Identification and functional analysis of a Hemolin like protein from Litopenaeus vannamei

Fish & Shellfish Immunology 43 (2015) 51e59

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification and functional analysis of a Hemolin like protein from Litopenaeus vannamei Hongliang Zuo a, b, Haoyang Li a, b, Erman Wei a, b, Ziqi Su a, b, Jieyao Zheng a, b, Chaozheng Li a, b, Yonggui Chen b, c, Shaoping Weng a, b, Jianguo He a, b, c,**, Xiaopeng Xu a, b, * a b c

MOE Key Laboratory of Aquatic Product Safety/State Key Laboratory for Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, PR China Institute of Aquatic Economic Animals and Guangdong Province Key Laboratory for Aquatic Economic Animals, Sun Yat-sen University, PR China School of Marine Sciences, Sun Yat-sen University, Guangzhou, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 September 2014 Received in revised form 4 November 2014 Accepted 6 December 2014 Available online 17 December 2014

Hemolin is a specific immune protein belonging to immunoglobulin superfamily and firstly identified in insects. Growing evidences suggest that Hemolin can be activated by bacterial and viral infections and may play an important role in antimicrobial immunity. In this paper, we firstly identified a Hemolin-like protein from Litopenaeus vannamei (LvHemolin). Sequence analysis showed that LvHemolin shares high similarity with insect Hemolins and is mainly composed of seven immunoglobulin (Ig) domains which form a ‘horseshoe’ tertiary structure. Tissue distribution analysis demonstrated that LvHemolin mainly expressed in stomach, gill, epithelium and pyloric cecum of L. vannamei. After challenge with pathogens or stimulants, expression of LvHemolin was significantly up-regulated in both gill and stomach. Agglutination analysis demonstrated that recombinant LvHemolin protein purified from Escherichia coli could accelerate the agglutination of Vibrio parahaemolyticus, E. coli, Staphylococcus aureus, and Bacillus subtilis in the presence of Ca2þ. To verify the immune function of LvHemolin in vivo, shrimps were injected with gene-specific dsRNA, followed by challenge with white spot syndrome virus (WSSV) or V. parahaemolyticus. The results revealed that silence of LvHemolin could increase the cumulative mortalities of shrimps challenged by pathogens and increase the WSSV copies in shrimp tissues. These suggested that Hemolin could play an important role in shrimp innate immune defense against bacterial and viral infections. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Litopenaeus vannamei Hemolin Innate immunity Bacteria agglutination Immunoglobulin superfamily

1. Introduction Litopenaeus vannamei, known as white pacific shrimp and belonging to Penaeidae family of decapod crustaceans, is a crucial aquaculture shrimp in the world [1]. L. vannamei can be infected by a wide range of pathogens, such as white spot syndrome virus (WSSV), Vibrio parahaemolyticus and Staphylococcus aureus, which

* Corresponding author. School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, PR China. Tel.: þ86 20 84113793; fax: þ86 20 84113229. ** Corresponding author. School of Life Sciences, School of Marine Sciences, Sun Yat-sen (Zhongshan) University, Guangzhou 510275, PR China. Tel.: þ86 20 39332988; fax: þ86 20 84113229. E-mail addresses: [email protected] (J. He), [email protected] (X. Xu). http://dx.doi.org/10.1016/j.fsi.2014.12.004 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

cause tremendous economic losses in shrimp industry. Studies on L. vannamei immunity could help improve the health of shrimp farming [2,3]. Hemolin known as a kind of insect specific immune protein belongs to immunoglobulin (Ig) superfamily. It was firstly identified in Hyalophora cecropia and proved to be activated during immune responses [4,5]. Since then, more and more homologs of Hemolin have been cloned in Lepidopterans [6e10]. Although the lengths of Hemolin genes are diverse in different insects, they typically share the same gene structure which mainly contains transcriptional regulatory sequences, promoter, 6 exons and 5 introns [11,12]. The mature proteins of Hemolin are composed of 390e400 residues and share 47e62% homology among insects [13,14]. Most of the Hemolins have a signal peptide composed of 18 amino acids [13]. Hemolins from insects are composed of 4 immunoglobulin domains which form a horseshoe shape in tertiary

52

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

structure [15,16]. Homology analysis demonstrated that all the immunoglobulin domains belong to the immunoglobulin superfamily and share high homology with adhesion proteins [14,16,17]. Interestingly, the promoter and intron regions of Hemolin harbor several NF-kB binding motifs, which can up-regulate Hemolin expression through binding with Rel factor [11,18]. As the only member of the immunoglobulin superfamily identified in invertebrates so far, Hemolin may play an important role in Lepidoptera immunity. It is expressed in all developmental stages of Lepidoptera and can be activated after pathogen challenge, especially in fat body, an important immune and defensive organ of insects [6,7,10,19]. Similar to opsonin, Hemolin can accelerate the phagocytosis of pathogens via adhering to the membrane of hemocytes and promote hemocytes agglutination in the presence of Ca2þ [5,11,14,20]. In most Lepidopterans, expression of Hemolin is induced by bacterial and viral infections [21], suggesting that Hemolin may have protective function against microbial invasion. While in some insects such as Heliothis virescens and Helicoverpa zea, the expression of Hemolin can not be induced by virus infection [22]. It may imply that the function of Hemolins is different among various insects. In this paper, we identified a Hemolin-like gene from L. vannamei, which is, to our knowledge, the first reported Hemolin gene in crustaceans. We verified its agglutination activity against gramnegative and -positive bacteria in vitro and further demonstrated that it plays a role in the immunity of L. vannamei. 2. Materials and methods 2.1. Experimental shrimp Juvenile and healthy L. vannamei (~5 g) were raised in a shrimp farm in Zhuhai City, Guangdong Province, China. Shrimps were acclimated in a re-circulating water tank system filled with airpumped seawater (2.5% salinity) at ~27  C and cultured for at least a week for acclimation before processing. 2.2. Cloning of LvHemolin cDNA Total RNA was extracted from mixed sample which contains gill, stomach and hepatopancreas of L. vannamei using RNeasy Plus Mini Kit (QIAGEN, Germany) as described in the manufacturer's protocol. The first-strand cDNA synthesis was carried out by PrimeScript Reverse Transcriptase (Takara, Japan) with the DNase (QIAGEN) treated total RNA as template and Oligo d(T)18 as primer. Based on a Hemolin homologous partial sequence retrieved from the transcriptome data of L. vannamei [23], the primers LvHem3R1, LvHem3R2, LvHem5R1 and LvHem5R2 were designed for the 30 and 50 rapid amplification of cDNA ends (RACE). Briefly, RACE cDNA templates were produced using the SMARTer™ RACE cDNA Amplification kit (Clontech, Japan) according to the manufacturer's protocol. The 50 - and 30 -untranslated region (UTR) were amplified using primers LvHem3R1/LvHem3R2 and LvHem5R1/ LvHem5R2, respectively. The first round PCR were performed by primers of LvHem3R1 or LvHem5R1 together with Universal Primer Mix (UPM), The PCR protocol was: 3 min of initial preheating at 94  C, followed by 30 cycles of 94  C for 30 s, 60  C for 30 s and 72  C for 3 min, and a final extension at 72  C for 10 min. Nested PCR was carried out with the first PCR products as templates and LvHem3R2 or LvHem5R2 together with Nested Universal Primer (NUP) A as primers, respectively, and the PCR protocol was the same as the first round PCR. The RACE products were purified, cloned and sequenced.

2.3. Bioinformatics analysis Sequence similarity and conserved domains of LvHemolin were searched using BLAST program on National Center for Biotechnology Information (NCBI). The cDNA sequences and deduced amino acid sequences were analyzed using DNASTAR 7.0. Prediction of signal peptide and transmembrane domains were performed using MEMSAT3 & MEMSAT-SVM (http://bioinf.cs.ucl.ac. uk/psipred/). Protein domains were predicted using the SMART program (http://smart.embl-heidelberg.de/). Tertiary structure was modeled by Protein Homology/analogy Recognition Engine (Phyre 2.0) (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id¼index). Multiple sequence alignments were performed by Multalin version 5.4.1 (http://multalin.toulouse.inra.fr/multalin/multalin. html). Phylogenetic tree was constructed using MEGA 5.05 software with the neighbor joining method and reconstructed with 1000 replicate bootstrap analysis [24]. 2.4. Quantitative real-time PCR (real-time RT-PCR) For tissue distribution analysis, the hemocyte, gill, hepatopancreas, heart, stomach, intestine, pyloric cecum, nerve, epidermis, muscle, eyestalk and scape were sampled from 9 healthy and acclimated L. vannamei. Total RNA of these samples were isolated using RNeasy Plus Mini Kit (QIAGEN) as described above. The firststrand cDNA was reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara) from 1 mg total RNA according to the manufacturer's instructions. Sequences of real-time RT-PCR primers for Lv-Hemolin (LvHem-qRTF and LvHem-qRTR) and internal control gene elongation factor 1 alpha (EF1-a, Genbank accession No. GU136229) (LvEF-1a-qRTF and LvEF-1a-qRTR) were listed in Table 1. Real-time RT-PCR was performed on a LightCycle 480 System (Roche, Germany) at a final volume of 10 mL comprised of 1 mL cDNA, 5 mL 2  SYBR Premix Ex Taq™ II (Takara), and 500 nM of each primer. The optimized thermal cycling parameters were 95  C for 2 min to activate the polymerase, followed by 40 cycles of 95  C for 15 s, 62  C for 15 s and 72  C for 10 s. After the cycling protocol, melting curves were obtained by increasing the temperature from 72  C to 95  C (0.5  C/s) to denature the double-stranded DNA. The expression level of LvHemolin was calculated using 2DDCt method after normalization to LvEF-1a [25]. Table 1 Summary of primers in this study. Primer

Sequence (50 -30 )

LvHem-3R1 LvHem-3R2 LvHem-5R1 LvHem-5R2 LvHem-qRTF LvHem-qRTR LvEF-1a-qRTF LvEF-1a-qRTR LvHem-dsT7F LvHem-dsT7R LvHem-dsF LvHem-dsR GFP-dsT7F GFP-dsT7R GFP-dsF GFP-dsR WSSV32678-qRTF WSSV32753-qRTR TaqMan probeWSSV32706 LvHem-ORFF LvHem-ORFR

CTTCTCGCTCGAGGACGGCA GCCTACAACGAGCTCGGCAC CTCCTCGACGACGACCTCAGG CAACGGGATGTCCAGTTGGTTGG TATTTCACGGACGATTTCACCAA CCCGCCATAGTAAGGCAGTTC TATGCTCCTTTTGGACGTTTTGC CCTTTTCTGCGGCCTTGGTAG TAATACGACTCACTATAGGCACAGCCGAAAATCACTTACAGC TAATACGACTCACTATAGGGGTCCGTGTTGTCCTTGTTGTTG CACAGCCGAAAATCACTTACAGC GGTCCGTGTTGTCCTTGTTGTTG TAATACGACTCACTATAGGATGGTGAGCAAGGGCGAGGAG TAATACGACTCACTATAGGTTACTTGTACAGCTCGTCCATGCC ATGGTGAGCAAGGGCGAGGAG TTACTTGTACAGCTCGTCCATGCC TGTTTTCTGTATGTAATGCGTGTAGGT CCCACTCCATGGCCTTCA CAAGTACCCAGGCCCAGTGTCATACGTT TAGGGATCCATGTCCCGGCTGACTCTGATTTC ATGGTCGACTTATTAAGCGCTGGCGGTTTCCTCC

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

2.5. Immune challenge WSSV was artificially propagated through infection of healthy shrimps and preserved in 80  C in our lab [26]. The virus stock used in this study was prepared from moribund shrimps artificially infected with the preserved WSSV. Briefly, muscle tissues (1 g) from the infected shrimp were homogenized in 10 mL of PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4). After centrifugation at 5000 g for 10 min at 4  C, the supernatant was filtered through a 0.45 mm membrane filter (Millipore, USA) to produce the viral stock. Virus loads of the stock were quantified using absolute quantitative real-time PCR (see below). The stock was further diluted with PBS before use as the experimental inoculum. Healthy L. vannamei were divided into 6 experimental groups and acclimated in seawater tanks at room temperature (27  C) for 7 days. L. vannamei in the 6 groups were separately injected with 106 copies newly extracted WSSV, 106 colony forming units (CFU) of Vibrio parahemolyticus, 106 CFU of S. aureus, 5 mg of lipopolysaccharide (LPS) or 5 mg of Poly(I:C) (all diluted in 50 mL PBS) at the second abdominal segment [26]. At each time point (0, 4, 12, 24, 36, 48, and 72 h post injection), the gill and stomach of challenged L. vannamei were randomly sampled from 5 shrimps in each group. Total RNAs were then isolated using RNeasy Plus Mini Kit (QIAGEN), first cDNA for real-time RT-PCR were synthesized using PrimeScript RT reagent kit With gDNA Eraser (Takara), and expression levels of LvHemolin were calculated as described above. 2.6. Expression and purification of recombinant LvHemolin To obtain recombinant protein, the open reading frame (ORF) of LvHemolin was amplified using specific primers LvHem-ORFF and LvHem-ORFR from the cDNA of L. vannamei and cloned into the pET-32a (þ) (Merck Millipore, Germany) vector. The recombinant plasmid was transformed into Escherichia coli strain Transetta (DE3) Chemically Competent Cells (TransGen, China), which were subsequently induced by 1 mM isopropyl-b-D-thiogalactosidase (IPTG) for expression of recombinant proteins. E. coli was transformed with original pET-32a (þ) vector to express the 6His-tagged Trx protein as the negative control. After induction, competent cells were obtained and cytolyzed by ultrasonic wave in PBS buffer. The 6His-tagged LvHemolin and 6His-tagged Trx proteins were then purified with Ni-NTA agarose (QIAGEN) under native conditions and dialyzed against PBS buffer. The purified proteins were analyzed by Western-blot using mouse anti-6His antibody (Sigma, USA) as the primary antibody. Concentration of the purified protein was determined by Pierce BCA protein assay kit (Thermo Fisher, USA). 2.7. Analysis of the microbe agglutination activity of LvHemolin The microbe agglutination activity of recombinant LvHemolin was analyzed using fluorescein isothiocyanate (FITC) labeled gramnegative becterias V. parahaemolyticus and E. coli and gram-positive becterias S. aureus and Bacillus subtilis. Briefly, mid-logarithmic phase bacteria were harvested and washed with TBS-Ca buffer (50 mM TriseHCl, 100 mM NaCl, 10 mM CaCl2, pH 7.4) three times and resuspended in TBS-Ca2þ buffer (pH 9.4) to 2  108 cells/mL. Bacteria were then incubated with 150 mg/mL FITC for 2 h at 37  C, washed with TBS-Ca2þ (pH 7.4) buffer for three times, and resuspended in TBS-Ca2þ (pH 7.4) buffer at 1  108 cell/mL. The 50 mL of FITC-labeled bacteria were mixed with 25 mL LvHemolin (0.1 mg/ mL) or recombinant Trx protein (0.1 mg/mL) or TBS-Ca2þ buffer (pH 7.4) and incubated at 25  C for 1 h. Agglutination was observed with a Nikon TE2000 microscope (Japan) at 488 nm for FITC. To

53

determine whether the agglutination activity was calciumdependent, FITC-labeled microbe was incubated with LvHemolin in TBS-Ca2þ-EDTA buffer (4 mM EDTA in TBS-Ca2þ buffer, pH 7.4) as described above. 2.8. Knockdown of LvHemolin The expression of LvHemolin was inhibited by RNA interference strategy using in vitro transcribed target-specific dsRNA. The dsRNAs targeting the LvHemolin and green fluorescent protein (GFP, as a negative control) genes were synthesized by in vitro transcription using T7 RiboMAX™ Express RNAi System (Promega, USA). Brifely, the target sequence of LvHemolin (1257 bp) was cloned from the first-strand cDNA of L. vannamei using primers of Hem-dsF and Hem-dsR (Table 1), then two DNA templates with a single T7 polymerase promoter on each 5’-end were cloned from the target sequence using primer pairs of Hem-dsT7F/Hem-dsR and Hem-dsF/Hem-dsT7R, respectively. Based on the two single T7 polymerase promoter templates, two single-strand RNAs were synthesized and annealed to a target-specific double-stranded RNA according to the manufacturer's protocol. The GFP-specific dsRNA (720 bp) was synthesized as the negative control. To verify the RNAi efficiency, healthy L. vannamei (n ¼ 40 in each group) were intramuscularly injected with 5 mg LvHemolin or GFP dsRNA (diluted in 50 mL PBS) or PBS (as control) in the second abdominal segment, respectively. At 48 h post dsRNA injection, stomach and gill were sampled from 9 shrimps in each group for the analysis of LvHemolin expression. The mRNA levels of LvHemolin were detected by real-time RT-PCR as described above and detection was repeated three times, each with RNA pooled from 3 random shrimps in a sample. 2.9. Identification of anti-pathogen activity of LvHomolin To investigate pathogen resistibility of L. vannamei after the interference of LvHemolin, healthy shrimps (n ¼ 50 in each group) were injected with dsRNA or PBS and 48 h later were challenged with 106 copies WSSV CFU or 106 CFU of V. parahaemolyticus diluted in 50 mL PBS and mock-challenged with PBS as a control. Shrimps were kept in culture flasks and cumulative mortalities were recorded every 8 h until 168 h after challenge. Differences of mortalities between LvHemolin-dsRNA, GFP-dsRNA and PBS injected groups were tested for statistical significance using the KaplaneMeier plot (log-rank c2 test) [27,28]. For the WSSV challenge experiments, virus titers in muscle sampled from a parallel challenge experiment were detected as previously described [29,30]. Briefly, muscle tissues were sampled from surviving shrimps at 24, 48, 72, 96 h post infection with 6 shrimps in each sample and subjected to genomic DNA extraction using the DNeasy Blood & Tissue Kit (Qiagen). Quantities of WSSV genome DNA were measured by absolute real-time quantitative PCR using primers of WSSV32678-qRTF, WSSV32753-qRTR and Taqman probe-WSSV32706 (Table 1) which range from 32,678 to 32,753 of the WSSV genome (GenBank accession number AF332093.2) [31]. The standard curve was generated from serial dilutions (109, 108, 107, 106, 105, 104, 103, 102, 101) of plasmid pMD19-T containing the WSSV genomic DNA fragment range from 32,678 to 32,753 which amplified using primers of WSSV32678-qRTF and WSSV32753-qRTR. The WSSV genome copy numbers in 1 mg of muscle template DNA were then calculated. 2.10. Statistical analysis For the statistical analysis, the mean and standard deviation (SD) from three parallel samples were calculated. Student's t-test

54

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

was applied to compare the means of the target and control groups using Microsoft Excel software. Differences were considered to be significant at p < 0.05 and to be highly significant at p < 0.01. The KaplaneMeier plot (log-rank c2 test) was used to analyze the mortality between different groups.

3. Results 3.1. cDNA cloning and sequence analysis of the LvHemolin The full-length of LvHemolin mRNA is 2,977 bp long, with a 33bp 50 -UTR, a 406-bp 30 UTR and a 2538-bp open reading frame (ORF) encoding a protein of 845 amino acids with a calculated molecular weight of 93.2 kDa (GenBank Accession No.: KJ995918) (Supplementary Fig. S1). In the LvHemolin sequence, an O-linked glycosylation and three N-linked glycosylation sites can be predicted. The LvHemolin protein also contains a predicted N-terminal signal peptide consisted of 20 residues and seven putative Igdomains, each of which has two cysteines linked together to fold a globin structure through the intradomain disulfide (SeS) bonds (Supplementary Fig. S2A). Results of homology modeling demonstrated that these seven Ig-domains form a strongly bent “horseshoe” tertiary structure (Supplementary Fig. S2B).

3.2. Bioinformatics analysis of LvHemolin All of the reported insect Hemolin proteins were phylogenetically analyzed by the neighbor-joining (NJ) method (Fig. 1). Phylogenetic tree showed that LvHemolin is mostly clustered with these insect Hemolins. Multiple sequence alignment indicated that LvHemolin shows high homology with insect Hemolins (Fig. 2). LvHemolin shares 27.1% identity with Hemolin form Hyphantria cunea, 30.2% with H. virescens, 29.7% with H. zea, and 30.0% with Galleria mellonella. The conserved sequences mainly cover the last four Ig-domains of Hemolin which contain eight high conserved cysteine residues.

3.3. Tissue distribution of LvHemolin mRNA Tissue distribution of LvHemolin mRNA in L. vannamei was analyzed by real-time RT-PCR. The mRNA of LvHemolin could be detected in all the tissues examined. The relative expression levels of LvHemolin in other tissues were normalized to that in hemocytes, which was set as baseline (1.0). The results demonstrated that LvHemolin was rarely expressed in hepatopancreas and nerve with expression levels of 5% and 19% of the baseline, respectively. The expression of LvHemolin in intestine, eyestalk, muscle, epithelium, pyloric cecum, scape, heart, gill, and stomach was higher than that in hemocytes (Fig. 3). Notably, the highest expression levels of LvHemolin were detected in gill and stomach, which were 63.2- and 287.6-fold over that in hemocytes, respectively. 3.4. Expression of LvHemolin after pathogen and stimulant challenges Expression of LvHemolin in gill and stomach after pathogen and stimulant challenges was detected by real-time RT-PCR (Fig. 4). In gill, LvHemolin expression was rapidly increased and reached the highest level of 10.4-fold (over the baseline) at 12 hpi (hours post injection), then continuously decreased until to the lowest level of 0.36-fold at 72 hpi after the stimulation of WSSV. After the V. parahemolyticus stimulation, expression of LvHemolin was increased to the highest level of 10.31-fold at 12 hpi, decreased to 2.2-fold at 24 hpi, and increased again to 8.8-fold at 36 hpi, then continuously decreased until to 4.3-fold at 72 hpi. In response to S. aureus, expression of LvHemolin was rapidly increased to 5.5 fold at 4 hpi and sustained around this level until 36 hpi, then continuously decreased to 0.34-fold before it increased again to the highest level of 9.9-fold at 72 hpi. After the stimulation of LPS and Poly(I:C), expression of LvHemolin was continuously increased and reached the highest level of 7.1-fold and 5.2-fold at 24 hpi, respectively, both followed by decrease to the baseline level after 48 hpi. Similarly, in stomach, expression of LvHemolin was rapidly

Fig. 1. Phylogenetic tree of Hemolin from different species. The sequences were obtained from the GeneBank database, and their GeneBank accession numbers are as follow: Hyalophora cecropia: AAB34817.1, Samia ricini: BAE07175.1, Antheraea pernyi: AAS99343.1, Lonomia oblique: ABF21070.1, Manduca sexta: AAC46916.1, Bombyx mori: AAZ03611.1, Bombyx mandarina: AAS00446.1, Danaus plexippus: EHJ68008.1, Galleria mellonella: ACU09501.1, Pseudoplusia includes: AAV41247.1, Hyphantria cunea: AAD09287.1, Helicoverpa zea: ACC91898.1, Heliothis virescens: ACC91897.1.

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

55

Fig. 2. Multiple sequence alignment of Hemolin. The seven Ig-domains of LvHemolin were underlined and cysteine residues in each Ig-domain were boxed.

increased to the highest level of 5.9-fold and sharply decreased below the baseline after 24 hpi. After the V. parahemolyticus stimulation, expression of LvHemolin was increased to 2.9-fold at 4 hpi, and continuously decreased until to 0.6-fold at 24 hpi, then increased again to the highest level of 4.4-fold at 36 hpi, and after that it was rapidly decreased below the normal level. In response to S. aureus, LvHemolin expression was slightly increased to 1.7-fold at 4 hpi and fluctuated around the baseline after 4 hpi. After the stimulation of LPS and Poly(I:C), expression of LvHemolin were fluctuated around the baseline before 48 hpi, then it was decreased to 0.09-fold and 0.07-fold at 72 hpi, respectively. 3.5. Recombinant expression and purification of LvHemoin

Fig. 3. Tissue distribution of LvHemolin mRNA in L. vannamei. Real-time RT-PCR was performed in triplicate for each sample. Expression level in the hemocyte was used as control and set to 1.0. Expression values were normalized to those of LvEF-1a using the Livak (2DDCt) method and the data were provided as the mean fold changes (means ± SD, n ¼ 3) relative to the control group.

The recombinantly expressed LvHemolin was analyzed by SDSPAGE and purified by Ni-affinity chromatography under native conditions. Coomassie Bright Blue R250 staining revealed that the recombinant LvHemolin was remarkably expressed after the induction of IPTG (Fig. 5A) and successfully purified under native condition (Fig. 5B). The purified proteins were verified by Westernblot analysis using monoclonal antibody against the 6His tag, which showed a specific band consistent with the predicted molecular weight of the recombinant LvHemolin (~113.6 kDa) and Trx protein (~20.4 kDa), respectively (Fig. 5C).

56

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

specific dsRNA. Real-time RT-PCR analysis verified that compared with the PBS and GFP-dsRNA injection groups, the level of LvHemolin mRNA in the LvHemolin-dsRNA injection group was remarkably decreased by 95.4% and 94.3% in gill, and 99.4% and 99.6% in stomach at 48 hpi, respectively (Fig. 7A). Experimental shrimps were challenged with WSSV or V. parahemolyticus at 48 h post dsRNA injection. The cumulative mortality of the LvHemolin dsRNA injected group was increased rapidly from 2.5 d and reached 100% at 5.5 d after WSSV challenge, which was significantly higher than the GFP-dsRNA group (Fig. 7C). After WSSV challenge, the final mortality rates of the LvHemolin-dsRNA, GFP-dsRNA, and PBS treatment groups were 100%, 70%, and 85%, respectively. WSSV genomic copies in muscle were detected at 24 h, 48 h, 72 h, and 96 h post WSSV challenge (Fig. 7B). Absolute quantitative RT-PCR results revealed that the WSSV genomic copies were significantly increased in the LvHemolin-dsRNA group compared with GFPdsRNA and PBS groups at each detection point. In detail, the increasing rate of WSSV genomic copies in the LvHemolin-dsRNA groups at 24, 48, 72 and 96 h were 4.3-, 10.5-, 20.4-, and 160.6-fold over the GFP-dsRNA group, and 2.59-, 15.8-, 2.0-, and 1.6-fold over the PBS group, respectively. Similarly, dsRNA-injected shrimps were also challenged with V. parahemolyticus at 48 h post dsRNA injection, and the mortality rate was recorded for a period of 5 d at every 4 h after challenge (Fig. 7D). At 0.5 d post V. parahemolyticus challenge, the cumulative mortality of the LvHemolin dsRNA injected group was increased rapidly compared to the two control groups. At 2 d after V. parahemolyticus challenge, the cumulative mortalities of all the three groups were stabilized until the end of the experiments. The final mortality rates were 58.8%, 26.3%, and 40.5% for the LvHemolin-dsRNA, GFP-dsRNA, and PBS groups, respectively. 4. Discussion

Fig. 4. Expression profiles of LvHemolin in gill (A) and stomach (B) from pathogens or stimulants challenged L. vannamei. Expression values were normalized to those of LvEF-1a using the Livak (2DDCt) method and the data were provided as the mean fold changes (means ± SD, n ¼ 3) relative to the control group (*p < 0.05, **p < 0.01). Expression level detected at 0 h post injection of each group was set as 1.0.

3.6. Microbe agglutination activity of LvHemolin To assess the agglutination activity of LvHemolin, FITC-labbled bacteria were incubated with recombinant LvHemolin protein (0.5 mg/mL) in the presence of Ca2þ with or without EDTA. Gramnegative bacteria V. parahaemolyticus and E. coli and gram-positive bacteria S. aureus and B. subtilis could be agglutinated by recombinant LvHemolin and the agglutination could be abolished when the Ca2þ was chelated with EDTA (Fig. 6). The control groups treated with the control Trx protein had no bacterial agglutination activity.

3.7. Silencing of LvHemolin during pathogen infection To investigate the immune function of LvHemolin in vivo, expression of LvHemolin was knockdown by LvHemolin sequence

Since Hemolin was firstly identified in Hyalophora cecropia, more and more homologs of Hemolin have been sequentially cloned from other lepidopterans [17]. In this study, we cloned a homologous protein of Hemolin from L. vannamei, the first Hemolin in crustaceans to be reported. The size of the LvHemolin protein is larger than those of insect Hemolins. Hemolins from insects are mainly composed of four Ig-domains forming a horseshoe shape in tertiary structure [13,16]. In contrast, LvHemolin is mainly composed of seven Ig-domains, the last four of which share high identity with insect Hemolins. The other three Ig-domains might indicate the additional feature of LvHemolin that is different from that of insect Hemolin. The predicted tertiary structure of LvHemolin could form a globular structure which is similar to the horseshoe shape formed by the four Ig-domains of insect Hemolins [15,16]. This may imply that LvHemolin possesses similar function with the Hemolin from insects. Hemolin was expressed in all development stages of Lepidopterous insects [6,7,9,10], and mainly existed in fat body, hemolymph, and midgut, which are the important immune organs in defense of micro-invasions [17]. In this study, we observed that LvHemolin was high expressed in the stomach, moderately expressed in gill, heart, scape, pyloric cecum, epithelium, and muscle. The stomach, gill, and pyloric cecum are important organs of L. vannamei, which directly encounter the invasive microorganisms. This may indicate that LvHemolin plays an immune function in these tissues. It has been reported that Hemolin can be activated by challenge with bacteria, fungi, and virus in insects [14,19,22,32]. Although Hemolin may not target the microorganisms directly, it works as an opsonin to accelerate the agglutination of microorganisms and promote the phagocytosis of hemocytes [8]. In this study, we observed that the mRNA level of LvHemolin was

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

57

Fig. 5. Analysis of the recombinant LvHemolin protein. (A) SDS-PAGE analysis of the expression of LvHemolin in E. coli. Line 1: uninduced E. coli cells harboring pET-32a; Line 2: uninduced E. coli cells harboring pET-32a-LvHemolin; Line 3: induced E. coli cells harboring pE-T32a; Line 4: induced E. coli cells harboring pET-32a-LvHemolin. (B) SDS-PAGE analysis of purified recombinant protein. Line 1: 6His-tagged Trx; Line 2: 6His-tagged LvHemolin. (C) Western-blot analysis of the purified LvHemolin and Trx protein using anti-6His antibody. Line 1: 6His-tagged Trx; Line 2: 6His-tagged LvHemolin. White arrow: recombinant LvHemolin protein (~113.6 kDa); Black arrow: Trx protein (~20.4 kDa).

increased both in gill and stomach after challenge with WSSV and bacteria, including V. parahemolyticus (Germ-negative) and S. aureus (Germ-positive), suggesting that Hemolin could be activated during the immune responses of L. vannamei. However, the tendencies of the expression patterns of LvHemolin in responses to different pathogens or immune stimulants were different, which may reflect different levels of LvHemolin activation during different pathogen infections. The distinct function of LvHemolin in shrimp

anti-pathogen immunity induced by various stimulants requires further investigation. After knockdown of Hemolin, Manduca sexta was easier infected by Photorhabdus luminescens TT01 [33,34]. Meanwhile, silence of Hemolin inhibited microaggregation of the invaded bacteria triggered by hemolymph [35]. On the other hand, overexpression of Hemolin could significantly increase the phagocytosis of bacteria and yeast in the hemolymph of M. sexta and tumor-like

Fig. 6. Aggregation of the microbes by recombinant LvHemolin protein. FITC-labbled gram-negative bacteria V. parahaemolyticus and E. coli and gram-positive bacteria S. aureus and B. subtilis were treated with purified recombinant LvHemolin or Trx (as control) protein in the presence of Ca2þ with or without EDTA.

58

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59

Fig. 7. Cumulative mortality of L. vannamei treated with dsRNA injection followed by experimental infection with WSSV or V. parahemolyticus. (A) real-time RT-PCR analysis of mRNA level of LvHemolin after dsRNA injection. LvEF-1a was used as the internal control to normalize expression values. (B) WSSV genome copies in muscle tissues after WSSV challenge. Each bar represents the mean ± SD of three samples (*p < 0.05, **p < 0.01). (C and D) L. vannamei (n ¼ 40) were intramuscularly infected with PBS, GFP-dsRNA, or LvHemolin-dsRNA. At 48 h post injection, shrimps were infected with WSSV (C) or V. parahemolyticus (D), and PBS (negative control). Cumulative mortality was recorded every 4 h. Differences in cumulative mortality levels between treatments were analyzed by KaplaneMeier log-rank c2 tests.

hemolymph of Drosophila melanogaster [34,35]. Baculoviruses, a family of double-stranded DNA (dsRNA) viruses that mainly infect insects, in particular Lepidoptera, exhibit a generally narrow host specificity [36]. In Lepidoptera, only larvae can be infected by baculoviruses, and as the larvae age, they become increasingly resistant to fatal baculovirus infection, along with the increase of Hemolin expression [15,37]. Furthermore, Hemolin in Antheraea pernyi could be induced after injection or feeding with baculovirus [10]. Interestingly, the expression of Hemolin and anti-baculovirus ability of A. pernyi were activated after the low dose (0.005 mg/mL) of Hemolin specific dsRNA injection (dsHemolin) [38,39]. However, the anti-baculovirus ability of A. pernyi was remarkably suppressed along with the suppression of Hemolin induced by the high dose (10 mg/mL) of Hemolin specific dsRNA injection [40,41]. These data may suggest that Hemolin could be induced by dsRNA or dsRNA virus, and may be putatively involved in the anti-viral responses. In this study, to determine the function of LvHemolin during WSSV infection, LvHemolin was silenced by RNA interference strategy. The results demonstrated that suppression of the expression of LvHemolin would significantly increase the mortality caused by WSSV. Moreover, the WSSV genome copies in muscle were significantly increased after the silence of LvHemolin. These indicate that the LvHemolin may play an important role in shrimp antiviral responses. Growing evidence proved that instead of displaying direct antibacterial activity, Hemolin of insects could bind to the surface of hemocytes and to bacteria at the presence of Ca2þ, and promote the phagocytosis performed by phagocytes [8,14,16,21]. In this study, we proved that the recombinant LvHemolin protein can agglutinate both Gram-positive and Gram-negative bacteria at the presence of Ca2þ. We also observed that suppression of LvHemolin expression could cause significantly increased mortality of L. vannamei after V. parahemolyticus infection. These results demonstrated that LvHemolin could accelerate the agglutination of bacteria and might promote phagocytosis against invaders, pointing to an involvement

of LvHemolin in shrimp antibacterial defense, which needs further investigation. As LvHemolin is the first identified Hemolin in crustaceans, our study suggests a role of LvHemolin in the immune response of L. vannamei, which may further promote the research on the immunity of this kind of important aquaculture shrimp. Further study should be performed to investigate the function of LvHemolin in shrimp immune system including how does LvHemolin is activated by the pathogens, is there any other biological process does LvHemolin take part in, what is the exact role of LvHemolin played in the antiviral processes, and is there any other isoforms exists in the L. vannemei. In a word, the function of LvHemolin in the immune defenses of L. vannamei is worthy of in-depth study. Acknowledgments This research was supported by National Natural Science Foundation of National Basic Research Program of China (973 program) 2012CB114401; National Key Technology R&D program (2012BAD17B03); China Agriculture Research System (47); and the Open Project of the State Key Laboratory of Biocontrol (SKLBC13KF06). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.12.004. References [1] Wang Z, Yan C, Yan Y, Chi Q. Integrated assessment of biomarker responses in caged shrimps (Litopenaeus vannamei) exposed to complex contaminants from the Maluan Bay of China. Ecotoxicology 2012;21:869e81.

H. Zuo et al. / Fish & Shellfish Immunology 43 (2015) 51e59 [2] Shockey JE, O'Leary NA, de la Vega E, Browdy CL, Baatz JE, Gross PS. The role of crustins in Litopenaeus vannamei in response to infection with shrimp pathogens: an in vivo approach. Dev Comp Immunol 2009;33:668e73. [3] Lin YC, Chen JC, Li CC, Morni WZ, Suhaili AS, Kuo YH, et al. Modulation of the innate immune system in white shrimp Litopenaeus vannamei following long-term low salinity exposure. Fish Shellfish Immunol 2012;33:324e31. [4] Faye I, Pye A, Rasmuson T, Boman HG, Boman IA. Insect immunity. 11. Simultaneous induction of antibacterial activity and selection synthesis of some hemolymph proteins in diapausing pupae of Hyalophora cecropia and Samia cynthia. Infect Immun 1975;12:1426e38. [5] Sun SC, Lindstrom I, Boman HG, Faye I, Schmidt O. Hemolin: an insectimmune protein belonging to the immunoglobulin superfamily. Science 1990;250:1729e32. [6] Kanost MR, Zepp MK, Ladendorff NE, Andersson LA. Isolation and characterization of a hemocyte aggregation inhibitor from hemolymph of Manduca sexta larvae. Arch Insect Biochem Physiol 1994;27:123e36. [7] Dunn PE, Bohnert TJ, Russell V. Regulation of antibacterial protein synthesis following infection and during metamorphosis of Manduca sexta. Ann N Y Acad Sci 1994;712:117e30. [8] Lanz-Mendoza H, Bettencourt R, Fabbri M, Faye I. Regulation of the insect immune response: the effect of hemolin on cellular immune mechanisms. Cell Immunol 1996;169:47e54. [9] Bettencourt R, Assefaw-Redda Y, Faye I. The insect immune protein hemolin is expressed during oogenesis and embryogenesis. Mech Dev 2000;95:301e4. [10] Lee KY, Horodyski FM, Valaitis AP, Denlinger DL. Molecular characterization of the insect immune protein hemolin and its high induction during embryonic diapause in the gypsy moth, Lymantria dispar. Insect Biochem Mol Biol 2002;32:1457e67. [11] Lindstrom-Dinnetz I, Sun SC, Faye I. Structure and expression of Hemolin, an insect member of the immunoglobulin gene superfamily. Eur J Biochem 1995;230:920e5. [12] Wang Y, Willott E, Kanost MR. Organization and expression of the hemolin gene, a member of the immunoglobulin superfamily in an insect, Manduca sexta. Insect Mol Biol 1995;4:113e23. [13] Bao Y, Yamano Y, Morishima I. Induction of hemolin gene expression by bacterial cell wall components in eri-silkworm, Samia cynthia ricini. Comp Biochem Physiol B Biochem Mol Biol 2007;146:147e51. [14] Ladendorff NE, Kanost MR. Bacteria-induced protein P4 (hemolin) from Manduca sexta: a member of the immunoglobulin superfamily which can inhibit hemocyte aggregation. Arch Insect Biochem Physiol 1991;18:285e300. [15] Yu XQ, Kanost MR. Developmental expression of Manduca sexta hemolin. Arch Insect Biochem Physiol 1999;42:198e212. [16] Su XD, Gastinel LN, Vaughn DE, Faye I, Poon P, Bjorkman PJ. Crystal structure of hemolin: a horseshoe shape with implications for homophilic adhesion. Science 1998;281:991e5. [17] Ladendorff NE, Kanost MR. Isolation and characterization of bacteria-induced protein P4 from hemolymph of Manduca sexta. Arch Insect Biochem Physiol 1990;15:33e41. [18] Roxstrom-Lindquist K, Lindstrom-Dinnetz I, Olesen J, Engstrom Y, Faye I. An intron enhancer activates the immunoglobulin-related Hemolin gene in Hyalophora cecropia. Insect Mol Biol 2002;11:505e15. [19] Aye TT, Shim JK, Rhee IK, Lee KY. Upregulation of the immune protein gene hemolin in the epidermis during the wandering larval stage of the Indian meal moth, Plodia interpunctella. J Insect Physiol 2008;54:1301e5. [20] Bettencourt R, Gunne H, Gastinel L, Steiner H, Faye I. Implications of hemolin glycosylation and Ca2þ-binding on homophilic and cellular interactions. Eur J Biochem 1999;266:964e76. [21] Yu XQ, Kanost MR. Binding of hemolin to bacterial lipopolysaccharide and lipoteichoic acid. An immunoglobulin superfamily member from insects as a pattern-recognition receptor. Eur J Biochem 2002;269:1827e34. [22] Terenius O, Bettencourt R, Lee SY, Li W, Soderhall K, Faye I. RNA interference of Hemolin causes depletion of phenoloxidase activity in Hyalophora cecropia. Dev Comp Immunol 2007;31:571e5.

59

[23] Li C, Weng S, Chen Y, Yu X, Lu L, Zhang H, et al. Analysis of Litopenaeus vannamei transcriptome using the next-generation DNA sequencing technique. PLoS One 2012;7:e47442. [24] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28: 2731e9. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: 402e8. [26] Ai HS, Huang YC, Li SD, Weng SP, Yu XQ, He JG. Characterization of a prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is down-regulated by white spot syndrome virus. Fish Shellfish Immunol 2008;25:28e39. [27] Alberti C, Timsit JF, Chevret S. Survival analysis e the log rank test. Rev Mal Respir 2005;22:829e32. [28] Ziegler A, Lange S, Bender R. Survival analysis: log rank test. Dtsch Med Wochenschr 2007;132(Suppl. 1):e39e41. [29] Chen YH, Zhao L, Pang LR, Li XY, Weng SP, He JG. Identification and characterization of Inositol-requiring enzyme-1 and X-box binding protein 1, two proteins involved in the unfolded protein response of Litopenaeus vannamei. Dev Comp Immunol 2012;38:66e77. [30] Li C, Chen Y, Weng S, Li S, Zuo H, Yu X, et al. Presence of Tube isoforms in Litopenaeus vannamei suggests various regulatory patterns of signal transduction in invertebrate NF-kappaB pathway. Dev Comp Immunol 2014;42: 174e85. [31] Qiu W, Zhang S, Chen YG, Wang PH, Xu XP, Li CZ, et al. Litopenaeus vannamei NF-kappaB is required for WSSV replication. Dev Comp Immunol 2014;45: 156e62. [32] Terenius O, Popham HJ, Shelby KS. Bacterial, but not baculoviral infections stimulate Hemolin expression in noctuid moths. Dev Comp Immunol 2009;33:1176e85. [33] Eleftherianos I, Marokhazi J, Millichap PJ, Hodgkinson AJ, Sriboonlert A, Ffrench-Constant RH, et al. Prior infection of Manduca sexta with nonpathogenic Escherichia coli elicits immunity to pathogenic Photorhabdus luminescens: roles of immune-related proteins shown by RNA interference. Insect Biochem Mol Biol 2006;36:517e25. [34] Eleftherianos I, Millichap PJ, Ffrench-Constant RH, Reynolds SE. RNAi suppression of recognition protein mediated immune responses in the tobacco hornworm Manduca sexta causes increased susceptibility to the insect pathogen Photorhabdus. Dev Comp Immunol 2006;30:1099e107. [35] Eleftherianos I, Gokcen F, Felfoldi G, Millichap PJ, Trenczek TE, FfrenchConstant RH, et al. The immunoglobulin family protein Hemolin mediates cellular immune responses to bacteria in the insect Manduca sexta. Cell Microbiol 2007;9:1137e47. [36] Hughes AL. Evolution of inhibitors of apoptosis in baculoviruses and their insect hosts. Infect Genet Evol 2002;2:3e10. [37] Kirkpatrick BA, Washburn JO, Volkman LE. AcMNPV pathogenesis and developmental resistance in fifth instar Heliothis virescens. J Invertebr Pathol 1998;72:63e72. [38] Hirai M, Terenius O, Li W, Faye I. Baculovirus and dsRNA induce Hemolin, but no antibacterial activity, in Antheraea pernyi. Insect Mol Biol 2004;13: 399e405. [39] Nishikawa T, Natori S. Targeted disruption of a pupal hemocyte protein of Sarcophaga by RNA interference. Eur J Biochem 2001;268:5295e9. [40] Bettencourt R, Terenius O, Faye I. Hemolin gene silencing by ds-RNA injected into Cecropia pupae is lethal to next generation embryos. Insect Mol Biol 2002;11:267e71. [41] Robalino J, Browdy CL, Prior S, Metz A, Parnell P, Gross P, et al. Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J Virol 2004;78:10442e8.