Identification and expression analysis of a Spsb gene in planarian Dugesia japonica

GENE-40362; No. of pages: 8; 4C: Gene xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

2Q1 3

Research paper

Identification and expression analysis of a Spsb gene in planarian Dugesia japonica

F

1

6

College of Life Science, Henan Normal University, Xinxiang, 453007 Henan, China

7

a r t i c l e

8 9 10 11 12

Article history: Received 21 October 2014 Received in revised form 2 March 2015 Accepted 14 March 2015 Available online xxxx

13 14 15 16 17 18

Keywords: Spsb Planarians Expression pattern Regeneration Stress

R O

i n f o

O

5

Zimei Dong 1, Fangfang Cheng 1, Yanqing Yuwen, Jing Chen, Xiaoyan Li, He Dou, Haixia Zhang, Guangwen Chen ⁎, Dezeng Liu

a b s t r a c t

E

D

P

The SPSB family is comprised of four highly conserved proteins, each containing a C-terminal SOCS box motif and a central SPRY domain. Presently, Spsb genes have been found in mammals and in a few invertebrates, however, the specific functions of these genes are still unknown. In this study, we identified a Spsb gene from the planarian Dugesia japonica and termed it DjSpsb. The temporal and spatial expression patterns of DjSpsb were examined in both intact and regenerative animals, and expression levels were also quantified in response to various stressors. The results show that (1) DjSpsb is highly conserved in evolutionary history in metazoans and is at closer relationship to Spsb1, Spsb2 and Spsb4; (2) DjSpsb mRNA is mainly expressed in the head and also throughout head regeneration processes, particularly, its expression up-regulated observably on day 5 after amputation; (3) DjSpsb is also expressed in the testes and yolk glands; (4) DjSpsb expression is induced by high temperature and ethanol but inhibited by high doses of ionic liquids. The date suggests that the DjSpsb gene might be active in central nervous system (CNS) formation and functional recovery during head regeneration, and it is also involved in the development of germ cells and stress responses in the planarians. © 2015 Published by Elsevier B.V.

T

4Q2

C

31 35 33 32

E

34

1. Introduction

37

SPSB (also known as SSB) proteins are originally identified as a subfamily of the large suppressor of cytokine signaling (SOCS) family (Hilton et al., 1998), which contain two well-conserved protein domains: a sp1A/ryanodine receptor (SPRY) domain and a suppressor of cytokine signaling (SOCS) box. SOCS family proteins are characterized by a SOCS box, a domain of approximately 50 amino acid residues that is located at the C-terminus. Traditionally, this domain has been associated with the inhibition of cell signaling molecules either through competitive phosphorylation or by targeting proteins for ubiquitination and subsequent degradation (Kile et al., 2002). Currently, there are about 1600 eukaryotic proteins recognized as containing a SPRY domain in the SMART database and 46 are encoded within the human genome (Letunic et al., 2004). The SPRY domain is generally thought to mediate protein–protein interactions, and recent functional and structural evidence also suggest that the SPRY element allows for more versatile folding (Wang et al., 2005; Woo et al., 2006; Perfetto et al., 2013). Thus far, four Spsb genes, termed Spsb1 to Spsb4, have been identified

44 45 46 47 48 49 50 51 52 53

R

N C O

42 43

U

40 41

R

36

38 39

19 20 21 22 23 24 25 26 27 28 29 30

Abbreviations: CNS, central nervous system; SPRY, sp1A/ryanodine receptor domain; SOCS, suppressor of cytokine signaling box; RACE, rapid amplification of cDNA ends. ⁎ Corresponding author. E-mail address: [email protected] (G. Chen). 1 These authors contributed equally to this work.

in metazoans and shown to be expressed in certain tissues, such as the ovaries, testes, brain, lung and thymus (Styhler et al., 2002; Li et al., 2009; Zhang et al., 2011). Although, previous studies have explored some characteristics of specific SPSB family members using genetic, biochemical and crystal structural analyses, such as, SPSB proteins may be as part of an E3 ubiquitin ligase, with the SPRY domain determining the substrate for ubiquitination (James et al., 2007; Kleiber and Singh, 2009; Filippakopoulos et al., 2010). The data concerning the Spsb gene family, especially in the invertebrates, is limited and the specific function of Spsb genes remains to be determined. Freshwater planarians (Platyhelminthes, Tricladida) are wellknown to have a powerful regenerative ability and considered similar to ancestral animals that first evolved a CNS (Agata and Watanabe, 1999). Within a week of transverse amputation at the post-auricle level, the trunk fragment will completely regenerate a head including the CNS (Umesono and Agata, 2009; Dong et al., 2011). Planarians are an emerging model for studying regeneration of the CNS. In recent years, hundreds of CNS specific genes have been identified in the two most commonly studied freshwater planarians, Dugesia japonica and Schmidtea mediterranea (Nakazawa et al., 2003; Iglesias et al., 2011; Nishimura et al., 2010; Lapan and Reddien, 2012). However, the mechanisms behind CNS regeneration in planarians are still unknown. In this paper, we firstly identified a Spsb gene from the planarian D. japonica and investigated its temporal and spatial expression pattern in intact and regenerating worms. At the same time, the expression

http://dx.doi.org/10.1016/j.gene.2015.03.032 0378-1119/© 2015 Published by Elsevier B.V.

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

54 55 56 57 58 59 60 61 Q3 62 63 64 65 66 67 68 69 70 71 72 Q4 73 74 75 76 77 78

2.1. Animals and treatments

84

104

Planarians used in this work were the sexually mature and immature intact worms of the species D. japonica, collected from Yuquan spring, Henan Province, China (Elevation: 200 m, 35°48.409 N, 114°06.852 E, Water temperature: 16 °C, pH: 5.4). The worms were cultured in autoclaved tap water in the dark at 18 °C and fed once a week with fresh fish spleen, and they were starved for at least 1 week prior to use. Regenerating fragments were obtained by transverse amputation at the post-auricle level from sexually immature intact worms (Fig. 3A). This study did not involve endangered or protected species and the collection of specimens was approved by the Forestry Department of Wild Animal Protection, Henan Province, China. For the stress response experiments, 260 sexually immature worms were evenly divided into 13 groups (20 animals per group) and exposed to different gradient stressors according to the pre-experiments. For thermal stress, 18 °C (the control), 12 °C, 24 °C and 30 °C were designed and worms were cultured under different temperature conditions for 3 days, respectively. To induce stress with chemicals, 0.25%, 0.5%, 1% or 2% ethanol and 15.6, 31.2 or 62.4 mg/L [C8mim] Br were designed as treated groups. Worms were exposed to the above chemical stressors in the dark at 18 °C for 3 days, respectively, and autoclaved tap water was as the control.

105

2.2. Isolation of the planarian DjSpsb gene

106 107

122

Total RNA was extracted using Trizol (TaKaRa, China) and the first strand cDNA was synthesized from 1 μg of total RNA using SuperScriptIII RNaseH-reverse transcriptase (Invitrogen, USA) according to the manufacturer's protocol. All primers used in this study are shown in Table 1. The cDNA was used as the template for PCR, and a set of degenerate oligonucleotide primers (DjSpsb degenerate) were designed to amplify the EST of DjSpsb on the basis of the amino acid alignment of Spsb sequences from various eumetazoa. Based on the EST of DjSpsb cDNA, the 5′-gene specific primers (DjSpsb 5GSP1 and GSP2) and 3′-gene specific primers (DjSpsb 3GSP1 and GSP2) were designed. The corresponding full-length transcripts were amplified by rapid amplification of complementary DNA (cDNA) ends (RACE) using both the 5′ and 3′-Full RACE kits (TaKaRa, China) according to the manufacturer's instructions. The PCR products were gel-purified and then ligated into the pUCm-T vector, which was then sequenced. The sequence reported here has been deposited into the GenBank database (accession no.: KJ398212).

123

2.3. Sequence analysis of DjSpsb and phylogenetic tree reconstruction

124

The amino acid sequence of DjSpsb was deduced from its cDNA nucleotide sequence. The predicted DjSPSB protein sequence was analyzed using the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi. nlm.nih.gov/blast/Blast.cgi) (Altschul et al., 1997). The DjSPSB domain was predicted using the simple modular architecture research tool (SMART) version 4.0 program (http://www.smart.emblheidelberg.de/) and the Interpro program (http://www.ebi.ac.uk/interpro/) (Schultz et al., 1998; Zdobnov and Apweiler, 2001). To align DjSPSB with SPSB sequences from other species, the GenBank protein database was searched using both BLASTn and BLASTp at web servers of the National Center of Biotechnology Information (http://www.ncbi.nlm.nih.gov/ blast). The similarities and identities of the known SPSB sequences were calculated using the MatGAT program with default parameters (Campanella et al., 2003). Multiple SPSB protein sequences were

103

108 109 110 111 112 113 114 115 116 117 118 119 120 121

125 126 127 128 129 130 Q6 131 Q7 132 133 134 135 136 137

t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13

aligned using Clustal 1.83 (http://www.clustal.org/). A phylogenetic tree was built using the Bayesian inference (BI) in MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). ProtTes was used to select the optimal models based on the Akaike Information Criterion (AIC) (Abascal et al., 2005). The Bayesian analyses of the amino acid matrix were performed using the LG + G + F model. Four Markov chains were run for one hundred thousand generations with sampling every 100 generations. The first 25% of trees were removed as part of the “burn-in” stage followed by a calculation of Bayesian posterior probabilities (PP). The 50% majority-rule consensus of the post burn-in trees were sampled at stationarity.

138 139 140 141 142 143 144 145 146 147 148

2.4. Whole-mount in situ hybridization and in situ hybridization of sections 149 Sense and antisense digoxigenin-labeled probes were designed according to a DjSpsb fragment (373 to 758). The probes were synthesized using the RNA in vitro labeling kit (Roche). Whole-mount in situ hybridizations (WISH) were performed with sexually mature, sexually immature intact and regenerating worms as described previously (Pearson et al., 2009), with some modifications: planarians were treated with 2% HCl to kill and remove mucus at 4 °C for 2 min; followed by proteinase K treatment (20 mg/mL) for between 10 and 20 min depending on the size; hybridization was performed at 58 °C for 28 h in solution containing 50% formamide, 5 × SSC, 50 × Dehardent's, 1% Tween 20, 0.1 mg/mL heparan sulfate, 1 mg/mL yeast tRNA and 10% dextran sulfate with digoxigenin-labeled RNA probes. Samples were viewed and photographed under a Leica DMLB stereomicroscope equipped with a Leica DFC300FX camera. After WISH, the sexually mature intact worms were proceeded for cytosections. The worms were fixed for 4–6 h with 4% formaldehyde in phosphate-buffered saline (PBS), then submerged overnight in an ascending series of ice-cold sucrose solutions (12%, 15%, and 18% sucrose in HBS), followed by blocking of specimens with OCT compound (Tissue-tek 4583; Sakura Finetechnical, Tokyo, Japan) and frozen in liquid nitrogen. Cryostat sections of 16 μm thickness were fixed with 4% formaldehyde in PBS for 30 min on ice and washed twice with PBS, then pretreated with proteinase K and acetic anhydride. Sections were hybridized with cRNA probe at a concentration of about 1 ng/μL overnight at 60 °C in hybridization solution. Then the sections were washed and the unbound cRNA was removed by the RNase and incubated with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche) at 4 °C overnight. For visualization of the labeled mRNA, a substrate solution of nitroblue tetrazolium salt (NBT) and 5-bromo-4-chloro-3-indoyl phosphate (BCIP) was added. The color reaction on sections was viewed and photographed under a transmission microscope (BX40; Olympus, Hamburg, Germany) equipped with a digital camera (DP70; Olympus).

150 151

2.5. Quantitative real-time PCR analysis of gene expression

182

T

101 102

C

99 100

E

97 98

R

95 96

R

93 94 Q5

O

91 92

C

89 90

N

87 88

U

85 86

t1:3

TCNGGGARATWAAVTGGCC ACAWTGABCMCVTACAGC ACAGGACTTCAAGGAAAGACTC GTGATGGGTAATGACTTTCTGG CCAATAACTGCATGAGTGCCTC CATGACTCATTATCTATGCCAAC GTTGCCTTCTAACCCTTATGCT CTATATCCCAACCCCATGACTC ACACCGTACCAATCTATG GTGAAACTGTAACCTCGT

F

83

Sequence (5′–3′)

DjSpsb degenerate pr-F DjSpsb degenerate pr-R DjSpsb 3GSP1 DjSpsb 3GSP2 DjSpsb 5GSP1 DjSpsb 5GSP2 DjSpsb RT-F DjSpsb RT-R Djβ-actin RT-F Djβ-actin RT-R

O

2. Materials and methods

Name

E

82

t1:1 t1:2

Table 1 Primers used in this study.

R O

81

patterns of DjSpsb were examined in response to various stressors. Our work provides basic data to elucidate the functions of Spsb genes and the molecular mechanism of planarian CNS regeneration.

P

79 80

Z. Dong et al. / Gene xxx (2015) xxx–xxx

D

2

152 153 154 Q8 155 156 157 158 159 160 161 162 163 164 165 166 167 168 Q9 169 170 171 172 173 174 175 176 177 178 179 180 181

Quantitative real-time PCR was carried out as described previously 183 (Dong et al., 2012). DjSpsb 233 bp (DjSpsb RT) was used for real-time 184 PCR; a Djβ-actin gene 121 bp (Djβ-actin RT) was used as the internal 185

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

Z. Dong et al. / Gene xxx (2015) xxx–xxx

186 187

3

189

2.6. Statistical analysis of data

190

196

Statistical analysis was performed using SPSS 13.0 software. Significant interactions with external stressor and during the regeneration stage were determined by one-way ANOVA followed by post-hoc multiple comparisons using the LSD test. For all experiments, the data from biological replicates (n = 3) were averaged and shown as mean ± standard deviation. Differences were considered statistically significant at P b 0.05 and highly significant at P b 0.01.

A sequence analysis of DjSPSB by SMART identified an SPRY domain (residues 134–279) and a SOCS-box (residues 276–300), while InterProScan identified the SPRY/B30.2 domain, which spanned most of the SPRY domain and the 76 residues preceding this domain. Although sequence analysis by SMART only identified the first half of a SOCS box, which might be attributable to an approximate 20 amino acid stretch between the two blocks, the critical residues of the second half appeared to be conserved by multiple sequence alignment (Fig. 1A). Finally, a conserved SPRY/B30.2-domain (residues 58–279) and a SOCS-box (residues 279–306 and 329–344) were identified in the DjSPSB protein by SMART and Interpro analysis (Fig. 1B). The deduced protein has a predicted molecular mass of 40.90 kDa and theoretical isoelectric point of 9.04.

197

3. Results

3.2. Homology analysis of DjSpsb

198

3.1. Isolation and characterization of a planarian Spsb gene cDNA clone

199

Initial isolation and partial characterization of a planarian Spsb homologue were achieved by PCR amplification using a set of degenerate oligonucleotide primers. A cDNA of 1251 bp was identified by RACEPCR from both ends, which included a 5′-terminal untranslated region (UTR) of 105 bp and a 3′-terminal UTR of 87 bp. The 3′ UTR was found to contain a canonical polyadenylation signal sequence (AATAAA) and a poly (A) tail. The open reading frame (ORF) was 1059 bp, which encoded a polypeptide of 352 amino acids (Additional File 1: Fig. S1).

We screened GenBank using the deduced amino acid sequence of DjSpsb. Our screen revealed apparent SPSB homologues in both mammalian and non-mammalian species and high conservation was found within the SPRY/B30.2 domain (Fig. 1A). Amino acid sequence alignment analysis indicated that DjSPSB had the highest identity (82.39%) between its related genera Dugesia ryukyuensis SPSB, but it shared low identity to other invertebrate and vertebrate SPSBs. For example, the DjSPSB shared a 30.23% identity with Drosophila melanogaster GUSTAVUS; 31.02% identity with Hydra magnipapillata SPSB3; 26.88% identity with Ascaris suum SPSB4; 29.55% and 28.81% identity with Danio rerio

O

R O

P

D E T

206

C

204 205

E

202 203

R

200 201

R

194 195

N C O

193

U

191 192

F

188

control (accession number: AB292462). Primers were designed using Oligo 6.0 software and all primers generated a single PCR band of the expected size. PCR products were verified by DNA sequencing.

Fig. 1. A: An alignment of the DjSPSB with those of other SPSB members. Black and pink shading indicate positions with sequence identity and similarity, respectively. The SPRY/B30.2domain is underlined (black) in the N-terminal and SOCS-box is underlined (red) in the carboxy terminal. Key hPar-4 contact residues of hSPSB1 are indicated by asterisks. B: Schematic representation of the structure of DjSPSB. The SPRY/B30.2-domain is shadowed and SOCS-box is drawn on a slant. Abbreviation: h: Homo sapiens; m: Mus musculus; GUSTAVUS: SPSB protein of Drosophila melanogaster; Dj: Dugesia japonica. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230

3.3. Expression pattern of DjSpsb in intact and regenerating planarians

248

In sexually immature intact worms, DjSpsb transcripts were mainly located in the head and were more strongly found at the margin. Furthermore, DjSpsb transcripts were also detected in the guts (Fig. 3B). In sexually mature intacts, the hybridization signals were expressed in

3.5. Expression pattern of DjSpsb in response to external stressors

254 255 256 257 258 259

263 264 265 266 267 268

In order to determine whether external stressors could induce DjSpsb 269 expression in planarians, expression patterns of DjSpsb in response to 270

D E T C

251

261 262

E

249 250

Quantitative real-time PCR was performed to examine the temporal expression of DjSpsb during head regeneration. The expression levels of intact immature animals were used as the control. The transcript levels of DjSpsb changed dynamically during head regeneration, displaying gradual increases with the head regeneration process and reaching a peak on day 5 after amputation. Afterwards, its expression levels reduced on day 7 post-amputation and were similar to the control (Fig. 5A).

R

244 245

260

R

242 243

3.4. Temporal expression pattern of DjSpsb during head regeneration

O

240 241

C

238 239

N

237

U

235 236

252 253

F

247

233 234

the reproductive system besides the head (Fig. 3C). The results of the sagittal cytosections further confirmed that the strongest signals were expressed in the head and nervous tissues in the trunk (Fig. 4A and D). At the same time, DjSpsb transcripts were also detected in the testes and yolk gland cells (Fig. 4B, C and G) but not in the ovary (Fig. 4E and F). Relatively, weak expression was detected in the guts (Fig. 4B and C). In the regenerating fragments, DjSpsb transcripts were expressed in the anterior blastemas and throughout the regenerating head (Fig. 3E–H).

P

246

SPSB1 and SPSB4; 27.56%, 29.97%, 18.33% and 28.81% identity with Homo sapiens SPSB1, SPSB2, SPSB3 and SPSB4, respectively. The results revealed that DjSPSB shared the least amino acid sequence identity with SPSB3 compared to SPSB1, SPSB2 and SPSB4. To explore the relationship between the DjSpsb and Spsb genes of other species, available invertebrate SPSB sequences and representative vertebrate SPSB sequences were used to construct the phylogenetic tree using the MrBayes method. As shown in Fig. 2, all the Spsb genes were classified into two clades: clade I can be further classified into two sub-clades: sub-clade I, which includes Spsb2, Spsb1 and Spsb4; and sub-clade II, which includes two planarian Spsbs. Clade II included Spsb3 genes from all species. Not surprisingly, the DjSpsb and Spsb from D. ryukyuensis, belonging to same genera, were clustered together. Interestingly, both of these genes did not cluster with any of the four members of Spsb gene family. The high bootstrap values supported the precision of topology.

O

231 232

Z. Dong et al. / Gene xxx (2015) xxx–xxx

R O

4

Fig. 2. Phylogenetic tree of SPSB proteins constructed by the MrBayes program. Numbers above the branches denote the posterior probabilities (only those ≥0.50 are shown). DjSPSB is shown with an asterisk.

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

5

N C O

R

R

E

C

T

E

D

P

R O

O

F

Z. Dong et al. / Gene xxx (2015) xxx–xxx

U

Fig. 3. Expression of DjSpsb in intact and regenerating planarians. The upper panel shows the intact and the lower panel shows the regenerating worms, respectively. A: Schematic drawing of a planarian body structure and showing the position of decapitation (cut). B: In sexually immature intact worms, DjSpsb is mainly expressed in the head and guts; C: In sexually mature intact worms, DjSpsb is expressed in the gonads (arrowheads). D: The control. E–H: In regenerating planarians, DjSpsb is expressed in the anterior blastema during head regeneration, the dashed yellow line indicates the border between the regenerating region and the stump. Abbreviation: b: brain; e: eye; a: auricle; o: ovary; ov: oviduct; vnc: ventral nerve cords; yg: yolk gland; g: gut; vd: vas deferens; t: testis; ph: pharynx; sv: seminal vesicle; cb: copulatory bursa; pb: penis bulb; ga: genital atrium; gp: genital pore. 1d, 3d, 5d, 7d: 1, 3, 5, 7 days after decapitation. In all images, anterior is at the top. Scale bars: 500 μm in panels B, D, E–H; 1000 μm in panel C. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

271 272 273 274 275 276 277 278 279 280

diverse external stressors were examined by quantitative real-time PCR. For thermal stress, the expression value of DjSpsb increased slightly at 12 °C and 24 °C compared to the control, and when worms were cultured at 30 °C for 3 days, expression levels showed a significant increase (Fig. 5B). For ethanol-induced stress, the expression levels of DjSpsb exhibited a significant upregulation in a dose-dependent manner and reached a peak at 2% ethanol concentration (Fig. 5C). For ionic liquidinduced stress, the expression values of DjSpsb all declined when the worms were exposed to three concentrations of [C8mim] Br, but there were no obvious differences between 15.6 mg/L and 31.2 mg/L [C8mim]

Br, and when [C8mim] Br concentrations were raised to 62.4 mg/L, 281 expression levels of DjSpsb decreased sharply and lower than the control 282 (Fig. 5D). 283 4. Discussion

284

In this study, a cDNA sequence of DjSpsb from the planarian D. japonica was firstly cloned and characterized. The deduced amino acid sequence from DjSpsb was analyzed using a number of bioinformatics tools and methods. The results show that the deduced sequence

285

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

286 287 288

Z. Dong et al. / Gene xxx (2015) xxx–xxx

D

P

R O

O

F

6

298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321

C

E

R

R

296 297

O

295

C

293 294

N

291 292

contains an N-terminal conserved SPRY/B30.2-domain and a C-terminal SOCS-box (Fig. 1A and B). Traditionally, the SOCS-box is about 50 amino acids in length and contains two blocks of well-conserved residues separated by between 2 and 10 non-conserved residues (Hilton et al., 1998); intriguingly, the SOCS-box of DjSPSB is an approximate 20 amino acid stretch between the two blocks compared to those of the other SPSB members (Fig. 1A). The phylogenetic relationship based on SPSB protein sequences shows that the Spsb genes split into Spsb3 and the other Spsb genes cluster, consistent with the topology of the neighbor-joining tree based on vertebrate Spsb genes (Kleiber and Singh, 2009). DjSPSB and SPSB from D. ryukyuensis are clustered together and formed a monophyletic group; this indicated that both underwent independent duplication and were more distinct compared to the other Spsb genes (except Spsb3). Furthermore, the evolutionary relationship between DjSpsb and Spsb3 was more distant than Spsb1, Spsb2 and Spsb4 (Fig. 2), which was consistent with the results of amino acid sequence homology analysis. Surprisingly, DjSpsb and Spsb from D. ryukyuensis are not clustered with any of the four SPSB members (Fig. 2), which is possible that planarians have a single Spsb gene similar to the other invertebrates (Styhler et al., 2002; Zhang et al., 2011). Spsb genes are found in many animals and are widely expressed in many tissues, such as the brain, lung, thymus and heart (Xing et al., 2006; Masters et al., 2005), but little is known about the function of the Spsb genes in these tissues. Here, temporal and spatial expression patterns of DjSpsb were examined to gain insight into its function in planarians. Whether in sexually mature or immature intact worms, DjSpsb was strongly expressed in the head and other nervous tissues in the body; however, this result was at odds with that of previous study in planarians D. ryukyuensis, which reported that Spsb was only expressed in the yolk gland rather than the head (Hasey et al., 2007). For regenerative fragments, the DjSpsb was expressed in the blastema during head regeneration. Moreover, the highest expression levels of DjSpsb are at

U

289 290

T

E

Fig. 4. In situ hybridization on sagittal sections of DjSpsb in sexually mature planarians. A: DjSpsb is expressed in the head. B: DjSpsb is expressed in the testes and nerve tissues. C: Higher magnification view of large boxed region of (B) showing the testes and guts. D: Higher magnification view of small boxed region of B showing nerve tissues. E: No expression of DjSpsb in the ovary. F: Higher magnification view of (E). G: DjSpsb is weakly expressed in the yolk glands. Abbreviation: g: gut; t: testis; nt: nerve tissues; o: ovary; yg: yolk gland; dm: dorsoventral muscle. In all images, anterior is at the top. Scale bars: 100 μm in panels A–C and E–G. 50 μm in panel D.

stages consistent with the timing of CNS functional recovery (Inoue et al., 2007; Agata and Umesono, 2008). In zebrafish and mouse, the expressions of Spsb1 gene are also observed in the brain and mSpsb1 may play a role in HGF signaling during brain development (Li et al., 2009; Kleiber and Singh, 2009). At the same time, SOCS family genes, especially Socs-2, are also expressed in the developing nervous system and play an important role during neuronal development, possibly by regulation of IGF-1 signaling (Polizzotto et al., 2000). Based on this, we supposed that DjSpsb was involved in CNS development during planarian head regeneration; in particular, DjSpsb might serve as an important role of CNS functional recovery during the latter stages of head regeneration. There are more than one substrate recognition sites for the SPRY domain, in mammals, SPSB1, SPSB2 and SPSB4 all interact with human prostate apoptosis response protein-4 (hPar-4), which sensitizes the cells to apoptotic stimuli (Masters et al., 2006), and recent crystal structural studies have confirmed the Key hPar-4 binding residues at SPRY domains of SPSB1, SPSB2 and SPSB4 (Filippakopoulos et al., 2010). In this study, sequence alignment analysis has shown that the B30.2/SPRY domain of DjSPSB is well conserved and includes the 7 corresponding residues essential for hPar-4 binding (Fig. 1A). When the worms are cut, the cell death, proliferation, differentiation and migration of the injury sites are governed by a tightly controlled series of gene expression events (Petersen and Reddien, 2009); the wound can induce apoptosis at approximately 1 to 4 h post-amputation and increase the rate of cell death that is localized to wound sites (Pellettieri et al., 2010); the regeneration process is actually a balance between stem cell proliferation and old cell death (Tu et al., 2012). It is therefore tempting to speculate that DjSPSB might interact with some proteins, similar to hPar-4, to induce apoptosis during planarian head regeneration. In Drosophila, gustavus (Spsb homologue) is mainly expressed in the ovary and interacts with Vasa and is necessary for the specification of germ cells (Styhler et al., 2002). In addition, Spsb genes are found in

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354

7

E

D

P

R O

O

F

Z. Dong et al. / Gene xxx (2015) xxx–xxx

E

C

T

Fig. 5. RT-PCR analysis of DjSpsb during head regeneration and in response to external stressors. A: The expression pattern of DjSpsb during head regeneration: DjSpsb displays a gradual increase during the head regeneration and reaches the peak on day 5 after amputation. B: The expression pattern of DjSpsb in response to thermal stress, DjSpsb shows significant increase at 30 °C culture condition compared with the control. C: The expression pattern of DjSpsb in response to ethanol stress, DjSpsb displays a significant up-regulation in a dose-dependent manner. D: The expression pattern of DjSpsb in response to ionic liquid stress, DjSpsb levels decline when worms are exposed to three concentrations of [C8mim] Br and decrease sharply at a concentration of 62.4 mg/L. β-actin is used as the internal control. The worms were exposed to different stressors for 3 days. Vertical bars represent the mean ± SD (N = 3). Asterisks indicate statistical differences (*P b 0.05; **P b 0.01).

355 356

U

N C O

R

R

Macrobrachium nipponense, D. ryukyuensis, zebrafish, mouse and so forth, which are also expressed in the gonads, and similarly proposed 357 to regulate germ cell physiology (Li et al., 2009; Zhang et al., 2011; 358 Xing et al., 2006; Masters et al., 2005). Here, DjSpsb is expressed in the 359 testes and yolk gland cells, in contrast with that of the other species; 360 DjSpsb expression was not detectable in the ovary. At present, we 361 were not certain of the mechanism of DjSpsb in planarian gonads and 362 unable to demonstrate a relationship between the reproductive system 363 and the nervous system; these are interesting topics and require further 364 experimental validation. 365 SOCS proteins are well-known mediators of extracellular stress sig366 nals and previous studies demonstrate that Spsb1 is up-regulated in re367 sponse to ethanol exposure in the mouse brain (Kleiber and Singh, 368 2009). We were interested in determining whether DjSpsb responds 369 to external stressors. In general, freshwater planarians inhabit unpollut370 ed springs and streams, and as aquatic animals, they are highly sensitive 371 to water quality and temperature, especially environmental toxicants 372 (Nano et al., 2002). So, they often have been used as test organisms in 373 water environmental toxicology (Knakievicz and Ferreira, 2008). In 374 this study, the expression levels of DjSpsb were up-regulated and 375 displayed significant response to thermal stress and ethanol exposure, 376 which coincides with the behavior of Spsb1 in mouse (Kleiber and 377 Singh, 2009). These results suggest that the biochemical function of 378 DjSpsb is conserved in planarians, similar to Spsb1 in the mouse, which 379 Spsb genes probably play important roles in response to external 380 stressors in a variety of organisms. But, when the worms were exposed 381 to ionic liquids ([C8mim] Br), which are less toxic and have been widely 382 Q10 applied in all areas of chemical industry (Keskin et al., 2007), it is appar383 ent that high concentrations of [C8mim] Br inhibit DjSpsb expression.

This result is unexpected in lieu of the results obtained above and the effect of the external stressors remains to be determined in planarians. Taken together, these results imply that the DjSpsb gene may play an important role in response to stress and respond to diverse regulatory cues to different external stressors.

384 385

5. Conclusions

389

DjSpsb cDNA from planarian D. japonica was successfully cloned and its expression pattern in intact and regenerating worms was analyzed. Collectively, the present results indicated that the DjSpsb protein might regulate multiple target proteins and perform multiple physiological functions in the planarians, especially, it may play a critical role in CNS development; moreover, it is also involved in the development of germ cells and stress response. Although a systematic analysis of the function of DjSpsb is still required, the data offered within this study are presented to enhance understanding of features of the Spsb gene family and offer some insight into what roles this gene may have in invertebrate physiology. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.03.032.

390

Acknowledgments

403

This work was supported by grants from the National Natural Science Foundation of China (Nos. 31471965, 31170357, 30870368, 30670247, 30170119), the Ph.D. Programs Foundation of the Ministry of Education of China (No. 200804760003), the Outstanding Young Scientists Foundation of Henan Province (No. 0312001100), the Innovation

404 405

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

386 387 388

391 392 393 394 395 396 397 398 399 400 401 402

406 407 408

F

Abascal, F., Zardoya, R., Posada, D., 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104–2105. Agata, K., Umesono, Y., 2008. Brain regeneration from pluripotent stem cells in planarian. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 2071–2078. Agata, K., Watanabe, K., 1999. Molecular and cellular aspects of planarian regeneration. Semin. Cell Dev. Biol. 10, 377–383. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., 1997. Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 4, 29. Dong, Z., Yuwen, Y., Wang, Q., Chen, G., Liu, D., 2011. Expression analysis of Djsix-1 gene during regeneration of planarian eyespots. Mol. Biol. Rep. 38, 3977–3982. Dong, Z., Yuwen, Y., Wang, Q., Chen, G., Liu, D., 2012. Eight genes expression patterns during visual system regeneration in Dugesia japonica. Gene Expr. Patterns 12, 1–6. Filippakopoulos, P., Low, A., Sharpe, T.D., Uppenberg, J., Yao, S., 2010. Structural basis for Par-4 recognition by the SPRY domain-and SOCS box-containing proteins SPSB1, SPSB2, and SPSB4. J. Mol. Biol. 401, 389–402. Hasey, S., Kashiwagi, E., Kobayashi, K., Hoshi, M., Matsumoto, M., 2007. Characterization of novel genes expressed specifically in the sexual organs of the planarian Dugesia ryukyuensis. Int. J. Dev. Biol. 51, 345–349. Hilton, D.J., Richardson, R.T., Alexander, W.S., Viney, E.M., Willson, T.A., 1998. Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc. Natl. Acad. Sci. U. S. A. 95, 114–119. Iglesias, M., Castillo, M.A., Aboobaker, A.A., Saló, E., 2011. Early planarian brain regeneration is independent of blastema polarity mediated by the Wnt/β-catenin pathway. Dev. Biol. 358, 68–78. Inoue, T., Hayashi, T., Takechi, K., Agata, K., 2007. Clathrin-mediated endocytic signals are required for the regeneration of, as well as homeostasis in, the planarian CNS. Development 134, 1679–1689. James, L.C., Keeble, A.H., Khan, Z., Rhodes, D.A., Trowsdale, J., 2007. Structural basis for PRYSPRY-mediated tripartite motif (TRIM) protein function. Proc. Natl. Acad. Sci. U. S. A. 104, 6200–6205. Keskin, S., Kayrak-Talay, D., Akman, U., Hortaçsu, Ö., 2007. A review of ionic liquids towards supercritical fluid applications. J. Supercrit. Fluids 43, 150–180. Kile, B.T., Schulman, B.A., Alexander, W.S., Nicola, N.A., Martin, H.M., 2002. The SOCS box: a tale of destruction and degradation. Trends Biochem. Sci. 27, 235–241. Kleiber, M.L., Singh, S.M., 2009. Divergence of the vertebrate sp1A/ryanodine receptor domain and SOCS box-containing (Spsb) gene family and its expression and regulation within the mouse brain. Genomics 93, 358–366. Knakievicz, T., Ferreira, H.B., 2008. Evaluation of copper effects upon Girardia tigrina freshwater planarians based on a set of biomarkers. Chemosphere 71, 419–428. Lapan, S.W., Reddien, P.W., 2012. Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep. 2, 294–307.

O

415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458

R O

References

P

414

C

E

R

R

411 412

Letunic, I., Copley, R.R., Schmidt, S., Ciccarelli, F.D., Doerks, T., 2004. SMART 4.0: towards genomic data integration. Nucleic Acids Res. 32, 142–144. Li, J., Zhou, Y., Zhen, Y., Xu, Y., Cheng, P., 2009. Cloning and characterization of the SSB-1 and SSB-4 genes expressed in zebrafish gonads. Biochem. Genet. 47, 179–190. Masters, S.L., Palmer, K.R., Stevenson, W.S., Metcalf, D., Viney, E.M., 2005. Genetic deletion of murine SPRY domain-containing SOCS box protein 2 (SSB-2) results in very mild trombocytopenia. Mol. Cell. Biol. 25, 5639–5647. Masters, S.L., Yao, S., Willson, T.A., Zhang, J.G., Palmer, K.R., 2006. The SPRY domain of SSB2 adopts a novel fold that presents conserved Par-4-binding residues. Nat. Struct. Mol. Biol. 13, 77–84. Nakazawa, M., Cebria, F., Mineta, K., Ikeo, K., Agata, K., 2003. Search for the evolutionary origin of a brain: planarian brain characterized by microarray. Mol. Biol. Evol. 20, 784–791. Nano, G.M., Binello, A., Bianco, M.A., Ugazio, G., Burdino, S., 2002. In vitro tests to evaluate potential biological activity in natural substances. Fitoterapia 73, 140–146. Nishimura, K., Kitamura, Y., Taniguchi, T., Agata, K., 2010. Analysis of motor function modulated by cholinergic neurons in planarian Dugesia japonica. Neuroscience 168, 18–30. Pearson, B.J., Eisenhoffer, G.T., Gurley, K.A., Rink, J.C., Miller, D.E., 2009. Formaldehydebased whole-mount in situ hybridization method for planarians. Dev. Dyn. 238, 443–450. Pellettieri, J., Fitzgerald, P., Watanabe, S., Mancuso, J., Green, D.R., 2010. Cell death and tissue remodeling in planarian regeneration. Dev. Biol. 338, 76–85. Perfetto, L., Gherardini, P.F., Davey, N.E., Diella, F., Citterich, M.H., 2013. Exploring the diversity of SPRY/B30.2-mediated interactions. Trends Biochem. Sci. 38, 38–46. Petersen, C.P., Reddien, P.W., 2009. A wound-induced Wnt expression program controls planarian regeneration polarity. Proc. Natl. Acad. Sci. U. S. A. 106, 17061–17066. Polizzotto, M.N., Bartlett, P.F., Turnley, A.M., 2000. Expression of “Suppressor of Cytokine Signalling” (SOCS) genes in the developing and adult mouse nervous system. J. Comp. Neurol. 423, 348–358. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. U. S. A. 95, 5857–5864. Styhler, S., Nakamura, A., Lasko, P., 2002. VASA localization requires the SPRY-domain and SOCS-box containing protein, GUSTAVUS. Dev. Cell 3, 865–876. Tu, K.C., Pearson, B.J., Alvarado, A.S., 2012. TORC1 is required to balance cell proliferation and cell death in planarians. Dev. Biol. 365, 458–469. Umesono, Y., Agata, K., 2009. Evolution and regeneration of the planarian central nervous system. Dev. Growth Differ. 51, 185–195. Wang, D., Li, Z., Messinget, E.M., Wu, G., 2005. The SPRY domain-containing SOCS box protein1 (SSB-1) interacts with MET and enhances the hepatocyte growth factor-induced Erk-Elk-1-serum response element pathway. J. Biol. Chem. 280, 16393–16401. Woo, J.S., Suh, H.Y., Park, S.Y., Oh, B.H., 2006. Structural basis for protein recognition by B30.2/SPRY domains. Mol. Cell 24, 967–976. Xing, Y., Gosden, R., Lasko, P., Clarke, H., 2006. Murine homologs of the Drosophila gustavus gene are expressed in ovarian granulosa cells. Reproduction 131, 905–915. Zdobnov, E.M., Apweiler, R., 2001. InterProScan—an integration platform for the signature-recognition methods in InterPro. Bioinformatics 17, 847–848. Zhang, F., Chen, L., Qin, J., Zhao, W., Wu, P., 2011. CDNA cloning and expression analysis of Gustavus gene in the oriental river prawn Macrobrachium nipponense. PLoS One 6 (2), e17170.

T

413

Foundation of Henan Province (No. 2005126), the Basic and Advanced Technique Research Program of Technology Department of Henan Province (Nos. 122300410142, 142300410160) and the Doctoral Scientific Research Start-up Foundation of Henan Normal University (No. 521).

D

409 410

Z. Dong et al. / Gene xxx (2015) xxx–xxx

E

8

U

N

C

O

513

Please cite this article as: Dong, Z., et al., Identification and expression analysis of a Spsb gene in planarian Dugesia japonica, Gene (2015), http:// dx.doi.org/10.1016/j.gene.2015.03.032

459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512