- Email: [email protected]
Identification and expression analysis of the gene associated with geosmin production in Lyngbya kuetzingii UTEX 1547 (cyanobacteria)
Harmful Algae 39 (2014) 127–133
Contents lists available at ScienceDirect
Harmful Algae journal homepage: www.elsevier.com/locate/hal
Identification and expression analysis of the gene associated with geosmin production in Lyngbya kuetzingii UTEX 1547 (cyanobacteria) Ting Zhang a,b,*, Deliang Li b, Guiping Wang b, Lirong Song c, Lin Li c a
Center for Environment and Water Resources, College of Chemistry and Chemical Engineering, Central South University, Changsha 410083, China College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China c State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 25 October 2013 Received in revised form 10 July 2014 Accepted 10 July 2014 Available online
Cyanobacteria are the major producers of geosmin in natural waters. To identify a gene involved in geosmin biosynthesis in cyanobacteria, the polymerase chain reaction (PCR) was used to amplify a 2298bp open reading frame (ORF) from the geosmin-producing cyanobacterium Lyngbya kuetzingii UTEX 1547. This ORF encoded a protein of 765 amino acids. Alignment of the deduced amino acid sequence demonstrated that geoL had high similarity to the corresponding genes of Oscillatoria sp. PCC 6506 (100% identity), Calothrix sp. PCC 7507 (89%), Anabaena ucrainica CHAB 1432 (88%), A. ucrainica CHAB 2155 (87%), Nostoc punctiforme PCC 73102 (87%), Phormidium sp. P2r (84%) and Cylindrospermum stagnale PCC 7417 (83%), and modest similarity to myxobacteria (61–73%). It also indicated geoL with low similarity to the corresponding genes of actinomycetes (<60%). The encoded protein GEOL was estimated to have two geosmin synthase domains, and each contained two strictly conserved Mg2+-binding motifs (aspartaterich motif and NSE triad). The geoL gene was shown to be responsible for geosmin biosynthesis in L. kuetzingii UTEX 1547. Then, geoL had been cloned into pET21a(+) vector and expressed in Escherichia coli BL21(DE3) with the isopropyl-b-D-thiogalactoside (IPTG) induction. The recombinant GEOL protein was purified and exhibited a single band (MW 90 kDa) on the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), which was consistent with the predicted molecular weight (MW) of 87,046 Da. In conclusion, this study has confirmed that geosmin synthase gene and its expression product can be identified and characterized from cyanobacteria, which will help understand the fundamental biological mechanism of geosmin biosynthesis in cyanobacteria. ß 2014 Elsevier B.V. All rights reserved.
Keywords: Geosmin synthase gene Geosmin Biosynthesis Lyngbya kuetzingii
1. Introduction Cyanobacteria and associated odorous compounds are of increasing environmental concern worldwide. One of the most common odorous compounds is described mostly as an earthy and musty odor, which is largely as the result of the production of the compound geosmin (trans-1,10-dimethyl-trans-9-decalol) and/or 2-methylisoborneol (2-MIB) (Saadoun et al., 2001). Both geosmin and 2-MIB with very low threshold odor values reported from 1.3 to 4.0 ng L1 and 6.3 to 15.0 ng L1, respectively (Watson, 2004; Wert et al., 2014), are responsible for decreasing the quality of drinking water (Smith et al., 2002) and aquaculture production (Smith et al., 2008). These negative effects may cause significant economic and public health concerns, despite neither geosmin nor
* Corresponding author. Tel.: +86 731 88876961; fax: +86 731 88876960. E-mail address: [email protected] (T. Zhang). http://dx.doi.org/10.1016/j.hal.2014.07.005 1568-9883/ß 2014 Elsevier B.V. All rights reserved.
2-MIB having any known adverse biological and pathological effects (Giglio et al., 2011a). Geosmin is a degraded sesquiterpenoid alcohol (Bentley and Meganathan, 1981; Dickschat et al., 2005). Significant advances have been made in the fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in the actinomycete strains Streptomyces coelicolor A3(2) (Jiang et al., 2006, 2007; He and Cane, 2004; Cane and Watt, 2003; Gust et al., 2003), Streptomyces avermitilis (Cane et al., 2006) and Streptomyces peucetius (Ghimire et al., 2008). The gene essential for geosmin biosynthesis was simultaneously detected for the first time by Gust et al. (2003) and Cane and Watt (2003) in S. coelicolor A3(2). Several years later, Cane’s group made an unexpected discovery that the geosmin synthase of S. coelicolor A3(2) could catalyze the entire biosynthesis of geosmin from farnesyl diphosphate (FPP) without requirement for any additional enzymes or redox cofactors (Jiang et al., 2006, 2007). Based on the above results, a real-time PCR method was established for the
128
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
quantification of geosmin-producing Streptomyces (Auffret et al., 2011; Lylloff et al., 2012). However, the biosynthesis of geosmin by cyanobacteria has received much attention recently. Nucleic sequences related to geosmin synthase-encoding gene were not detected in the geosmin-producing cyanobacterium Phormidium sp. until 2007, but it was not explicitly demonstrated that these nucleic sequences were functionally responsible for the biosynthesis of geosmin (Ludwig et al., 2007). In the model cyanobacterium Nostoc punctiforme PCC 73102, the putative geosmin synthase was homologous to fusion-type sesquiterpene synthase form Streptomyces spp. (Agger et al., 2008), and it was the single enzyme utilized to catalyze the cyclization of FPP to geosmin (Giglio et al., 2008). Moreover, Giglio et al. (2011b) further examined the growth conditions affecting the expression of geosmin synthase gene in Anabaena circinalis AWQC318. With regard to Anabaena, quantitative PCR methods were established for the quantification of geosmin-producing Anabaena sp. (Su et al., 2013), A. circinalis (Tsao et al., 2014) and Anabaena lemmermannii (Kutovaya and Watson, 2014) in freshwater systems. Cyanobacteria are considered to be the major sources of geosmin, which is found in many natural water bodies (Ju¨ttner and Watson, 2007). About 50 species of cyanobacteria have been directly confirmed as geosmin-producers, and more than 20 species of these known producers are benthic without the isolates from sediment (Zhang, 2008). Lyngbya kuetzingii UTEX 1547 is a benthic freshwater cyanobacterium with relatively high geosmin productivity (geosmin concentration divided by biomass), and our previous study demonstrated the physiological characteristics of both growth and geosmin production (Zhang et al., 2009). The study showed that the dissolved geosmin of L. kuetzingii UTEX 1547 was released into the environment along with its growth phases. The amount of release reached the maximum in the stationary phase under normal growth conditions, even though the great majority of dissolved geosmin was still retained in cells during its growth. But little is known about the biochemical mechanism of geosmin synthesis in L. kuetzingii UTEX 1547. Although the benthic geosmin-producer is not in the water column and cannot rapidly affect a water body, it could contribute a great deal of geosmin to the water–sediment interface and cause harmful effects. Therefore, in order to further investigate into the correlation between geosmin production and geosmin synthase gene, we have identified geoL associated with geosmin production in L. kuetzingii UTEX 1547, and successfully induced this gene expressed in vitro. The objective of this study was to provide further information for our fundamental understanding of geosmin production in cyanobacteria, especially in benthic producers.
2. Materials and methods 2.1. Strain and culture conditions Lyngbya kuetzingii UTEX 1547, a known geosmin producer (Zhang et al., 2009), was obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology (FACHBCollection), Chinese Academy of Sciences. This strain was cultured in BG-11 medium at 25 8C under an illumination of 20 mmol photons m2 s1 with a cycled photoperiod of 12 h light:12 h dark. 2.2. DNA extraction Before DNA extraction, the culture was subcultured on starchcasein agar for the detection of possible contaminating geosminproducing actinomycetes. The subculture was negative for actinomycetes. Genomic DNA was extracted using a QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions, with the addition of overnight proteinase K incubation at 56 8C.
2.3. Gene cloning The oligonucleotides used in this study are shown in Table 1. For amplification of putative geosmin synthase gene fragments from genomic DNA, the PCR mastermix consisted of 25 mM MgCl2, 10 PCR buffer, 10 mM dNTP, 10 mM each of forward primer and reverse primer (180F and 718R, 262F and 983R), 2.5 U of Taq DNA polymerase (Tiangen) and 1 ml of extracted genomic DNA. The reaction was run on a Applied Biosystems 2720 thermal cycler (Singapore) with an initial denaturation step of 94 8C for 5 min, followed by 35 cycles of 94 8C for 30 s, 52 8C for 30 s, and 72 8C for 60 s, with a final extension step of 3 min at 72 8C. Samples were then run on a 1% agarose gel with ethidium bromide (EB) for 35 min at 90 V, and bands were visualized using a Syngene InGenius LHR Gel Documentation System (United Kingdom). For selected sample bands of expected size (538 bp and 721 bp), DNA was extracted using a QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. The purified PCR product was then cloned into pMD18-T Vector (TaKaRa, Code No.: D101A) according to the manufacturer’s instrucions, and the ligation mixture was subsequently used to transform competent cells of Escherichia coli DH5a under standard conditions. The resulting transformants were grown overnight at 37 8C on LB-agar plates containing ampicillin (100 mg ml1). Twelve individual colonies were isolated from LB-ampicillin (100 mg ml1) medium after overnight growth at 37 8C, and the positive colonies were screened by PCR. Three optimal positive colonies were selected for sequenced by Sangon Biotechnology (Shanghai) Company Limited (China). For amplification of the 50 and 30 ends of geoL, the Genome Walking Kit (TaKaRa, Code No.: D316) was used according to the manufacturer’s instructions. Specific primers 5SP1, 5SP2 and 5SP3 were used to amplify the 50 end of geoL. Specific primers 3SP1, 3SP2 and 3SP3 were first used, and then specific primers 3SP10 , 3SP20 and 3SP30 were used to amplify the 30 end of geoL for the second time. The purified PCR products were directly sequenced by Sangon Biotechnology (Shanghai) Company Limited (China) with 5SP3, 3SP3 and 3SP30 for primer, respectively. The full length natural geoL gene was amplified with primers geoL_F and geoL_R, inserting NdeI and XhoI restriction sites (underlined) for the geoL_F and geoL_R primers, respectively. The full length gene fragment was PCR-amplified using KOD Plus DNA polymerase (Toyobo) as described by the manufacturer. Amplification was performed in a 50 ml reaction with 1 ml of extracted genomic DNA, 1.0 U of KOD Plus DNA polymerase, 10 KOD PCR buffer, 25 mM MgSO4, 2 mM KOD dNTPs and 10 mM each primer. Cycling parameters were denaturation at 94 8C for 5 min, then 28 cycles consisting of denaturation at 94 8C for 20 s, annealing at Table 1 Oligonucleotides used in this study. Primer
Sequence (50 ! 30 )
180F 718R 262F 983R 3SP1 3SP2 3SP3 3SP10 3SP20 3SP30 5SP1 5SP2 5SP3 geoL_F geoL_R
CGCCTTGCTTTGCTCGTATA GGTAGGAGAAGAGGTCGTTGC TTCTTCGACGATCACTTCC CCCTTGTTCATGTARCGGC GACACATTTGCCGATGGAGTTCACC ACCTCACCAACGAACTGCTCACCTC TCAAAGGACTTCAAGACTGGCAA GCTAAATCTAAGTGCGTGCTGGCT CCCAGCACTCTACGGGAATAAC GAAGACCTTTGGCTCGGATTTG TGGCGACCCGATTTTGGTTGAT CTGGATTGGTGGGTAAGGAAGG ATAAATGCGGGCAGTCGGTGGA TAAGAAGGAGATATACATATGATGCAGCCGTTTAAACTGC GGTGGTGGTGGTGCTCGAGTTTGCCCACAAAACGATCTG
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
129
55 8C for 20 s, and extension at 72 8C for 150 s, and a last elongation step of 10 min at 72 8C with a final hold at 4 8C until needed. The purified PCR product and the pET21a(+) vector (Novagen) were digested separately with NdeI and XhoI (Fermentas) before ligation with T4 DNA ligase (3:1 insert:vector, 37 8C, 20 min) and transformation of competent Escherichia coli DH5a cells. The positive colonies were identified by PCR and subsequently sequenced by Invitrogen Corporation (China) to confirm the sequence of the correct insert.
program of the NCBI web-server, and were aligned using the multiple sequence alignment program, ClustalX 1.83. Molecular similarity between geoL associated with geosmin production in Lyngbya kuetzingii UTEX 1547 and other previously reported geosmin synthase genes were determined using the MEGA 5.02 software program. Distance matrices were determined and used to elaborate dendrogram by the neighbor-joining method.
2.4. Expression of geosmin synthase
3.1. Identification of the gene associated with geosmin production in L. kuetzingii UTEX 1547
The purified pET21a(+) expression vector carrying geoL gene was then used to transform Escherichia coli BL21(DE3). Recombinant E. coli BL21(DE3) overnight culture was used to inoculate a 100 ml culture that was grown at 37 8C and 250 rpm until an optical density at 600 nm (OD600) of 0.5–0.6, and then induced by the addition of IPTG to a final concentration of 0.1 mM. After a further overnight induction at 16 8C, the cells were harvested by centrifugation (5000 rpm, 15 min, 4 8C) and resuspended in 20 ml of lysis buffer (20 mM PB, 300 mM NaCl, pH 7.4). The cells were disrupted by sonication on ice and the cell lysate was clarified by centrifugation (12,000 rpm, 20 min, 4 8C). The clarified protein extract was used to purify proteins by metal affinity chromatography. The soluble protein was loaded onto a chelating SFF (Ni) column (1 ml) that had been pre-equilibrated with 40 ml buffer A (20 mM PB, 300 mM NaCl, pH 7.4). The chelating SFF (Ni) column combined target protein was washed with buffer A and then eluted four times with a linear gradient of 20–500 mM imidazole in buffer B (20 mM PB, 300 mM NaCl, 500 mM imidazole, pH 7.4). The target protein was mainly in the elution buffer with 500 mM imidazole, and dialyzed overnight with the dialysis buffer (PBS, pH 7.4, 1 L) at 4 8C. The purified protein was determined by SDS-PAGE. The apparent molecular weight (Mr) of 90 kDa of the desired protein was very close to the theoretical MW of 87,046 Da. 2.5. Nucleotide sequence accession number The nucleotide sequence of geoL has been deposited in the NCBI nucleotide sequence database under accession number JX962775. 2.6. Analysis of DNA and protein sequences The obtained nucleotide sequence and homologous sequences were detected using a database search with the BLAST search
3. Results and discussion
A database search with cyc2 of Streptomyces coelicolor A3(2) indicated the presence of similar proteins in geosmin-producing cyanobacteria, such as Nostoc punctiforme PCC 73102 (YP_001866236) and Phormidium sp. P2r (ABU93239). To search for a similar gene in Lyngbya kuetzingii UTEX 1547, two pairs of degenerate primers (180F and 718R, 262F and 983R) were designed based on four highly conserved regions of sequences from the NCBI database. By PCR from total genomic DNA of L. kuetzingii UTEX 1547, two fragments (538 bp and 721 bp, which had a 434-bp overlap at their ends) were amplified as expected theoretically (Fig. 1A). Blastn searches in the GenBank database revealed that the two PCR products were similar to a number of known geosmin synthase genes, suggesting that the two fragments were parts of the gene encoding a geosmin synthase involved in geosmin biosynthesis of L. kuetzingii UTEX 1547. The 538-bp and 721-bp sequences were then assembled into an 825-bp sequence using the DNAMAN V6 software program. The nucleotide order of the 825-bp sequence was confirmed by PCR with the primers 180F and 983R (the expected fragment shown in Fig. 1B). To amplify the 50 and 30 ends of geoL, the genome walking strategy was successfully used on the basis of the 825-bp sequence. DNA bands of the expected size from agarose gels were excised, purified, sequenced and assembled. A single 2298-bp ORF from L. kuetzingii UTEX 1547 having a putative ATG start codon and TAA stop codon was revealed by both the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and the DNAMAN V6 software program. The 2298-bp ORF encoded an apparent protein of 765 amino acids. A Blastn homology search of this ORF (GenBank Accession JX962775) demonstrated that the predicted geoL was similar to N. punctiforme PCC 73102 NPUNMOD protein gene (FJ010203, 2156 bp, 85% identity and 73% positive matches) and Anabaena ucrainica CHAB 1432 geosmin synthesis operon (HQ404996, 2237 bp, 82% identity
Fig. 1. Agarose gel electrophoresis of PCR products for geoL of L. kuetzingii UTEX 1547. Note: (A) Lane M: Marker II (Tiangen), Lane 1: the 538-bp PCR product (primed by 180F and 718R), Lane 2: the 721-bp PCR product (primed by 262F and 983R); (B) Lane M: Marker II (Tiangen), Lane 1: the 825-bp PCR product (primed by 180F and 983R); (C) Lane M: DL2000 plus (SinoBio), Lane 1: the 2298-bp PCR product (primed by geoL_F and geoL_R).
130
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
and 76% positive matches) at the nucleotide sequence level. To confirm the expected nucleotide order of geoL within L. kuetzingii UTEX 1547, a confirmatory PCR was carried out using the genespecific primers (geoL_F and geoL_R), and a 2298-bp PCR fragment was obtained (Fig. 1C). Using the deduced 765-amino acid sequence from Lyngbya kuetzingii UTEX 1547 as a query, a number of putative geosmin synthase genes of prokaryotic origin were identified by a BLAST analysis from NCBI database. The BLAST search also showed that geoL had high similarity to the corresponding genes of Oscillatoria sp. PCC 6506 (100% identity), Calothrix sp. PCC 7507 (89%), Anabaena ucrainica CHAB 1432 (88%), A. ucrainica CHAB 2155 (87%), Nostoc punctiforme PCC 73102 (87%), Phormidium sp. P2r (84%) and Cylindrospermum stagnale PCC 7417 (83%), and modest similarity to myxobacteria (61–73%). It also indicated geoL with low similarity to the corresponding genes of actinomycetes (<60%). Subsequently, alignment of the amino acid sequences was analyzed by using ClustalX 1.83 program. Phylogenetic analysis of aligned sequences was done by the bootstrap method (bootstrap number, 1000; seed number, 111) of MEGA 5.02 software. Drawing of the phylogenetic tree was done by neighbor-joining method. The phylogenetic tree showing the relationship between geoL of L. kuetzingii UTEX 1547 and other selected known geosmin synthase genes was shown in Fig. 2. The results of phylogenetic analysis suggested that the geosmin synthase genes of cyanobacteria were more similar to myxobacteria than to actinomycetes. Therefore, the authors postulated that cyanobacteria might be similar to myxobacteria using the mevalonate (MVA) pathway as a major route to synthesize geosmin (Dickschat et al., 2005), although it has not been known which pathway cyanobacteria could use to synthesize FPP, MEP (2methylerythritol-4-phosphate), MVA or L-leucine pathway (Zhang et al., 2012).
Within the last 10 years, the genes associated with geosmin synthesis in Streptomyces and cyanobacteria have been elucidated. Geosmin synthase gene was first identified in Streptomyces in 2003 (Cane and Watt, 2003; Gust et al., 2003). Both of them confirmed that a single 726-amino acid protein in Streptomyces coelicolor A3(2), encoded by the 2181-bp SCO6073 gene (cyc2), catalyzed the C15 sesquiterpene precursor FPP to geosmin. However, the gene associated with geosmin production in cyanobacteria was first isolated from Nostoc punctiforme PCC 73102 in 2008 (Giglio et al., 2008). It was demonstrated that the 1893-bp npun02003620 gene could encode a NJ2 protein, which was similar to SCO6073 protein. According to the experimental data, geoL showing high similarity to npun02003620 of N. punctiforme PCC 73102 indicated that the 2298-bp geoL gene was responsible for geosmin synthesis in Lyngbya kuetzingii UTEX 1547. Additionally, the deduced amino acid sequence of geol was found to be identical to the germacradienol/germacrene D synthase of Oscillatoria sp. PCC 6506 (WP_007358458). Alignment of the partial sequence of the 16S rRNA gene also revealed that Oscillatoria sp. PCC 6506 (AY768397, 634 bp) had an identical nucleotide sequence with L. kuetzingii UTEX 1547 (GenBank Accession Number: KJ817358, 1291 bp, unpublished). The authors inferred that both L. kuetzingii UTEX 1547 and Oscillatoria sp. PCC 6506 may be the same cyanobacterial species with different taxonomic names. Geosmin synthase is a bifunctional cyclase. The N-terminal half of the cyclase catalyzes the cyclization of FPP to germacradienol, and the C-terminal half catalyzes the cyclization–fragmentation of germacradienol to geosmin (Jiang et al., 2007). Generally, typical bacterial cyclases contain an acid-rich motif and a downstream triad (NSE), and both of them coordinate Mg2+ (Komatsu et al., 2008; Daum et al., 2009). As shown in Fig. 3, the encoded protein (JX962775) was estimated to have two sesquiterpene cyclase
Fig. 2. Phylogenetic analysis of geosmin synthase homologs identified in completed bacterial sequences available in the NCBI database. Sequences were identified by BLAST using the deduced 765-amino acid sequence of Lyngbya geosmin synthase described in this study (bold and underlined). Phylogenetic analysis of aligned sequences was performed using the bootstrap method (bootstrap number: 1000; seed number: 111). Bootstrap values (%) were indicated at the nodes, and the scale bars represented 0.05 substitution/site. Phylogenetic tree branches were labeled with accession numbers followed by species names for each geosmin synthase sequence (the published sequences were referred to Giglio et al. (2008), Ludwig et al. (2007), Goldman et al. (2006), Li et al. (2011) and Ohnishi et al. (2008)).
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
131
Fig. 3. Alignment of the deduced amino acid sequence of GEOL with its homologs. Accession no.: JX962775 (Lyngbya kuetzingii UTEX 1547, obtained in this study), WP_007358458 (Oscillatoria sp. PCC 6506), AEA03338 (Anabaena ucrainica CHAB 1432), AEA03341 (A. ucrainica CHAB 2155), ABU93239 (Phormidium sp. P2r), YP_001866236 (Nostoc punctiforme PCC 73102), YP_007149161 (Cylindrospermum stagnale PCC 7417), YP_007066242 (Calothrix sp. PCC 7507). Shadow boxes indicate aspartate-rich regions of cyanobacterial geosmin synthases. Mg2+-binding sites are shown in bold with a shadow box (‘‘*’’ indicates exact sequence match, ‘‘:’’ indicates moderate sequence match, ‘‘.’’ indicates low sequence match).
domains, both of which contained two strictly conserved Mg2+binding motifs (aspartate-rich motif and NSE triad). The aspartaterich 90DDHFL motif and NSE triad 234NDIFSYQRE located near the N-terminal half of the encoded protein, while the aspartate-rich
471
DDYFP motif and NSE triad 615NDIFSYQKE located near the Cterminal half. Both of the two NSE triads were found at the usual 140-amino acids downstream of the two aspartate-rich motifs. In comparison with Lyngbya kuetzingii UTEX 1547, the aspartate-rich
132
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
motif in these known geosmin synthases shown in Fig. 3 was absolutely conserved, while both of the two NSE triads appeared moderate sequence match at the third amino acid residue (236I ! L and 617I ! V, respectively). However, in several geosmin synthases of the Streptomyces species, a DDYYP variant was found in the aspartate-rich motif of the C-terminal domain (Jiang et al., 2007; Cane et al., 2006; Cane and Watt, 2003). Similarly, the NSE triad of residues (NDVFSYQKE) had a slight C-terminal acid variant in Streptomyces. These variants occurring between Streptomyces and cyanobacteria may be a reason for forming distinct clusters during examining the phylogeny of geosmin synthases (Fig. 2). To our knowledge, no reliable methods have been developed to distinguish between the contributions of cyanobacteria and actinomycetes (or other potential producers) to geosmin in surface water. It is thus necessary to develop a sensitive and useful tool to correctly identify the corresponding microorganisms and their contributions to geosmin production in waters. According to the differences of both the aspartate-rich motif and NSE triad between cyanobacteria and Streptomyces, using the specific molecular probes to develop a PCR-based screening procedure might be a good choice to evaluate the geosmin-producers. 3.2. Expression analysis of geoL To determine protein expression, the 2298-bp geoL gene was amplified by PCR with primers geoL_F and geoL_R (inserting NdeI and XhoI restriction sites) from genomic DNA of Lyngbya kuetzingii UTEX 1547, and ligated into the pET21a(+) expression vector. The derived construct, pET21a(+)-geoL, was transformed into Escherichia coli BL21(DE3). An induction of the transformed bacteria with IPTG 0.1 mM (final concentration) at 16 8C for overnight provided high-level expression of GEOL protein in vitro. As expected, after expression analysis by SDS-PAGE, one protein of approximately 90 kDa was observed in the supernatant of cell lysate (Fig. 4). The expressed soluble GEOL protein, carrying an N-terminal His6-tag, was purified by Ni-NTA affinity chromatography under experimental procedures. The results from SDS-PAGE verified the successful purification, since only one clear band with molecular weight about 90 kDa was observed as expected, corresponding to the predicted 87.046-kDa MW (Fig. 5). In this study, geoL from Lyngbya kuetzingii UTEX 1547 was cloned into pET21a(+) vector and successfully expressed in Escherichia coli BL21(DE3) cells. The experimental data showed
Fig. 5. SDS-PAGE of soluble GEOL protein purified by Ni-NTA affinity chromatography. Lane M shows the molecular weight marker. Lane A shows the clarified protein extract. Lane B shows the protein sample after flow-through with buffer A (20 mM PB, 300 mM NaCl, pH 7.4). Lane C shows the protein sample after elution by 20 mM imidazole (pH 7.4). Lane D shows the protein sample after elution by 50 mM imidazole (pH 7.4). Lane E shows the protein sample after elution by 100 mM imidazole (pH 7.4). Lane F shows the protein sample after elution by 500 mM imidazole (pH 7.4). Lane G shows the supernatant after dialysis (arrowhead). Lane H shows the precipitation after dialysis.
that E. coli BL21(DE3) could successfully be used as an expression system for generating biologically functional GEOL protein. The monitoring of experimental protocol to optimize protein expression was made by SDS-PAGE. The factors including the IPTG concentration, incubation time, temperature, and imidazole concentration in the lysis, wash and elution buffer were optimized for recombinant GEOL protein. However, although the recombinant GEOL protein was expressed in a prokaryotic system to obtain large-scale protein production, the amount of soluble GEOL protein was much less than expected. Moreover, the protein stability was reduced after stored at 4 8C for two days, which posed a challenge to GEOL generation. Future studies will focus on the development of a suitable strategy to improve the production and stability of the GEOL protein.
4. Conclusions This study clearly demonstrated that the 2298-bp geoL gene was responsible for geosmin synthesis in Lyngbya kuetzingii UTEX 1547, which was confirmed by PCR amplification and heterologous expression in Escherichia coli BL21(DE3). The 2298-bp ORF encoded a protein of 765 amino acids. Alignment of the deduced amino acid sequences indicated that geoL (JX962775) had high similarity to the corresponding genes of cyanobacteria (>83% identity), modest similarity to myxobacteria (61–73%), and low similarity to actinomycetes (<60%). The encoded protein was estimated to have two geosmin synthase domains the same as other typical bacterial cyclases, and each contained two strictly conserved Mg2+binding motifs (the aspartate-rich 90DDHFL motif and NSE triad 234 NDIFSYQRE near the N-terminal, while the aspartate-rich 471 DDYFP motif and NSE triad 615NDIFSYQKE near the C-terminal). Additionally, the soluble GEOL protein was heterologously expressed with IPTG induction. The purified protein exhibited a single band (MW 90 kDa) on SDS-PAGE, which was consistent with the predicted MW of 87,046 Da. Acknowledgements
Fig. 4. Analysis of GEOL protein expression by SDS-PAGE. Lane A shows the crude of E. coli pET21a(+)-geoL without induction. Lane B shows the crude of E. coli pET21a(+)-geoL with IPTG induction, and Lanes B1–B3 show parallel experiments in triplicate. Lane C shows the supernatant of cell lysate with IPTG induction (arrowhead). Lane D shows the precipitation of cell lysate with IPTG induction. Lane M shows the molecular weight marker.
This study was supported by the National Natural Science Foundation of China (Grant Nos. 31000183 and 31100282). The authors would like to thank Prof. Zhaoguang Yang and Xiaowan Li of Central South University for their valuable suggestions on the manuscript.[SS]
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
References Agger, S.A., Lopez-Gallego, F., Hoye, T.R., Schmidt-Dannert, C., 2008. Identification of sesquiterpene synthases from Nostoc punctiforme PCC 73102 and Nostoc sp. Strain PCC 7120. J. Bacteriol. 190 (18), 6084–6096. Auffret, M., Pilote, A., Proulx, ?., Proulx, D., Vandenberg, G., Villemur, R., 2011. Establishment of a real-time PCR method for quantification of geosmin-producing Streptomyces spp. in recirculating aquaculture systems. Water Res. 45 (20), 6753–6762. Bentley, R., Meganathan, R., 1981. Geosmin and methylisoborneol biosynthesis in Streptomycetes. Evidence for an isoprenoid pathway and its absence in nondifferentiating isolates. FEBS Lett. 125 (2), 220–222. ¯ mura, S., Ikeda, H., 2006. Geosmin biosynthesis Cane, D.E., He, X.F., Kobayashi, S.J., O in Streptomyces avermitillis. Molecular cloning, expression, and mechanistic study of the germacradienol/geosmin synthase. J. Antibiot. 59 (8), 471–479. Cane, D.E., Watt, R.M., 2003. Expression and mechanistic analysis of a germacradienol synthase from Streptomyces coelicolor implicated in geosmin biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 100 (4), 1547–1551. Daum, M., Herrmann, S., Wilkinson, B., Bechthold, A., 2009. Genes and enzymes involved in bacterial isoprenoid biosynthesis. Curr. Opin. Chem. Biol. 13 (2), 180–188. Dickschat, J.S., Bode, H.B., Mahmud, T., Mu¨ller, R., Schulz, S., 2005. A novel type of geosmin biosynthesis in myxobacteria. J. Org. Chem. 70 (13), 5174–5182. Ghimire, G.P., Oh, T.J., Lee, H.C., Kim, B.G., Sohng, J.K., 2008. Cloning and functional characterization of the germacradienol synthase (spterp13) from Streptomyces peucetius ATCC 27952. J. Microbiol. Biotechnol. 18 (7), 1216–1220. Giglio, S., Chou, W.K.W., Ikeda, H., Cane, D.E., Monis, P.T., 2011a. Biosynthesis of 2methylsioborneol in cyanobacteria. Environ. Sci. Technol. 45 (3), 992–998. Giglio, S., Jiang, J.Y., Saint, C.P., Cane, D.E., Monis, P.T., 2008. Isolation and characterization of the gene associated with geosmin production in cyanobacteria. Environ. Sci. Technol. 42 (21), 8027–8032. Giglio, S., Saint, C.P., Monis, P.T., 2011b. Expression of the geosmin synthase gene in the cyanobacterium Anabaena circinalis AWQC318. J. Phycol. 47 (6), 1338–1343. Goldman, B.S., Nierman, W.C., Kaiser, D., Slater, S.C., Durkin, A.S., Eisen, J.A., Ronning, C.M., Barbazuk, W.B., Blanchard, M., Field, C., Halling, C., Hinkle, G., Iartchuk, O., Kim, H.S., Mackenzie, C., Madupu, R., Miller, N., Shvartsbeyn, A., Sullivan, S.A., Vaudin, M., Wiegand, R., Kaplan, H.B., 2006. Evolution of sensory complexity recorded in a myxobacterial genome. Proc. Natl. Acad. Sci. U.S.A. 103 (41), 15200–15205. Gust, B., Challis, G.L., Fowler, K., Kieser, T., Chater, K.F., 2003. PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. U.S.A. 100 (4), 1541– 1546. He, X.F., Cane, D.E., 2004. Mechanism and stereochemistry of the germacradienol/ germacrene D synthase of Streptomyces coelicolor A3(2). J. Am. Chem. Soc. 126 (9), 2678–2679. Jiang, J.Y., He, X.F., Cane, D.E., 2006. Geosmin biosynthesis. Streptomyces coelicolor germacradienol/germacrene D synthase converts farnesyl diphosphate to geosmin. J. Am. Chem. Soc. 128 (25), 8128–8129. Jiang, J.Y., He, X.F., Cane, D.E., 2007. Biosynthesis of the earthy odorant geosmin by a bifunctional Streptomyces coelicolor enzyme. Nat. Chem. Biol. 3 (11), 711–715.
133
Ju¨ttner, F., Watson, S.B., 2007. Biochemical and ecological control of geosmin and 2methylisoborneol in source waters. Appl. Environ. Microb. 73 (14), 4395–4406. ¯ mura, S., Oikawa, H., Ikeda, H., 2008. Identification and Komatsu, M., Tsuda, M., O functional analysis of genes controlling biosynthesis of 2-methylisoborneol. Proc. Natl. Acad. Sci. U.S.A. 105 (21), 7422–7427. Kutovaya, O.A., Watson, S.B., 2014. Development and application of a molecular assay to detect and monitor geosmin-producing cyanobacteria and actinomycetes in the Great Lakes. J. Great Lakes Res. 40 (2), 404–414. Li, Z.F., Li, X., Liu, H., Liu, X., Han, K., Wu, Z.H., Hu, W., Li, F.F., Li, Y.Z., 2011. Genome sequence of the halotolerant marine bacterium Myxococcus fulvus HW-1. J. Bacteriol. 193 (18), 5015–5016. Ludwig, F., Medger, A., Bo¨rnick, H., Opitz, M., Lang, K., Go¨ttfert, M., Ro¨ske, I., 2007. Identification and expression analyses of putative sesquiterpene synthase genes in Phormidium sp. and prevalence of geoA-like genes in a drinking water reservoir. Appl. Environ. Microbiol. 73 (21), 6988–6993. Lylloff, J.E., Mogensen, M.H., Burford, M.A., Schluter, L., Jorgensen, N.O.G., 2012. Detection of aquatic streptomycetes by quantitative PCR for prediction of tasteand-odour episodes in water reservoirs. J. Water Supply Res. Technol.-Aqua 61 (5), 272–282. Ohnishi, Y., Ishikawa, J., Hara, H., Suzuki, H., Ikenoya, M., Ikeda, H., Yamashita, A., Hattori, M., Horinouchi, S., 2008. Genome sequence of the streptomycin-producing microorganism Streptomyces griseus IFO 13350. J. Bacteriol. 190 (11), 4050–4060. Saadoun, I.M.K., Schrader, K.K., Blevins, W.T., 2001. Environmental and nutritional factors affecting geosmin synthesis by Anabaena sp. Water Res. 35 (5), 1209–1218. Smith, V.H., Sieber-Denlinger, J., deNoyelles, F., Campbell, S., Pan, S., Randtke, S.J., Blain, G.T., Strasser, V.A., 2002. Managing taste and odor problems in a eutrophic drinking water reservoir. Lake Reserv. Manage. 18 (4), 319–323. Smith, J.L., Boyer, G.L., Zimba, P.V., 2008. A review of cyanobacterial odorous and bioactive metabolites: impacts and management alternatives in aquaculture. Aquaculture 280 (1–4), 5–20. Su, M., Gaget, V., Giglio, S., Burch, M., An, W., Yang, M., 2013. Establishment of quantitative PCR methods for the quantification of geosmin-producing potential and Anabaena sp. in freshwater systems. Water Res. 47 (10), 3444–3454. Tsao, H.W., Michinaka, A., Yen, H.K., Giglio, S., Hobson, P., Monis, P., Lin, T.F., 2014. Monitoring of geosmin producing Anabaena circinalis using quantitative PCR. Water Res. 49, 416–425. Watson, S.B., 2004. Aquatic taste and odor: a primary signal of drinking-water integrity. J. Toxicol. Environ. Health A 67 (20–22), 1779–1795. Wert, E.C., Korak, J.A., Trenholm, R.A., Rosario-Ortiz, F.L., 2014. Effect of oxidant exposure on the release of intracellular microcystin, MIB, and geosmin from three cyanobacteria species. Water Res. 52, 251–259. Zhang, T., Li, D.L., Li, J., 2012. Biosynthesis of geosmin and 2-methylisoborneol in the prokaryotes – a review. Acta Microbiol. Sin. 52 (2), 152–159. Zhang, T., Li, L., Song, L.R., Chen, W., 2009. Effects of temperature and light on the growth and geosmin production of Lyngbya kuetzingii (Cyanophyta). J. Appl. Phycol. 21 (3), 279–285. Zhang, T., 2008. Ecological Investigation and Physiological Characteristics of EarthyMusty Odor-Producing Cyanobacteria. (Ph.D. thesis)Institute of Hydrobiology, The Chinese Academy of Science, , pp. 8–13.
Contents lists available at ScienceDirect
Harmful Algae journal homepage: www.elsevier.com/locate/hal
Identification and expression analysis of the gene associated with geosmin production in Lyngbya kuetzingii UTEX 1547 (cyanobacteria) Ting Zhang a,b,*, Deliang Li b, Guiping Wang b, Lirong Song c, Lin Li c a
Center for Environment and Water Resources, College of Chemistry and Chemical Engineering, Central South University, Changsha 410083, China College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China c State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 25 October 2013 Received in revised form 10 July 2014 Accepted 10 July 2014 Available online
Cyanobacteria are the major producers of geosmin in natural waters. To identify a gene involved in geosmin biosynthesis in cyanobacteria, the polymerase chain reaction (PCR) was used to amplify a 2298bp open reading frame (ORF) from the geosmin-producing cyanobacterium Lyngbya kuetzingii UTEX 1547. This ORF encoded a protein of 765 amino acids. Alignment of the deduced amino acid sequence demonstrated that geoL had high similarity to the corresponding genes of Oscillatoria sp. PCC 6506 (100% identity), Calothrix sp. PCC 7507 (89%), Anabaena ucrainica CHAB 1432 (88%), A. ucrainica CHAB 2155 (87%), Nostoc punctiforme PCC 73102 (87%), Phormidium sp. P2r (84%) and Cylindrospermum stagnale PCC 7417 (83%), and modest similarity to myxobacteria (61–73%). It also indicated geoL with low similarity to the corresponding genes of actinomycetes (<60%). The encoded protein GEOL was estimated to have two geosmin synthase domains, and each contained two strictly conserved Mg2+-binding motifs (aspartaterich motif and NSE triad). The geoL gene was shown to be responsible for geosmin biosynthesis in L. kuetzingii UTEX 1547. Then, geoL had been cloned into pET21a(+) vector and expressed in Escherichia coli BL21(DE3) with the isopropyl-b-D-thiogalactoside (IPTG) induction. The recombinant GEOL protein was purified and exhibited a single band (MW 90 kDa) on the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), which was consistent with the predicted molecular weight (MW) of 87,046 Da. In conclusion, this study has confirmed that geosmin synthase gene and its expression product can be identified and characterized from cyanobacteria, which will help understand the fundamental biological mechanism of geosmin biosynthesis in cyanobacteria. ß 2014 Elsevier B.V. All rights reserved.
Keywords: Geosmin synthase gene Geosmin Biosynthesis Lyngbya kuetzingii
1. Introduction Cyanobacteria and associated odorous compounds are of increasing environmental concern worldwide. One of the most common odorous compounds is described mostly as an earthy and musty odor, which is largely as the result of the production of the compound geosmin (trans-1,10-dimethyl-trans-9-decalol) and/or 2-methylisoborneol (2-MIB) (Saadoun et al., 2001). Both geosmin and 2-MIB with very low threshold odor values reported from 1.3 to 4.0 ng L1 and 6.3 to 15.0 ng L1, respectively (Watson, 2004; Wert et al., 2014), are responsible for decreasing the quality of drinking water (Smith et al., 2002) and aquaculture production (Smith et al., 2008). These negative effects may cause significant economic and public health concerns, despite neither geosmin nor
* Corresponding author. Tel.: +86 731 88876961; fax: +86 731 88876960. E-mail address: [email protected] (T. Zhang). http://dx.doi.org/10.1016/j.hal.2014.07.005 1568-9883/ß 2014 Elsevier B.V. All rights reserved.
2-MIB having any known adverse biological and pathological effects (Giglio et al., 2011a). Geosmin is a degraded sesquiterpenoid alcohol (Bentley and Meganathan, 1981; Dickschat et al., 2005). Significant advances have been made in the fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in the actinomycete strains Streptomyces coelicolor A3(2) (Jiang et al., 2006, 2007; He and Cane, 2004; Cane and Watt, 2003; Gust et al., 2003), Streptomyces avermitilis (Cane et al., 2006) and Streptomyces peucetius (Ghimire et al., 2008). The gene essential for geosmin biosynthesis was simultaneously detected for the first time by Gust et al. (2003) and Cane and Watt (2003) in S. coelicolor A3(2). Several years later, Cane’s group made an unexpected discovery that the geosmin synthase of S. coelicolor A3(2) could catalyze the entire biosynthesis of geosmin from farnesyl diphosphate (FPP) without requirement for any additional enzymes or redox cofactors (Jiang et al., 2006, 2007). Based on the above results, a real-time PCR method was established for the
128
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
quantification of geosmin-producing Streptomyces (Auffret et al., 2011; Lylloff et al., 2012). However, the biosynthesis of geosmin by cyanobacteria has received much attention recently. Nucleic sequences related to geosmin synthase-encoding gene were not detected in the geosmin-producing cyanobacterium Phormidium sp. until 2007, but it was not explicitly demonstrated that these nucleic sequences were functionally responsible for the biosynthesis of geosmin (Ludwig et al., 2007). In the model cyanobacterium Nostoc punctiforme PCC 73102, the putative geosmin synthase was homologous to fusion-type sesquiterpene synthase form Streptomyces spp. (Agger et al., 2008), and it was the single enzyme utilized to catalyze the cyclization of FPP to geosmin (Giglio et al., 2008). Moreover, Giglio et al. (2011b) further examined the growth conditions affecting the expression of geosmin synthase gene in Anabaena circinalis AWQC318. With regard to Anabaena, quantitative PCR methods were established for the quantification of geosmin-producing Anabaena sp. (Su et al., 2013), A. circinalis (Tsao et al., 2014) and Anabaena lemmermannii (Kutovaya and Watson, 2014) in freshwater systems. Cyanobacteria are considered to be the major sources of geosmin, which is found in many natural water bodies (Ju¨ttner and Watson, 2007). About 50 species of cyanobacteria have been directly confirmed as geosmin-producers, and more than 20 species of these known producers are benthic without the isolates from sediment (Zhang, 2008). Lyngbya kuetzingii UTEX 1547 is a benthic freshwater cyanobacterium with relatively high geosmin productivity (geosmin concentration divided by biomass), and our previous study demonstrated the physiological characteristics of both growth and geosmin production (Zhang et al., 2009). The study showed that the dissolved geosmin of L. kuetzingii UTEX 1547 was released into the environment along with its growth phases. The amount of release reached the maximum in the stationary phase under normal growth conditions, even though the great majority of dissolved geosmin was still retained in cells during its growth. But little is known about the biochemical mechanism of geosmin synthesis in L. kuetzingii UTEX 1547. Although the benthic geosmin-producer is not in the water column and cannot rapidly affect a water body, it could contribute a great deal of geosmin to the water–sediment interface and cause harmful effects. Therefore, in order to further investigate into the correlation between geosmin production and geosmin synthase gene, we have identified geoL associated with geosmin production in L. kuetzingii UTEX 1547, and successfully induced this gene expressed in vitro. The objective of this study was to provide further information for our fundamental understanding of geosmin production in cyanobacteria, especially in benthic producers.
2. Materials and methods 2.1. Strain and culture conditions Lyngbya kuetzingii UTEX 1547, a known geosmin producer (Zhang et al., 2009), was obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology (FACHBCollection), Chinese Academy of Sciences. This strain was cultured in BG-11 medium at 25 8C under an illumination of 20 mmol photons m2 s1 with a cycled photoperiod of 12 h light:12 h dark. 2.2. DNA extraction Before DNA extraction, the culture was subcultured on starchcasein agar for the detection of possible contaminating geosminproducing actinomycetes. The subculture was negative for actinomycetes. Genomic DNA was extracted using a QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions, with the addition of overnight proteinase K incubation at 56 8C.
2.3. Gene cloning The oligonucleotides used in this study are shown in Table 1. For amplification of putative geosmin synthase gene fragments from genomic DNA, the PCR mastermix consisted of 25 mM MgCl2, 10 PCR buffer, 10 mM dNTP, 10 mM each of forward primer and reverse primer (180F and 718R, 262F and 983R), 2.5 U of Taq DNA polymerase (Tiangen) and 1 ml of extracted genomic DNA. The reaction was run on a Applied Biosystems 2720 thermal cycler (Singapore) with an initial denaturation step of 94 8C for 5 min, followed by 35 cycles of 94 8C for 30 s, 52 8C for 30 s, and 72 8C for 60 s, with a final extension step of 3 min at 72 8C. Samples were then run on a 1% agarose gel with ethidium bromide (EB) for 35 min at 90 V, and bands were visualized using a Syngene InGenius LHR Gel Documentation System (United Kingdom). For selected sample bands of expected size (538 bp and 721 bp), DNA was extracted using a QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. The purified PCR product was then cloned into pMD18-T Vector (TaKaRa, Code No.: D101A) according to the manufacturer’s instrucions, and the ligation mixture was subsequently used to transform competent cells of Escherichia coli DH5a under standard conditions. The resulting transformants were grown overnight at 37 8C on LB-agar plates containing ampicillin (100 mg ml1). Twelve individual colonies were isolated from LB-ampicillin (100 mg ml1) medium after overnight growth at 37 8C, and the positive colonies were screened by PCR. Three optimal positive colonies were selected for sequenced by Sangon Biotechnology (Shanghai) Company Limited (China). For amplification of the 50 and 30 ends of geoL, the Genome Walking Kit (TaKaRa, Code No.: D316) was used according to the manufacturer’s instructions. Specific primers 5SP1, 5SP2 and 5SP3 were used to amplify the 50 end of geoL. Specific primers 3SP1, 3SP2 and 3SP3 were first used, and then specific primers 3SP10 , 3SP20 and 3SP30 were used to amplify the 30 end of geoL for the second time. The purified PCR products were directly sequenced by Sangon Biotechnology (Shanghai) Company Limited (China) with 5SP3, 3SP3 and 3SP30 for primer, respectively. The full length natural geoL gene was amplified with primers geoL_F and geoL_R, inserting NdeI and XhoI restriction sites (underlined) for the geoL_F and geoL_R primers, respectively. The full length gene fragment was PCR-amplified using KOD Plus DNA polymerase (Toyobo) as described by the manufacturer. Amplification was performed in a 50 ml reaction with 1 ml of extracted genomic DNA, 1.0 U of KOD Plus DNA polymerase, 10 KOD PCR buffer, 25 mM MgSO4, 2 mM KOD dNTPs and 10 mM each primer. Cycling parameters were denaturation at 94 8C for 5 min, then 28 cycles consisting of denaturation at 94 8C for 20 s, annealing at Table 1 Oligonucleotides used in this study. Primer
Sequence (50 ! 30 )
180F 718R 262F 983R 3SP1 3SP2 3SP3 3SP10 3SP20 3SP30 5SP1 5SP2 5SP3 geoL_F geoL_R
CGCCTTGCTTTGCTCGTATA GGTAGGAGAAGAGGTCGTTGC TTCTTCGACGATCACTTCC CCCTTGTTCATGTARCGGC GACACATTTGCCGATGGAGTTCACC ACCTCACCAACGAACTGCTCACCTC TCAAAGGACTTCAAGACTGGCAA GCTAAATCTAAGTGCGTGCTGGCT CCCAGCACTCTACGGGAATAAC GAAGACCTTTGGCTCGGATTTG TGGCGACCCGATTTTGGTTGAT CTGGATTGGTGGGTAAGGAAGG ATAAATGCGGGCAGTCGGTGGA TAAGAAGGAGATATACATATGATGCAGCCGTTTAAACTGC GGTGGTGGTGGTGCTCGAGTTTGCCCACAAAACGATCTG
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
129
55 8C for 20 s, and extension at 72 8C for 150 s, and a last elongation step of 10 min at 72 8C with a final hold at 4 8C until needed. The purified PCR product and the pET21a(+) vector (Novagen) were digested separately with NdeI and XhoI (Fermentas) before ligation with T4 DNA ligase (3:1 insert:vector, 37 8C, 20 min) and transformation of competent Escherichia coli DH5a cells. The positive colonies were identified by PCR and subsequently sequenced by Invitrogen Corporation (China) to confirm the sequence of the correct insert.
program of the NCBI web-server, and were aligned using the multiple sequence alignment program, ClustalX 1.83. Molecular similarity between geoL associated with geosmin production in Lyngbya kuetzingii UTEX 1547 and other previously reported geosmin synthase genes were determined using the MEGA 5.02 software program. Distance matrices were determined and used to elaborate dendrogram by the neighbor-joining method.
2.4. Expression of geosmin synthase
3.1. Identification of the gene associated with geosmin production in L. kuetzingii UTEX 1547
The purified pET21a(+) expression vector carrying geoL gene was then used to transform Escherichia coli BL21(DE3). Recombinant E. coli BL21(DE3) overnight culture was used to inoculate a 100 ml culture that was grown at 37 8C and 250 rpm until an optical density at 600 nm (OD600) of 0.5–0.6, and then induced by the addition of IPTG to a final concentration of 0.1 mM. After a further overnight induction at 16 8C, the cells were harvested by centrifugation (5000 rpm, 15 min, 4 8C) and resuspended in 20 ml of lysis buffer (20 mM PB, 300 mM NaCl, pH 7.4). The cells were disrupted by sonication on ice and the cell lysate was clarified by centrifugation (12,000 rpm, 20 min, 4 8C). The clarified protein extract was used to purify proteins by metal affinity chromatography. The soluble protein was loaded onto a chelating SFF (Ni) column (1 ml) that had been pre-equilibrated with 40 ml buffer A (20 mM PB, 300 mM NaCl, pH 7.4). The chelating SFF (Ni) column combined target protein was washed with buffer A and then eluted four times with a linear gradient of 20–500 mM imidazole in buffer B (20 mM PB, 300 mM NaCl, 500 mM imidazole, pH 7.4). The target protein was mainly in the elution buffer with 500 mM imidazole, and dialyzed overnight with the dialysis buffer (PBS, pH 7.4, 1 L) at 4 8C. The purified protein was determined by SDS-PAGE. The apparent molecular weight (Mr) of 90 kDa of the desired protein was very close to the theoretical MW of 87,046 Da. 2.5. Nucleotide sequence accession number The nucleotide sequence of geoL has been deposited in the NCBI nucleotide sequence database under accession number JX962775. 2.6. Analysis of DNA and protein sequences The obtained nucleotide sequence and homologous sequences were detected using a database search with the BLAST search
3. Results and discussion
A database search with cyc2 of Streptomyces coelicolor A3(2) indicated the presence of similar proteins in geosmin-producing cyanobacteria, such as Nostoc punctiforme PCC 73102 (YP_001866236) and Phormidium sp. P2r (ABU93239). To search for a similar gene in Lyngbya kuetzingii UTEX 1547, two pairs of degenerate primers (180F and 718R, 262F and 983R) were designed based on four highly conserved regions of sequences from the NCBI database. By PCR from total genomic DNA of L. kuetzingii UTEX 1547, two fragments (538 bp and 721 bp, which had a 434-bp overlap at their ends) were amplified as expected theoretically (Fig. 1A). Blastn searches in the GenBank database revealed that the two PCR products were similar to a number of known geosmin synthase genes, suggesting that the two fragments were parts of the gene encoding a geosmin synthase involved in geosmin biosynthesis of L. kuetzingii UTEX 1547. The 538-bp and 721-bp sequences were then assembled into an 825-bp sequence using the DNAMAN V6 software program. The nucleotide order of the 825-bp sequence was confirmed by PCR with the primers 180F and 983R (the expected fragment shown in Fig. 1B). To amplify the 50 and 30 ends of geoL, the genome walking strategy was successfully used on the basis of the 825-bp sequence. DNA bands of the expected size from agarose gels were excised, purified, sequenced and assembled. A single 2298-bp ORF from L. kuetzingii UTEX 1547 having a putative ATG start codon and TAA stop codon was revealed by both the ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and the DNAMAN V6 software program. The 2298-bp ORF encoded an apparent protein of 765 amino acids. A Blastn homology search of this ORF (GenBank Accession JX962775) demonstrated that the predicted geoL was similar to N. punctiforme PCC 73102 NPUNMOD protein gene (FJ010203, 2156 bp, 85% identity and 73% positive matches) and Anabaena ucrainica CHAB 1432 geosmin synthesis operon (HQ404996, 2237 bp, 82% identity
Fig. 1. Agarose gel electrophoresis of PCR products for geoL of L. kuetzingii UTEX 1547. Note: (A) Lane M: Marker II (Tiangen), Lane 1: the 538-bp PCR product (primed by 180F and 718R), Lane 2: the 721-bp PCR product (primed by 262F and 983R); (B) Lane M: Marker II (Tiangen), Lane 1: the 825-bp PCR product (primed by 180F and 983R); (C) Lane M: DL2000 plus (SinoBio), Lane 1: the 2298-bp PCR product (primed by geoL_F and geoL_R).
130
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
and 76% positive matches) at the nucleotide sequence level. To confirm the expected nucleotide order of geoL within L. kuetzingii UTEX 1547, a confirmatory PCR was carried out using the genespecific primers (geoL_F and geoL_R), and a 2298-bp PCR fragment was obtained (Fig. 1C). Using the deduced 765-amino acid sequence from Lyngbya kuetzingii UTEX 1547 as a query, a number of putative geosmin synthase genes of prokaryotic origin were identified by a BLAST analysis from NCBI database. The BLAST search also showed that geoL had high similarity to the corresponding genes of Oscillatoria sp. PCC 6506 (100% identity), Calothrix sp. PCC 7507 (89%), Anabaena ucrainica CHAB 1432 (88%), A. ucrainica CHAB 2155 (87%), Nostoc punctiforme PCC 73102 (87%), Phormidium sp. P2r (84%) and Cylindrospermum stagnale PCC 7417 (83%), and modest similarity to myxobacteria (61–73%). It also indicated geoL with low similarity to the corresponding genes of actinomycetes (<60%). Subsequently, alignment of the amino acid sequences was analyzed by using ClustalX 1.83 program. Phylogenetic analysis of aligned sequences was done by the bootstrap method (bootstrap number, 1000; seed number, 111) of MEGA 5.02 software. Drawing of the phylogenetic tree was done by neighbor-joining method. The phylogenetic tree showing the relationship between geoL of L. kuetzingii UTEX 1547 and other selected known geosmin synthase genes was shown in Fig. 2. The results of phylogenetic analysis suggested that the geosmin synthase genes of cyanobacteria were more similar to myxobacteria than to actinomycetes. Therefore, the authors postulated that cyanobacteria might be similar to myxobacteria using the mevalonate (MVA) pathway as a major route to synthesize geosmin (Dickschat et al., 2005), although it has not been known which pathway cyanobacteria could use to synthesize FPP, MEP (2methylerythritol-4-phosphate), MVA or L-leucine pathway (Zhang et al., 2012).
Within the last 10 years, the genes associated with geosmin synthesis in Streptomyces and cyanobacteria have been elucidated. Geosmin synthase gene was first identified in Streptomyces in 2003 (Cane and Watt, 2003; Gust et al., 2003). Both of them confirmed that a single 726-amino acid protein in Streptomyces coelicolor A3(2), encoded by the 2181-bp SCO6073 gene (cyc2), catalyzed the C15 sesquiterpene precursor FPP to geosmin. However, the gene associated with geosmin production in cyanobacteria was first isolated from Nostoc punctiforme PCC 73102 in 2008 (Giglio et al., 2008). It was demonstrated that the 1893-bp npun02003620 gene could encode a NJ2 protein, which was similar to SCO6073 protein. According to the experimental data, geoL showing high similarity to npun02003620 of N. punctiforme PCC 73102 indicated that the 2298-bp geoL gene was responsible for geosmin synthesis in Lyngbya kuetzingii UTEX 1547. Additionally, the deduced amino acid sequence of geol was found to be identical to the germacradienol/germacrene D synthase of Oscillatoria sp. PCC 6506 (WP_007358458). Alignment of the partial sequence of the 16S rRNA gene also revealed that Oscillatoria sp. PCC 6506 (AY768397, 634 bp) had an identical nucleotide sequence with L. kuetzingii UTEX 1547 (GenBank Accession Number: KJ817358, 1291 bp, unpublished). The authors inferred that both L. kuetzingii UTEX 1547 and Oscillatoria sp. PCC 6506 may be the same cyanobacterial species with different taxonomic names. Geosmin synthase is a bifunctional cyclase. The N-terminal half of the cyclase catalyzes the cyclization of FPP to germacradienol, and the C-terminal half catalyzes the cyclization–fragmentation of germacradienol to geosmin (Jiang et al., 2007). Generally, typical bacterial cyclases contain an acid-rich motif and a downstream triad (NSE), and both of them coordinate Mg2+ (Komatsu et al., 2008; Daum et al., 2009). As shown in Fig. 3, the encoded protein (JX962775) was estimated to have two sesquiterpene cyclase
Fig. 2. Phylogenetic analysis of geosmin synthase homologs identified in completed bacterial sequences available in the NCBI database. Sequences were identified by BLAST using the deduced 765-amino acid sequence of Lyngbya geosmin synthase described in this study (bold and underlined). Phylogenetic analysis of aligned sequences was performed using the bootstrap method (bootstrap number: 1000; seed number: 111). Bootstrap values (%) were indicated at the nodes, and the scale bars represented 0.05 substitution/site. Phylogenetic tree branches were labeled with accession numbers followed by species names for each geosmin synthase sequence (the published sequences were referred to Giglio et al. (2008), Ludwig et al. (2007), Goldman et al. (2006), Li et al. (2011) and Ohnishi et al. (2008)).
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
131
Fig. 3. Alignment of the deduced amino acid sequence of GEOL with its homologs. Accession no.: JX962775 (Lyngbya kuetzingii UTEX 1547, obtained in this study), WP_007358458 (Oscillatoria sp. PCC 6506), AEA03338 (Anabaena ucrainica CHAB 1432), AEA03341 (A. ucrainica CHAB 2155), ABU93239 (Phormidium sp. P2r), YP_001866236 (Nostoc punctiforme PCC 73102), YP_007149161 (Cylindrospermum stagnale PCC 7417), YP_007066242 (Calothrix sp. PCC 7507). Shadow boxes indicate aspartate-rich regions of cyanobacterial geosmin synthases. Mg2+-binding sites are shown in bold with a shadow box (‘‘*’’ indicates exact sequence match, ‘‘:’’ indicates moderate sequence match, ‘‘.’’ indicates low sequence match).
domains, both of which contained two strictly conserved Mg2+binding motifs (aspartate-rich motif and NSE triad). The aspartaterich 90DDHFL motif and NSE triad 234NDIFSYQRE located near the N-terminal half of the encoded protein, while the aspartate-rich
471
DDYFP motif and NSE triad 615NDIFSYQKE located near the Cterminal half. Both of the two NSE triads were found at the usual 140-amino acids downstream of the two aspartate-rich motifs. In comparison with Lyngbya kuetzingii UTEX 1547, the aspartate-rich
132
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
motif in these known geosmin synthases shown in Fig. 3 was absolutely conserved, while both of the two NSE triads appeared moderate sequence match at the third amino acid residue (236I ! L and 617I ! V, respectively). However, in several geosmin synthases of the Streptomyces species, a DDYYP variant was found in the aspartate-rich motif of the C-terminal domain (Jiang et al., 2007; Cane et al., 2006; Cane and Watt, 2003). Similarly, the NSE triad of residues (NDVFSYQKE) had a slight C-terminal acid variant in Streptomyces. These variants occurring between Streptomyces and cyanobacteria may be a reason for forming distinct clusters during examining the phylogeny of geosmin synthases (Fig. 2). To our knowledge, no reliable methods have been developed to distinguish between the contributions of cyanobacteria and actinomycetes (or other potential producers) to geosmin in surface water. It is thus necessary to develop a sensitive and useful tool to correctly identify the corresponding microorganisms and their contributions to geosmin production in waters. According to the differences of both the aspartate-rich motif and NSE triad between cyanobacteria and Streptomyces, using the specific molecular probes to develop a PCR-based screening procedure might be a good choice to evaluate the geosmin-producers. 3.2. Expression analysis of geoL To determine protein expression, the 2298-bp geoL gene was amplified by PCR with primers geoL_F and geoL_R (inserting NdeI and XhoI restriction sites) from genomic DNA of Lyngbya kuetzingii UTEX 1547, and ligated into the pET21a(+) expression vector. The derived construct, pET21a(+)-geoL, was transformed into Escherichia coli BL21(DE3). An induction of the transformed bacteria with IPTG 0.1 mM (final concentration) at 16 8C for overnight provided high-level expression of GEOL protein in vitro. As expected, after expression analysis by SDS-PAGE, one protein of approximately 90 kDa was observed in the supernatant of cell lysate (Fig. 4). The expressed soluble GEOL protein, carrying an N-terminal His6-tag, was purified by Ni-NTA affinity chromatography under experimental procedures. The results from SDS-PAGE verified the successful purification, since only one clear band with molecular weight about 90 kDa was observed as expected, corresponding to the predicted 87.046-kDa MW (Fig. 5). In this study, geoL from Lyngbya kuetzingii UTEX 1547 was cloned into pET21a(+) vector and successfully expressed in Escherichia coli BL21(DE3) cells. The experimental data showed
Fig. 5. SDS-PAGE of soluble GEOL protein purified by Ni-NTA affinity chromatography. Lane M shows the molecular weight marker. Lane A shows the clarified protein extract. Lane B shows the protein sample after flow-through with buffer A (20 mM PB, 300 mM NaCl, pH 7.4). Lane C shows the protein sample after elution by 20 mM imidazole (pH 7.4). Lane D shows the protein sample after elution by 50 mM imidazole (pH 7.4). Lane E shows the protein sample after elution by 100 mM imidazole (pH 7.4). Lane F shows the protein sample after elution by 500 mM imidazole (pH 7.4). Lane G shows the supernatant after dialysis (arrowhead). Lane H shows the precipitation after dialysis.
that E. coli BL21(DE3) could successfully be used as an expression system for generating biologically functional GEOL protein. The monitoring of experimental protocol to optimize protein expression was made by SDS-PAGE. The factors including the IPTG concentration, incubation time, temperature, and imidazole concentration in the lysis, wash and elution buffer were optimized for recombinant GEOL protein. However, although the recombinant GEOL protein was expressed in a prokaryotic system to obtain large-scale protein production, the amount of soluble GEOL protein was much less than expected. Moreover, the protein stability was reduced after stored at 4 8C for two days, which posed a challenge to GEOL generation. Future studies will focus on the development of a suitable strategy to improve the production and stability of the GEOL protein.
4. Conclusions This study clearly demonstrated that the 2298-bp geoL gene was responsible for geosmin synthesis in Lyngbya kuetzingii UTEX 1547, which was confirmed by PCR amplification and heterologous expression in Escherichia coli BL21(DE3). The 2298-bp ORF encoded a protein of 765 amino acids. Alignment of the deduced amino acid sequences indicated that geoL (JX962775) had high similarity to the corresponding genes of cyanobacteria (>83% identity), modest similarity to myxobacteria (61–73%), and low similarity to actinomycetes (<60%). The encoded protein was estimated to have two geosmin synthase domains the same as other typical bacterial cyclases, and each contained two strictly conserved Mg2+binding motifs (the aspartate-rich 90DDHFL motif and NSE triad 234 NDIFSYQRE near the N-terminal, while the aspartate-rich 471 DDYFP motif and NSE triad 615NDIFSYQKE near the C-terminal). Additionally, the soluble GEOL protein was heterologously expressed with IPTG induction. The purified protein exhibited a single band (MW 90 kDa) on SDS-PAGE, which was consistent with the predicted MW of 87,046 Da. Acknowledgements
Fig. 4. Analysis of GEOL protein expression by SDS-PAGE. Lane A shows the crude of E. coli pET21a(+)-geoL without induction. Lane B shows the crude of E. coli pET21a(+)-geoL with IPTG induction, and Lanes B1–B3 show parallel experiments in triplicate. Lane C shows the supernatant of cell lysate with IPTG induction (arrowhead). Lane D shows the precipitation of cell lysate with IPTG induction. Lane M shows the molecular weight marker.
This study was supported by the National Natural Science Foundation of China (Grant Nos. 31000183 and 31100282). The authors would like to thank Prof. Zhaoguang Yang and Xiaowan Li of Central South University for their valuable suggestions on the manuscript.[SS]
T. Zhang et al. / Harmful Algae 39 (2014) 127–133
References Agger, S.A., Lopez-Gallego, F., Hoye, T.R., Schmidt-Dannert, C., 2008. Identification of sesquiterpene synthases from Nostoc punctiforme PCC 73102 and Nostoc sp. Strain PCC 7120. J. Bacteriol. 190 (18), 6084–6096. Auffret, M., Pilote, A., Proulx, ?., Proulx, D., Vandenberg, G., Villemur, R., 2011. Establishment of a real-time PCR method for quantification of geosmin-producing Streptomyces spp. in recirculating aquaculture systems. Water Res. 45 (20), 6753–6762. Bentley, R., Meganathan, R., 1981. Geosmin and methylisoborneol biosynthesis in Streptomycetes. Evidence for an isoprenoid pathway and its absence in nondifferentiating isolates. FEBS Lett. 125 (2), 220–222. ¯ mura, S., Ikeda, H., 2006. Geosmin biosynthesis Cane, D.E., He, X.F., Kobayashi, S.J., O in Streptomyces avermitillis. Molecular cloning, expression, and mechanistic study of the germacradienol/geosmin synthase. J. Antibiot. 59 (8), 471–479. Cane, D.E., Watt, R.M., 2003. Expression and mechanistic analysis of a germacradienol synthase from Streptomyces coelicolor implicated in geosmin biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 100 (4), 1547–1551. Daum, M., Herrmann, S., Wilkinson, B., Bechthold, A., 2009. Genes and enzymes involved in bacterial isoprenoid biosynthesis. Curr. Opin. Chem. Biol. 13 (2), 180–188. Dickschat, J.S., Bode, H.B., Mahmud, T., Mu¨ller, R., Schulz, S., 2005. A novel type of geosmin biosynthesis in myxobacteria. J. Org. Chem. 70 (13), 5174–5182. Ghimire, G.P., Oh, T.J., Lee, H.C., Kim, B.G., Sohng, J.K., 2008. Cloning and functional characterization of the germacradienol synthase (spterp13) from Streptomyces peucetius ATCC 27952. J. Microbiol. Biotechnol. 18 (7), 1216–1220. Giglio, S., Chou, W.K.W., Ikeda, H., Cane, D.E., Monis, P.T., 2011a. Biosynthesis of 2methylsioborneol in cyanobacteria. Environ. Sci. Technol. 45 (3), 992–998. Giglio, S., Jiang, J.Y., Saint, C.P., Cane, D.E., Monis, P.T., 2008. Isolation and characterization of the gene associated with geosmin production in cyanobacteria. Environ. Sci. Technol. 42 (21), 8027–8032. Giglio, S., Saint, C.P., Monis, P.T., 2011b. Expression of the geosmin synthase gene in the cyanobacterium Anabaena circinalis AWQC318. J. Phycol. 47 (6), 1338–1343. Goldman, B.S., Nierman, W.C., Kaiser, D., Slater, S.C., Durkin, A.S., Eisen, J.A., Ronning, C.M., Barbazuk, W.B., Blanchard, M., Field, C., Halling, C., Hinkle, G., Iartchuk, O., Kim, H.S., Mackenzie, C., Madupu, R., Miller, N., Shvartsbeyn, A., Sullivan, S.A., Vaudin, M., Wiegand, R., Kaplan, H.B., 2006. Evolution of sensory complexity recorded in a myxobacterial genome. Proc. Natl. Acad. Sci. U.S.A. 103 (41), 15200–15205. Gust, B., Challis, G.L., Fowler, K., Kieser, T., Chater, K.F., 2003. PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. U.S.A. 100 (4), 1541– 1546. He, X.F., Cane, D.E., 2004. Mechanism and stereochemistry of the germacradienol/ germacrene D synthase of Streptomyces coelicolor A3(2). J. Am. Chem. Soc. 126 (9), 2678–2679. Jiang, J.Y., He, X.F., Cane, D.E., 2006. Geosmin biosynthesis. Streptomyces coelicolor germacradienol/germacrene D synthase converts farnesyl diphosphate to geosmin. J. Am. Chem. Soc. 128 (25), 8128–8129. Jiang, J.Y., He, X.F., Cane, D.E., 2007. Biosynthesis of the earthy odorant geosmin by a bifunctional Streptomyces coelicolor enzyme. Nat. Chem. Biol. 3 (11), 711–715.
133
Ju¨ttner, F., Watson, S.B., 2007. Biochemical and ecological control of geosmin and 2methylisoborneol in source waters. Appl. Environ. Microb. 73 (14), 4395–4406. ¯ mura, S., Oikawa, H., Ikeda, H., 2008. Identification and Komatsu, M., Tsuda, M., O functional analysis of genes controlling biosynthesis of 2-methylisoborneol. Proc. Natl. Acad. Sci. U.S.A. 105 (21), 7422–7427. Kutovaya, O.A., Watson, S.B., 2014. Development and application of a molecular assay to detect and monitor geosmin-producing cyanobacteria and actinomycetes in the Great Lakes. J. Great Lakes Res. 40 (2), 404–414. Li, Z.F., Li, X., Liu, H., Liu, X., Han, K., Wu, Z.H., Hu, W., Li, F.F., Li, Y.Z., 2011. Genome sequence of the halotolerant marine bacterium Myxococcus fulvus HW-1. J. Bacteriol. 193 (18), 5015–5016. Ludwig, F., Medger, A., Bo¨rnick, H., Opitz, M., Lang, K., Go¨ttfert, M., Ro¨ske, I., 2007. Identification and expression analyses of putative sesquiterpene synthase genes in Phormidium sp. and prevalence of geoA-like genes in a drinking water reservoir. Appl. Environ. Microbiol. 73 (21), 6988–6993. Lylloff, J.E., Mogensen, M.H., Burford, M.A., Schluter, L., Jorgensen, N.O.G., 2012. Detection of aquatic streptomycetes by quantitative PCR for prediction of tasteand-odour episodes in water reservoirs. J. Water Supply Res. Technol.-Aqua 61 (5), 272–282. Ohnishi, Y., Ishikawa, J., Hara, H., Suzuki, H., Ikenoya, M., Ikeda, H., Yamashita, A., Hattori, M., Horinouchi, S., 2008. Genome sequence of the streptomycin-producing microorganism Streptomyces griseus IFO 13350. J. Bacteriol. 190 (11), 4050–4060. Saadoun, I.M.K., Schrader, K.K., Blevins, W.T., 2001. Environmental and nutritional factors affecting geosmin synthesis by Anabaena sp. Water Res. 35 (5), 1209–1218. Smith, V.H., Sieber-Denlinger, J., deNoyelles, F., Campbell, S., Pan, S., Randtke, S.J., Blain, G.T., Strasser, V.A., 2002. Managing taste and odor problems in a eutrophic drinking water reservoir. Lake Reserv. Manage. 18 (4), 319–323. Smith, J.L., Boyer, G.L., Zimba, P.V., 2008. A review of cyanobacterial odorous and bioactive metabolites: impacts and management alternatives in aquaculture. Aquaculture 280 (1–4), 5–20. Su, M., Gaget, V., Giglio, S., Burch, M., An, W., Yang, M., 2013. Establishment of quantitative PCR methods for the quantification of geosmin-producing potential and Anabaena sp. in freshwater systems. Water Res. 47 (10), 3444–3454. Tsao, H.W., Michinaka, A., Yen, H.K., Giglio, S., Hobson, P., Monis, P., Lin, T.F., 2014. Monitoring of geosmin producing Anabaena circinalis using quantitative PCR. Water Res. 49, 416–425. Watson, S.B., 2004. Aquatic taste and odor: a primary signal of drinking-water integrity. J. Toxicol. Environ. Health A 67 (20–22), 1779–1795. Wert, E.C., Korak, J.A., Trenholm, R.A., Rosario-Ortiz, F.L., 2014. Effect of oxidant exposure on the release of intracellular microcystin, MIB, and geosmin from three cyanobacteria species. Water Res. 52, 251–259. Zhang, T., Li, D.L., Li, J., 2012. Biosynthesis of geosmin and 2-methylisoborneol in the prokaryotes – a review. Acta Microbiol. Sin. 52 (2), 152–159. Zhang, T., Li, L., Song, L.R., Chen, W., 2009. Effects of temperature and light on the growth and geosmin production of Lyngbya kuetzingii (Cyanophyta). J. Appl. Phycol. 21 (3), 279–285. Zhang, T., 2008. Ecological Investigation and Physiological Characteristics of EarthyMusty Odor-Producing Cyanobacteria. (Ph.D. thesis)Institute of Hydrobiology, The Chinese Academy of Science, , pp. 8–13.