 3537–3543. Ganesh, L., Yoshimoto, T., Moorthy, N.C., Akahata, W., Boehm, M., Nabel, E.G., et al., 2006. Protein methyltransferase 2 inhibits NF-{kappa}B function and promotes apoptosis. Mol. Cell. Biol. 26, 3864–3874. Goulet, I., Gauvin, G., Boisvenue, S., Cote, J., 2007. Alternative splicing yields protein arginine methyltransferase 1 isoforms with distinct activity, substrate specificity, and subcellular localization. J. Biol. Chem. 282, 33009–33021.

J. Zhong et al. / Gene 487 (2011) 1–9 Gros, L., Renodon-Corniere, A., de Saint Vincent, B.R., Feder, M., Bujnicki, J.M., Jacquemin-Sablon, A., 2006. Characterization of prmt7alpha and beta isozymes from Chinese hamster cells sensitive and resistant to topoisomerase II inhibitors. Biochim. Biophys. Acta 1760, 1646–1656. Herrmann, F., Pably, P., Eckerich, C., Bedford, M.T., Fackelmayer, F.O., 2009. Human protein arginine methyltransferases in vivo — distinct properties of eight canonical members of the PRMT family. J. Cell Sci. 122, 667–677. Iwasaki, H., Kovacic, J.C., Olive, M., Beers, J.K., Yoshimoto, T., Crook, M.F., et al., 2010. Disruption of protein arginine N-methyltransferase 2 regulates leptin signaling and produces leanness in vivo through loss of STAT3 methylation. Circ. Res. 107, 992–1001. Katsanis, N., Yaspo, M.L., Fisher, E.M., 1997. Identification and mapping of a novel human gene, HRMT1L1, homologous to the rat protein arginine N-methyltransferase 1 (PRMT1) gene. Mamm. Genome 8, 526–529. Krause, C.D., Yang, Z.H., Kim, Y.S., Lee, J.H., Cook, J.R., Pestka, S., 2007. Protein arginine methyltransferases: evolution and assessment of their pharmacological and therapeutic potential. Pharmacol. Ther. 113, 50–87. Lakowski, T.M., Frankel, A., 2009. Kinetic analysis of human protein arginine Nmethyltransferase 2: formation of monomethyl- and asymmetric dimethylarginine residues on histone H4. Biochem. J. 421, 253–261. Lewis, B.P., Green, R.E., Brenner, S.E., 2003. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. PNAS 100, 189–192. Li, H., Park, S., Kilburn, B., Jelinek, M.A., Henschen-Edman, A., Aswad, D.W., et al., 2002. Lipopolysaccharide-induced Methylation of HuR, an mRNA-stabilizing Protein, by CARM1. J. Biol. Chem. 277, 44623–44630. Lin, W.-J., Gary, J.D., Yang, M.C., Clarke, S., Herschman, H.R., 1996. The mammalian immediate-early TIS21 Protein and the leukemia-associated BTG1 protein interact with a protein-arginine N-methyltransferase. J. Biol. Chem. 271, 15034–15044. Liu, H., Wang, Z., Li, S., Zhang, Y., Yan, Y.C., Li, Y.P., 2009. Utilization of an intron located polyadenlyation site resulted in four novel glutamate decarboxylase transcripts. Mol. Biol. Rep. 36, 1469–1474. Lukong, K.E., Richard, S., 2004. Arginine methylation signals mRNA export. Nat. Struct. Mol. Biol. 11, 914–915.

9

McBride, A.E., Silver, P.A., 2001. State of the arg: protein methylation at arginine comes of age. Cell 106, 5–8. Meister, G., Fischer, U., 2002. Assisted RNP assembly: SMN and PRMT5 complexes cooperate in the formation of spliceosomal UsnRNPs. EMBO J. 21, 5853–5863. Meyer, R., Wolf, S.S., Obendorf, M., 2007. PRMT2, a member of the protein arginine methyltransferase family, is a coactivator of the androgen receptor. J. Steroid Biochem. Mol. Biol. 107, 1–14. Modrek, B., Lee, C., 2002. A genomic view of alternative splicing. Nat. Genet. 30, 13–19. Ohkura, N., Takahashi, M., Yaguchi, H., Nagamura, Y., Tsukada, T., 2005. Coactivatorassociated arginine methyltransferase 1, CARM1, affects pre-mRNA splicing in an isoform-specific manner. J. Biol. Chem. 28927–28935. Qi, C., Chang, J., Zhu, Y., Yeldandi, A.V., Rao, S.M., Zhu, Y.-J., 2002. Identification of protein arginine methyltransferase 2 as a coactivator for estrogen receptor alpha. J. Biol. Chem. 277, 28624–28630. Rho, J., Choi, S., Seong, Y.R., Cho, W.-K., Kim, S.H., Im, D.-S., 2001. PRMT5, which forms distinct homo-oligomers, is a member of the protein-arginine methyltransferase family. J. Biol. Chem. 276, 11393–11401. Scott, H.S., Antonarakis, S.E., Lalioti, M.D., Rossier, C., Silver, P.A., Henry, M.F., 1998. Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2). Genomics 48, 330–340. Stamm, S., Ben-Ari, S., Rafalska, I., Tang, Y., Zhang, Z., Toiber, D., et al., 2005. Function of alternative splicing. Gene 344, 1–20. Tang, J., Gary, J.D., Clarke, S., Herschman, H.R., 1998. PRMT 3, type I protein arginine Nmethyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J. Biol. Chem. 273, 16935–16945. Torres-Padilla, M.E., Parfitt, D.E., Kouzarides, T., Zernicka-Goetz, M., 2007. Histone arginine methylation regulates pluripotency in the early mouse embryo. Nature 445, 214–218. Wang, L., Pal, S., Sif, S., 2008. Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol. Cell. Biol. 28, 6262–6277. Yildirim, A.O., Bulau, P., Zakrzewicz, D., Kitowska, K.E., Weissmann, N., Grimminger, F., et al., 2006. Increased protein arginine methylation in chronic hypoxia: role of protein arginine methyltransferases. Am. J. Respir. Cell Mol. Biol. 35, 436–443.