Identification and functional characterization of alpha-enolase from Taenia pisiformis metacestode

Acta Tropica 144 (2015) 31–40

Contents lists available at ScienceDirect

Acta Tropica journal homepage: www.elsevier.com/locate/actatropica

Identification and functional characterization of alpha-enolase from Taenia pisiformis metacestode Shaohua Zhang a , Aijiang Guo a , Xueliang Zhu a , Yanan You a , Junling Hou a , Qiuxia Wang b , Xuenong Luo a,∗ , Xuepeng Cai a,∗ a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China b Henan Institute of Science and Technology, Xinxiang 453003, China

a r t i c l e

i n f o

Article history: Received 17 June 2014 Received in revised form 13 January 2015 Accepted 17 January 2015 Available online 23 January 2015 Keywords: Taenia pisiformis metacestode Enolase Calcareous corpuscles Plasminogen binding

a b s t r a c t Enolase belongs to glycolytic enzymes with moonlighting functions. The role of enolase in Taenia species is still poorly understood. In this study, the full length of cDNA encoding for Taenia pisiformis alpha-enolase (Tpeno) was cloned from larval parasites and soluble recombinant Tpeno protein (rTpeno) was produced. Western blot indicated that both rTpeno and the native protein in excretion–secretion antigens from the larvae were recognized by anti-rTpeno monoclonal antibodies (MAbs). The primary structure of Tpeno showed the presence of a highly conserved catalytic site for substrate binding and an enolase signature motif. rTpeno enzymatic activities of catalyzing the reversible dehydration of 2-phosphoglycerate (2PGA) to phosphoenolpyruvate (PEP) and vice versa were shown to be 30.71 ± 2.15 U/mg (2-PGA to PEP) and 11.29 ± 2.38 U/mg (PEP to 2-PGA), respectively. Far-Western blotting showed that rTpeno could bind to plasminogen, however its binding ability was inhibited by -aminocaproic acid (ACA) in a competitive ELISA test. Plasminogen activation assay showed that plasminogen bound to rTpeno could be converted into active plasmin using host-derived activators. Immunohistochemistry and immunofluorescence indicated that Tpeno was distributed in the bladder wall of the metacestode and the periphery of calcareous corpuscles. In addition, a vaccine trial showed that the enzyme could produce a 36.4% protection rate in vaccinated rabbits against experimental challenges from T. pisiformis eggs. These results suggest that Tpeno with multiple functions may play significant roles in the migration, growth, development and adaptation of T. pisiformis for survival in the host environment. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Taenia pisiformis is an ancient cestode parasite. The natural life cycle of this parasite includes canines as normal definitive hosts and lagomorphs as typical intermediate hosts (Loos-Frank, 2000). Cysticercus pisiformis, the larval stage of T. pisiformis, can cause socio-economic losses in rabbit breeding and serious health problems to the host, such as liver lesions, digestive disorders, growth

Abbreviations: TpM, Taenia pisiformis metacestodes; Tpeno, Taenia pisiformis enolase; RACE, rapid amplification of cDNA ends; UTR, untranslated region; MAb, monoclonal antibody; SDS–PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; BSA, bovine serum albumin; ACA, aminocaproic acid; 2-PGA, 2-phospho-D-glycerate; PEP, phosphoenolpyruvate; TMB, 3,3 ,5,5 -tetramethylbenzidine; DAB, 3,3 -diaminobenzidine; ELISA, enzymelinked immunosorbent assay; IHC, immunohistochemistry; IFA, indirect immunofluorescence assay. ∗ Corresponding authors. Tel.: +86 931 8342716; fax: +86 931 8340977. E-mail addresses: [email protected] (X. Luo), [email protected] (X. Cai). http://dx.doi.org/10.1016/j.actatropica.2015.01.007 0001-706X/© 2015 Elsevier B.V. All rights reserved.

retardation, weight loss, and even death (Rajasekariah et al., 1985; Sun and Cai, 2008). T. pisiformis is also regarded as an alternate experimental model for studying the protein functions of tapeworms in vaccine trials and in the evaluation of novel anti-cestode drugs (Toral-Bastida et al., 2011). Similar to other parasitic cestodes, T. pisiformis lives in the digestive tract of the host and depends solely on its tegument for the acquisition of nutrition (Dalton et al., 2004). Under this condition, anaerobic glycolysis is considered as the principal way by which T. pisiformis obtains energy which is essential for certain activities of the parasite, such as growth, development, and survival in the host (Yang et al., 2012). Thus, further characterization of the glycolytic enzymes and selective inhibitors may boost the development of new potential therapeutic targets for treating parasitic infections. Enolase (2-phospho-D-glycerate hydrolase, EC4.2.1.11) is a ubiquitous glycolytic enzyme involved in the glycolysis and gluconeogenesis pathways that catalyzes the reversible dehydration conversion of 2-phosphoglyceric acid (2-PGA) into phosphoenolpyruvate (PEP), which is an important metabolic intermediate

32

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

for the production of ATP and NADH (Pancholi, 2001; Rodriguez et al., 2006). Copley (2003) has stated that enolase acquires moonlighting functions in organisms when the protein changes its cellular localization. In addition to its innate glycolytic activity, enolase may play important roles in a variety of biological and pathophysiological processes by acting, for example, as a virulence factor (Li et al., 2013; Pancholi and Fischetti, 1998), hypoxic stress protein (Subramanian and Miller, 2000), and/or heat shock protein (Iida and Yahara, 1985). Most of the information on enolase from parasites has been obtained from protozoa (Kibe et al., 2005; Navarro et al., 2007; Tovy et al., 2010) and helminthes (Liu et al., 2009; Ramajo-Hernandez et al., 2007). It is reported that enolase is involved not only in the regulation of gene transcription and expression during protozoa development (Ferguson et al., 2002; Holmes et al., 2010), but also in the encystation process (Chavez-Munguia et al., 2011; Segovia-Gamboa et al., 2010). In Clonorchis sinensis, the inhibition of enolase by excretory/secretory products could affect parasite growth (Wang et al., 2011). From this perspective, parasitic enolase, with its multiple biological functions, seems to be a suitable candidate for chemotherapeutic purposes. There have been few similar studies on tapeworm enolase in the pathophysiological processes of parasitic invasion compared with other parasites. In this study, we identified and characterized the expression, enzymatic characteristics, interaction with the host plasminogen system, localization and protective efficacy in anticestode infections of the Tpeno protein. 2. Materials and methods 2.1. Animals and parasites T. pisiformis metacestodes (TpM) used in this study were obtained from naturally infected rabbits at local abattoirs in Zhengzhou, Henan Province, China. The freshly separated metacestodes were prepared using the following procedure: (i) some metacestodes were immediately immersed in RNAlater (Qiagen, Germany) and stored at −70 ◦ C for RNA extraction; (ii) other larvae were fixed in 10% neutral formalin and embedded in paraffin according to routine histological procedures for immunohistochemical analysis. Three T. pisiformis adult worms were recovered during necropsy from a hybrid dog raised in a rabbit farm in Zhengzhou, Henan Province, China. BALB/c mice and 4-month-old rabbits were prepared for the immunological trial at the Laboratory Animal Center of Lanzhou Veterinary Research Institute. The animal experimental protocol reported herein was carried out in strict accordance with the recommendations of The Animal Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. 2.2. Calcareous corpuscles and excretion–secretion (E/S) antigens The TpM were sterilely grinded on a metal screen with the plunger of a 5 ml syringe, followed by repeated centrifugation and rinsing of the pellets. Calcareous corpuscles were purified using Ficoll-paque plus (Sigma, USA), examined by light microscopy (Yang, 2000), and then immersed in a fixative solution (containing 60% acetone, 40% methanol) overnight at 4 ◦ C for the immunofluorescence experiment. The E/S antigens from TpM were prepared according to the method described by Victor et al. (2012). After washing thoroughly in sterile saline, 68 cysts with intact bladder walls were incubated in 20 ml RPMI-1640 medium (containing 2 mM L-glutamine, 100 U/ml penicillin, 100 ␮g/ml streptomycin, 1% D-glucose, pH 7.2) for 6 h at 37 ◦ C in an atmosphere of 5% CO2 and their growth state was observed. The culture media were collected

after 48 h and centrifuged at 3000 × g for 15 min, then concentrated to a final volume of about 0.8 ml with an Amicon Ultra-15 (3 kDa) centrifugal filter device (Millipore, USA). 2.3. Amplification of full-length cDNA encoding T. pisiformis enolase (Tpeno) Total RNA was extracted from frozen TpM using Trizol reagent (Invitrogen, USA) and used immediately for cDNA synthesis using an MMLV first strand kit (Invitrogen, USA) according to the manufacturer’s instructions. The primers used in the initial amplification of the partial Tpeno cDNA fragment by RT-PCR were designed from the highly conserved regions of Echinococcus granulosus and Taenia asiatica enolase genes (GenBank accession numbers GU080332 and EF420377). All primers used in PCR amplifications are listed in Table 1. PCR reactions for the partial Tpeno cDNA fragment were performed in a 50 ␮l reaction mixture containing 25 ␮l 2× Master Mix (Biomiga, San Diego, CA, USA), 1 ␮l cDNA, 1 ␮l of each primer, and 12 ␮l H2 O. The optimal PCR program was as follows: initial denaturation at 94 ◦ C for 5 min, followed by 35 cycles of denaturation at 94 ◦ C for 1 min, annealing at 58 ◦ C for 45 s, extension at 72 ◦ C for 1.5 min and finally incubation at 72 ◦ C for 10 min. The PCR products were gel-purified, cloned into pGEM-T vector (Promega, Madison, WI, USA), and transformed into Escherichia coli DH5a cells (Tiangen, China). Finally, plasmid clones were sequenced by Shanghai Sangon Biotechnology Company. Following the defined partial sequence of the Tpeno gene, the full-length cDNA was obtained by 5 - and 3 -RACE-PCRs using the SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA). The gene-specific primers GSP1 and GSP2 are shown in Table 1. For 5 -RACE and 3 -RACE, the synthesized adaptor-ligated, oligo(dT)-primed, double-stranded cDNA and 10× universal primer mix (UPM) provided with the RACE kit were used for the RACE-PCR reaction according to the manufacturer’s instructions. The enolase sequence analysis was conducted using online servers, including ProtParam, MEME, NetNGlyc 2.0, SignalP 4.0, and SecretomeP 2.0. 2.4. Expression and purification of recombinant Tpeno (rTpeno) in E. coli The predicted open reading frame (ORF) region of Tpeno was PCR-amplified with Tp1 and Tp2 primers containing SacI and XhoI restriction enzyme sites, respectively (Table 1). The specific PCR product was cloned into pET32a vector (Invitrogen, Grand Island, NY, USA) following enzyme digestion. The correct coding sequences containing ORF and the three upstream tags (Trx-tag, S-tag, His-tag) were confirmed by DNA sequencing, and then Table 1 PCR primers used for Taenia pisiformis alpha-enolase analysis. Primers

Sequence (5 –3 )

Cloning for partial sequence 5 -GGAAATCCTACTGTTGAGGTT-3 Tp F Tp R 5 -TTACAAAGGATTGCGGAAGTG-3 5 -RACE 5 -TCCAGGCGGGCCAGTCATC-3 GSP1 3 -RACE 5 -GTCCCTGGGTCGAAGCTGG-3 GSP2 10× UPM 5 CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT3 Expression analysis 5 -CGAGCTC ATGTCAATCCAAAATATTCATGC-3 Tp1 SacI Tp2 5 -CCG CTCGAGTTACAAAGGATTGCGGAAGT-3 XhoI The underlined sequences are enzyme restriction sites.

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

transformed into E. coli Rosetta (DE3) (Tiangen, China). The fusion protein was expressed in Luria Bertani medium (LB) containing kanamycin (50 ␮g/ml) by induction with 0.2 mM isopropyl-␤D-thiogalactoside (IPTG) at 20 ◦ C overnight. The bacteria were harvested by centrifugation, resuspended in PBS and then sonicated. His-tagged rTpeno was purified with Ni sepharose 6 FF resin (GE Healthcare, Pittsburgh, PA, USA) according to the manufacturer’s instructions. To rule out the reactive possibility of the His tag protein contained in rTpeno, a His-tagged protein (His-Ts18, a glycoprotein cloned and expressed from Taenia solium) was used as a negative control while analysing enzyme activity and plasminogenbinding activities of the rTpeno protein. The Protein content of rTpeno was quantified using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). 2.5. Production of monoclonal antibodies (MAbs) BALB/c mice were administered a first dose consisting of 100 ␮g of the purified rTpeno antigen with Freund’s complete adjuvant (Sigma, St. Louis, MO, USA) by subcutaneous injection. The procedure was repeated after 3 weeks with Freund’s incomplete adjuvant (Sigma, USA). Three days before the fusion, the mice were intraperitoneally boosted with 100 ␮g of antigen in PBS. Mice that developed the strong IgG response against rTpeno were selected for fusion studies. Spleen cells from the mice were fused with SP2/0 myeloma cells. Hybridomas reacting positively with rTpeno were selected using the enzyme-linked immunosorbent assay (ELISA) and cloned by limit dilution at least twice. Subclass analysis was determined using an IsoStrip mouse MAb isotyping kit (Roche, Swiss) and the antibodies were purified using HiTrap Protein G HP columns (GE Healthcare, Pittsburgh, PA, USA) according to the respective manufacturer’s instructions. 2.6. Analysis of enzyme activity The rTpeno activity was determined according to the PEP absorbance change at 240 nm (A240 ) in a direct spectrophotometric assay (Wold and Ballou, 1957). The conversions of 2-PGA to PEP (forward direction) and PEP to 2-PGA (reverse direction) were continuously monitored on a UV-2550 spectrophotometer (Shimadzu, Japan) at 20 s intervals for a period of 3 min. This enzymatic reaction was performed at room temperature in 3 ml of assay mixture, which contained 100 mM HEPES buffer (Hyclone, China), 10 mM MgCl2 ·6H2 O, 7.7 mM KCl, and 1 mM 2-PGA/PEP (Sigma, St. Louis, MO, USA). Baker’s yeast enolase (Sigma, St. Louis, MO, USA) was used as a positive control, and His-Ts18 was used as a negative control. The change of PEP concentration was determined using an absorption coefficient ( = 1400 M−1 cm−1 , 240 nm). For the determination of Vmax and Km , the initial reaction rates were measured at several different concentrations of 2-PGA (0.6–7 mM) and PEP (0.2–3 mM). The data were fitted to the Michaelis–Menten equation {v = Vmax [S]/(Km + [S])} using the Lineweaver–Burk plots of UVProbe software. 2.7. Plasminogen-binding activities of rTpeno protein 2.7.1. Far-Western blotting Binding interactions between rTpeno and plasminogen were analyzed by the far-Western blotting assay. rTpeno was electrophoretically transferred from SDS–PAGE gels onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 1% (w/v) gelatin (Sigma, St. Louis, MO, USA) in PBS buffer and then incubated with human plasminogen (35 ␮g/ml, 2 h) (Sigma, St. Louis, MO, USA) at 37 ◦ C. After extensive washing with PBST, the membrane was probed with a goat anti-human plasminogen polyclonal antibody (1:1000, 1 h) (Abcam, UK). The

33

bound antibody was further detected by incubation with a rabbit anti-goat IgG–horseradish peroxidase (HRP) conjugation (Sigma, St. Louis, MO, USA). The antigen–antibody complexes were developed by incubation with 3,3’-diaminobenzidine tetrahydrochloride (DAB; Sigma, St. Louis, MO, USA). 2.7.2. Lysine competition binding assay The human plasminogen was serially diluted (0.01–4 ␮g/ml) in the carbonate buffer (50 mM, pH 9.6) and coated in 96-well plates (Costar, USA). The control wells were coated with His-Ts18 protein. The plates were blocked with 1% gelatin in PBS (37 ◦ C, 1 h) and incubated with pure rTpeno (1 ␮g/well, 2 h). The competition experiments were also performed in the absence or presence of final concentrations (0–40 mM) of lysine analogue ACA (Sigma, USA) to determine the role of lysine in the rTpeno binding of plasminogen. After washing three times with PBST, plates were incubated with anti-rTpeno MAb 1D7 (1:1000, 1 h) at 37 ◦ C and washed again three times. HRP-conjugated goat anti-mouse IgG was used as secondary antibodies (1:20,000, 1 h) at 37 ◦ C and 3,3 ,5,5 -tetramethylbenzidine (TMB; Promega, USA) was used as the enzyme substrate. The color reactions were stopped by adding 50 ␮l of 1 M H2 SO4 . Absorbance at 450 nm was determined in triplicate wells using a microplate reader (BioRad, USA). 2.7.3. Plasminogen activation assay The plasminogen activation assay was performed by measuring the proteolytic activity of generated plasmin. Maxisorp 96-well plates (Costar, Tewksbury, MA, USA) were coated with pure rTpeno (1 ␮g/well, 24 h), baker’s yeast enolase (positive control), and HisTs18 protein (negative control) in the carbonate buffer at 4 ◦ C, respectively. Wells were blocked with 1% gelatin and then washed three times with PBST. Thereafter, human plasminogen was added and incubated at 37 ◦ C (1 ␮g/well, 2 h). Wells were washed three times with PBST, then 20 units/ml of human urokinase plasminogen activator (uPA) (Zhongshan, China) and the chromogenic substrate S-2251 (Chromogenix, Italy) at a final concentration of 0.3 mM in PBS were added for an additional 4 h to convert plasminogen into plasmin. Next, plates were measured at 405 nm. In parallel control experiments, generation of the plasmin was determined in either the absence of uPA, plasminogen or S-2251. 2.8. Immunohistochemistry (IHC) The immunohistochemical study was performed using MAb against rTpeno to investigate the distribution of Tpeno in TpM. The 6-␮m-thick serial sections of TpM were de-waxed, re-hydrated, then autoclaved in 0.1 M citrate buffer (pH 6.0) at 121 ◦ C for 10 min to retrieve the antigens. After blocking for 30 min, the sections were incubated with MAb 1D7 (1:100) against rTpeno at 4 ◦ C overnight. In the control section, undiluted SP2/0 myeloma supernatant was used as a substitute for the primary antibody. Slides were washed twice in PBS and incubated with HRP labeled anti-IgG polymer (PV6000 Polymer Detection System; GBI, USA) as a secondary antibody for 30 min according to the manufacturer’s instructions. After a final PBS washing, sections were incubated with DAB for approximately 5 min at room temperature, washed in distilled water, counterstained with haematoxylin, dehydrated, and mounted in neutral balsam. All sections were examined under a BX53 microscope (Olympus, Japan) for image acquisition. 2.9. Indirect immunofluorescence assay (IFA) The presence of surface-exposed Tpeno in the calcareous corpuscles of TpM was confirmed by IFA. In brief, the fixed calcareous corpuscles were blocked with 1% gelatin (37 ◦ C, 2 h) prior to incubation with MAb 1D7 (1:50, 1 h). After washing

34

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

Fig. 1. Alignment of the amino acid sequences of alpha-enolase from Taenia pisiformis with homologues from other species. GenBank Accession Numbers: Taenia pisiformis (AGU16441); Echinococcus granulosus (ACY30465); Fasciola hepatica (Q27655); Streptococcus pneumoniae (Q97QS2). The enolase signature motif and catalytic motif are indicated in filled boxes. Metal binding sites (Ser40, Asp245, Glu294, Asp319) are highlighted in grey. Glycosylation sites are highlighted in light grey (green in the web version). The amino acids conserved in all the sequences are shown by asterisks; the conservative and semi-conservative substitutions are labeled with two and one points, respectively; dashes indicate gaps introduced to fit the sequences.

five times, the calcareous corpuscles were incubated with fluorescein isothiocyanate (FITC)-labeled anti-mouse IgG antibody (1:50, 1 h) (Sigma, St. Louis, MO, USA). Finally, the samples were rinsed several times with PBS and observed under

200× magnification using an EVOS fluorescence microscope (AMG-Life Technoligies, Grand Iland, NY, USA). A sample incubated with SP2/0 myeloma supernatant served as a negative control.

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

35

2.10. Rabbits vaccination assay Ten female New Zealand rabbits, about 4 months of age, were randomly divided into two groups (five rabbits per group). The rabbits in Group A (control group) were vaccinated with phosphate buffered saline (PBS) in Freund’s adjuvant (Sigma, St. Louis, MO, USA) and Group B were vaccinated with 150 ␮g of pure rTpeno administered with Freund’s adjuvant. All animals were immunized three times by hypodermic injection at 2-week intervals. Each rabbit in group A and B was orally infected with approximately 2000 viable and mature T. pisiformis eggs 2 weeks after the booster and humanely euthanized 9 weeks later. T. pisiformis eggs were obtained as described by Coman and Rickard (1977). Blood samples were taken prior to vaccination, 10 days after each vaccination and challenge, up until 4 weeks post-challenge to monitor the specific antibody titers against rTpeno. 2.11. Statistical analysis Statistical analysis was performed using SPSS software and Microsoft Office Excel statistical analysis. The enzymatic and plasminogen-binding activities of rTpeno protein among the different groups were analyzed and determined by one-way ANOVA. The difference was considered statistically significant at P values < 0.05. 3. Results 3.1. Tpeno sequence analysis Using 5 and 3 RACE experiments, a full-length 1503 bp Tpeno cDNA, containing a 48 bp 5 UTR (untranslated region), a 1302 bp ORF, and a 153 bp 3 UTR, was obtained and sequenced. The nucleotide sequence data has been submitted to GenBank (Accession numbers: KF040090). The protein was predicted to have a molecular weight of 47 kDa and a theoretical isoelectric point of 6.8. Using online analytic tools, a highly conserved catalytic motif 371-[SHRSGETED]-379 and enolase signature motif 341[LLLKVNQIGSVTES]-354 were identified in the deduced amino acid sequence of Tpeno (Fig. 1). Two putative N-linked glycosylation sites were located at positions 17-[NPT]-19 and 177-[NFT]-179. No signal peptide or transmembrane domains were found with the SignalP 4.0 program. Furthermore, the analysis using the SecretomeP 2.0 server indicated that Tpeno might not be a secreted protein because the predicted value for the putative signal peptide fragment was 0.390 (lower than the normal threshold value of 0.5). These results suggest that the peptide chain is not anchored to the cellular membrane.

Fig. 2. Expression of rTpeno protein. (A) SDS–PAGE gel stained with Coomassie Brilliant Blue showing protein marker (lane M), the empty vector control (lane 1), rTpeno expressed in bacteria after induction (lane 2), purified rTpeno with Niaffinity chromatography (lane 3), and E/S antigens from TpM (lane 4). (B) Western blot analysis using anti-His and anti-rTpeno 1D7 antibodies to detect rTpeno and E/S antigens, respectively.

from the parasite as a component of the E/S antigens. rTpeno was strongly recognized in both reactions, which revealed that rTpeno had good antigenicity.

3.3. rTpeno has enolase activity 3.2. Production of rTpeno and monoclonal antibodies The soluble rTpeno protein was expressed in Rosetta (DE3) after induction with IPTG and showed an expected molecular mass of 66 kDa (containing additional Trx-tag, S-tag and His-tag) on SDS–PAGE (Fig. 2A, lane 2). The target product was not observed in the host Rosetta (DE3) cells transformed with the vector pET32a (Fig. 2A, lane 1). The protein purified by Ni-affinity chromatography was designated as rTpeno. Ten specific MAbs against rTpeno were produced (data not shown). One IgG1-type MAb 1D7 with a high titer (1 × 107 ) to rTpeno was used in the following Western blot and immunolocalization analysis. The recombinant protein and native TpM enolase were analysed using anti-His antibody (GenScript, China) and anti-rTpeno MAb 1D7. Western blotting confirmed that the anti-rTpeno antibody specifically recognized the native enolase (≈47 kDa) derived from E/S antigens of the larvae (Fig. 2B), indicating that Tpeno is released

Michaelis–Menten kinetics of rTpeno validated the reversible conversion of 2-PGA to PEP by measuring the absorbance change of PEP at A240 in the presence of rTpeno. This catalytic activity was detected in rTpeno but not in the His-Ts18 protein control (Fig. 3A). Additionally, the saturation of rTpeno activity showed it was both time and dose-dependent, confirming that the observed activity resulted from a portion of purified rTpeno with catalytic effect. Kinetic measurements showed rTpeno provided for specific enzymatic activities of 30.71 ± 2.15 U/mg in the 2-PGA to PEP direction and 11.29 ± 2.38 U/mg in the PEP to 2-PGA direction, with no significant difference (P > 0.05) with that of baker’s yeast enolase (34.96 ± 4.65 U/mg in the 2-PGA to the PEP direction and 12.18 ± 1.51 U/mg in the PEP to 2-PGA direction). The Michaelis constants were determined using Lineweaver–Burk plots, with KmPEP to be 0.6 mM and Km2-PGA to be 0.77 mM, respectively (Fig. 3B).

36

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

Fig. 3. The characterization of enzymatic activity of purified rTpeno. (A) rTpeno enzyme activity was measured by catalysis of the substrate 2-PGA (1 mM) to PEP or PEP (1 mM) to 2-PGA at A240 for a period of 3 min using 2 ␮g/ml of enzyme source. Baker’s yeast enolase was used as a positive control and His-Ts18 was used as a negative control. (B) The values of Km for rTpeno were KmPEP ≈ 0.6 mM and Km2-PGA ≈ 0.77 mM by means of a Lineweaver–Burk plot using UVProbe software.

3.4. rTpeno has plasminogen-binding activity Far-Western blotting showed a positive band with a molecular weight of around 66 kDa detected in the purified rTpeno lane

(Fig. 4A). The expected saturation and concentration-dependent binding of rTpeno interacting specifically with immobilized plasminogen is displayed in Fig. 4B. The His-Ts18 protein control showed negligible, nonspecific binding of plasminogen. For the

Fig. 4. Analysis of plasminogen-binding activity of rTpeno. (A) Far-Western blotting. Lane M–Lane 3: protein marker, baker’s yeast enolase, rTpeno and His-Ts18 stained with Coomassie Brilliant Blue. Lane 4–Lane 6: baker’s yeast enolase, rTpeno and His-Ts18 binding plasminogen, respectively. (B) 10 ␮g/ml rTpeno was respectively incubated with immobilized human plasminogen [black bars (red bars in the web version)] and His-Ts18 [grey bars (blue bars in the web version)] at different concentrations. The binding of rTpeno was probed using anti-rTpeno MAb and HRP-conjugated secondary antibodies. (C) Increasing ACA concentrations (0–40 mM) were used to evaluate the role of lysine in plasminogen-rTpeno interaction by competitor ELISA. Values represent the mean values ± standard deviation (Mean ± SD) of absorbance at A450 from three independent assays. *P < 0.01 compared to His-Ts18 control and 0 mM ACA concentrations, respectively.

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

37

Table 2 Reduction of the number of Cysticercus pisiformis in rabbits immunized with rTpeno antigen. Vaccine group

A(PBS + adjuvant) B(rTpeno + adjuvant)

Viable TpM in vaccine trial No. of cysticerci in individual rabbits

Mean

48, 31, 44, 50, 63 32, 16, 23, 54, 25

47.2 30

Vaccine efficacy (%)a

36.4b

a Vaccine efficacy (%) = {1 − (Mean viable TpM for group B ÷ Mean viable TpM for group A) × 100%}. b P < 0.05, when compared to group A.

response. The vaccination with the rTpeno antigen reduced the number of cysticerci recovered from the peritoneal cavity of experimentally infected rabbits with a 36.4% reduction (Table 2). No calcified cysticerci were detected in individual rabbits of the rTpeno immunized group or control group. Fig. 5. Plasminogen activation assays. Microtitre plates were coated with rTpeno, baker’s yeast enolase (positive control), His-Ts18 (negative control), and/or incubated with plasminogen, uPA and S2251. In parallel, six series negative control wells were run in which either the plasminogen or uPA or the substrate were omitted (−). Proteolytic activity was measured by absorbance at A405 (mean ± SD) from three different experiments with 18 replicates per condition. *P < 0.01 compared to the activation of plasminogen bound to His-Ts18.

ACA competition experiment, despite the absence of C-terminal lysyl residues in the Tpeno sequence, this binding ability of rTpeno to plasminogen was effectively inhibited by 5 mM of ACA (Fig. 4C). In the plasminogen activated assay, plasminogen bound to rTpeno was converted into plasmin by host-derived activators uPA with a high activity (Fig. 5). All of the above results showed rTpeno is a specific plasminogen-binding protein. 3.5. Tissue localization In our experimental conditions, the cultured larva still maintained good motility after 21 days in culture. The scolex evagination and strobila elongation (Fig. 6A, panel a) were easily observed. Furthermore, calcareous corpuscles on the surface of the larval bladder wall were captured at 200× magnification (Fig. 6A, panel b). The purified calcareous corpuscles were irregularly spherical, variable in shape and size, similar to those in the bladder wall of live larvae (Fig. 6A, panel c). Tpeno expression in the larva and calcareous corpuscles was analyzed by two assays with MAb 1D7. Significant signals were detected in the larval cyst, while no signals were observed in the metacestode scolex, sucker, cystic cavity, or inner wall of the bladder (Fig. 6B, panel f). The presence of Tpeno on the surface of calcareous corpuscles was confirmed by the immunofluorescence test after incubation with MAb 1D7 (Fig. 6C, panel i), but no fluorescence was observed in SP2/0 myeloma supernatants control (Fig. 6C, panel h). The evidence presented here suggests that this specific localization of Tpeno indicates its novel physiological functions involved in the survival adaptations of the parasite in the host environment or direct participation in certain pathological processes. 3.6. Vaccination assay with rTpeno in rabbits To evaluate the protective efficacy induced by rTpeno, rabbits were vaccinated with purified rTpeno three times, challenged with T. pisiformis eggs, and then humanely killed 9 weeks post-infection. The results revealed that rTpeno induced a high level of rTpenospecific antibodies (1:51,200) in vaccinated rabbits after 40 days compared to the control group (Fig. 7, P < 0.01), which suggests that the rTpeno can induce rabbits with a specific humoral immune

4. Discussion It has been established that many moonlighting proteins are familiar metabolic enzymes and their special activities range from transcriptional regulation, apoptosis, growth, and motility to structural functions (Diaz-Ramos et al., 2012; Kim and Dang, 2005; Sriram et al., 2005). Without requiring expansion of the genome, moonlighting proteins can generate functional complexity. As an important hydrolase in glycolysis, enolase is highly conserved across species and serves as a multifunctional protein that plays various roles in intracellular and extracellular microenvironments (Copley, 2003). We herein report the identification and functional characterization of the Tpeno enzyme expressed during the larval development of T. pisiformis. In this study, we expressed rTpeno in E. coli as a soluble form. The purified rTpeno showed good enzymatic activity in hydrolyzing the specific substrates 2-PGA/PEP with 30.71 ± 2.15 U/mg in the conversion of 2-PGA to PEP and 11.29 ± 2.38 U/mg in PEP to 2-PGA. Moreover, we demonstrated the moonlighting functions of rTpeno in binding plasminogen and calcareous corpuscles. Enolase is one of the well-known plasminogen receptors detected in many organisms (Pancholi et al., 2003). The Tpeno primary structure showed a highly conserved enolase signature motif and catalytic site for substrate binding (Fig. 2). The binding ability of rTpeno to human plasminogen was also strongly demonstrated by specific bindings in far-Western blotting and ELISA assay. Moreover, the binding ability of rTpeno to plasminogen was effectively inhibited by ACA in competition experiments, although C-terminal lysyl residues were absent in the Tpeno sequence (Fig. 1), indicating that lysine residues are important for the binding activity of Tpeno with plasminogen. However, further studies are necessary to identify the individual amino acids and the specific domains affecting Tpeno–plasminogen complex formation. The plasminogen-binding ability of enolase provides the invasiveness and pathogenicity in pathogenic eukaryotic and prokaryotic cells (Walker et al., 2005). Plasminogen activation is responsible for the degradation of extracellular matrix proteins and fibrin which are part of the host’s defense against infections (Sun, 2006). For TpM, plasminogen bound to rTpeno can be converted into plasmin by host-derived activators uPA. rTpeno, with its properties of plasminogen binding and plasmin generation, has probably increased the larval invasion into the host’s physical barrier and facilitated migration in tissues with host-derived proteolytic activity. It has been clearly demonstrated that Tpeno is essential for the viability of this parasite and an adaptation for survival in the host environment (Hong et al., 2000; Yang et al., 2010).

38

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

Fig. 6. Immunolocalization of Tpeno in the larva and calcareous corpuscles of T. pisiformis. (A) T. pisiformis metacestodes (TpM) with good motility cultured at 21 days (panel a), calcareous corpuscles (panel b) on the bladder wall of TpM, and purified calcareous corpuscles (panel c). (B) Tissue section was stained with hematoxylin and eosin (panel d). Negative control showed absence of immunoreactivity in the section probed with undiluted SP2/0 myeloma supernatants (panel e). Anti-rTpeno antibody was localized directly in the bladder wall region (brown dots, arrowed in panel f) by IHC detection. (C) IFA demonstrated the fluorescence was seen at the periphery of calcareous corpuscles (panel i) when reacted with MAb 1D7, but it did not show in SP2/0 (panel h) and PBS controls (panel g). The following structures are indicated: Sc, scolex; Su, suck; Ns, neck and strobila; BW, bladder wall.

More importantly and interestingly, a new clue was provided by the localization of Tpeno in T. pisiformis, which shows Tpeno is a novel protein associated with calcareous corpuscles. Calcareous corpuscles are characteristic organelles in cestodes that are more abundant in the larval stage and may have many special biological functions (Vargas-Parada and Laclette, 1999). With regards to the composition of calcareous corpuscles isolated from several taeniid species, some studies have demonstrated by X-ray diffraction that these corpuscles are rich in calcium, magnesium, phosphorus, phosphate, and carbonate (Chalar et al., 2013; Senorale-Pose et al., 2008; Von Brand et al., 1969). However, their exact roles in parasites remain unknown. Diverse hypotheses have suggested that calcareous corpuscles may be involved in calcium metabolism and biomineralization processes, or act as a protective buffering system, a reservoir of inorganic ions, or waste fixers (McCullough and Fairweather, 1987). Previous studies have also shown that the organic matrix of calcareous corpuscles is composed of glycogen, mucopolysaccharide, lipids, simple proteins, and alkaline phosphatase (Jones et al., 1979; Khalifa et al., 2011). Some calcareous

corpuscles binding proteins are commonly molecules of 10, 17, 22, or 35 kDa in crude extracts of platyhelminthes. Additionally, some proteins prominently bind to calcareous corpuscles, such as a 95 kDa protein in the cyst fluid of T. solium metacestode, a 40 kDa protein in crude extracts of Taenia saginata, and a 27 kDa protein in crude extracts of Paragonimus westermani and C. sinensis (Yang, 2000, 2004). From the calcareous corpuscles of Spirometra erinacei sparganum, a total of 20 proteins, ranging from 8 to 56 kDa, have been detected and analyzed. However, their functions are poorly understood (Park et al., 2005). Calcium-binding proteins are characterized as antigenic proteins associated with calcareous corpuscles in E. granulosus and T. solium (Zurabian et al., 2005). These results suggest that calcareous corpuscles might bind to proteins in cestodes to exert specific physiological functions in the natural state. In this study, Tpeno was clearly located, by IHC and IFA assay, in the external bladder wall and on the surface of the calcareous corpuscles of TpM, respectively. These results indicate that Tpeno binding in the calcareous corpuscles probably has additional functions other than being consumed in the metabolic process

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

39

a plasminogen-binding and calcareous corpuscles-related protein. The Tpeno enzyme may play functional roles in the motility, migration, growth, and development of T. pisiformis, which could be a promising drug target for animal cysticercosis. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (31372433) and Science Fund for Creative Research Groups of Gansu Province (No. 1210RJIA006). References

Fig. 7. Humoral immune response of rabbits after immunization with rTpeno. Rabbits were vaccinated three times with rTpeno, or PBS administered with Freund’s adjuvant as control at 2-week intervals. rTpeno-specific IgG antibody levels in both experimental groups were detected by ELISA. Values were determined as absorbance at A450 . V0, before vaccination; V1, 10 days after first vaccination; V2, 10 days after second vaccination; V3, 10 days after third vaccination; C, rabbits were challenged with approximately 2000 T. pisiformis eggs. C1, 2 weeks post challenge; C2, 4 weeks post challenge. *P < 0.01, compared to the control group.

to provide energy and ions for the development and growth of T. pisiformis. However, one question that remains unanswered is how Tpeno is transported and fixed to the calcareous corpuscles despite the absence of any sorting sequence or anchor site. Given the absence of a signal peptide in Tpeno and the complexity of calcareous corpuscles, further studies are necessary to define and better understand the origin of Tpeno and the mechanism of its presence in calcareous corpuscles. Enolase has been considered as a novel vaccine candidate due to its critical role of plasminogen activation in migration across tissue barriers (Chen et al., 2012; Zhang et al., 2009). However, limited information is available about its protective potential against cysticercosis and the immune response it induces. Here, we further assessed the protective efficacy for hosts induced by the rTpeno protein. The preliminary vaccination experiment revealed that rTpeno formulated with Freund’s adjuvant triggers a specific humoral immune response with high levels of specific IgG antibodies in vaccinated rabbits. The immunization of rabbit with the rTpeno protein induced a 36.4% protection against experimental challenges from T. pisiformis eggs (Table 2). The result suggests that the rTpeno may not be a good vaccination candidate for rabbits against infection of T. pisiformis eggs. The lower protective efficacy may result from a prokaryotic system in terms of incorrect folding or lack of some posttranslational modifications when recombinant proteins are expressed. Using immunogen without well structured conformation, the production of the protective IgG antibodies is absent, which may be important in the host’s immunity against T. pisiformis eggs. Follow-up work is required to understand how to enhance the protective efficacy of an enolase vaccine against cysticercosis using effective methods, such as using DNA vaccinations, adjusting vaccination dose, ways, procedures, and/or adjuvants. This study establishes a foundation for further research on recombinant vaccines in anti-cestode infection. In addition, the therapeutic potential of targeting surface enolase from Taenia is discussed in depth. 5. Conclusions For the first time, we have characterized Tpeno protein from T. pisiformis, demonstrating its glycolytic activity, plasminogenbinding activity, and localization properties. Undoubtedly, the multifunctional Tpeno is related to the invasion of this parasite as

Chalar, C., Salome, M., Senorale-Pose, M., Marin, M., Williams, C.T., Dauphin, Y., 2013. A high resolution analysis of the structure and chemical composition of the calcareous corpuscles from Mesocestoides corti. Micron 44, 185–192. Chavez-Munguia, B., Segovia-Gamboa, N., Salazar-Villatoro, L., Omana-Molina, M., Espinosa-Cantellano, M., Martinez-Palomo, A., 2011. Naegleria fowleri: enolase is expressed during cyst differentiation. J. Eukaryot. Microbiol. 58, 463–468. Chen, N., Yuan, Z.G., Xu, M.J., Zhou, D.H., Zhang, X.X., Zhang, Y.Z., Wang, X.W., Yan, C., Lin, R.Q., Zhu, X.Q., 2012. Ascaris suum enolase is a potential vaccine candidate against ascariasis. Vaccine 30, 3478–3482. Coman, B.J., Rickard, M.D., 1977. A comparison of in vitro and in vivo estimates of the viability of Taenia pisiformis eggs aged under controlled conditions, and their ability to immunise against a challenge infection. Int. J. Parasitol. 7, 15–20. Copley, S.D., 2003. Enzymes with extra talents: moonlighting functions and catalytic promiscuity. Curr. Opin. Chem. Biol. 7, 265–272. Dalton, J.P., Skelly, P., Halton, D.W., 2004. Role of the tegument and gut in nutrient uptake by parasitic platyhelminths. Can. J. Zool. 82, 211–232. Diaz-Ramos, A., Roig-Borrellas, A., Garcia-Melero, A., Lopez-Alemany, R., 2012. alpha-Enolase, a multifunctional protein: its role on pathophysiological situations. J. Biomed. Biotechnol. 2012, 156795. Ferguson, D.J.P., Parmley, S.F., Tomavo, S., 2002. Evidence for nuclear localisation of two stage-specific isoenzymes of enolase in Toxoplasma gondii correlates with active parasite replication. Int. J. Parasitol. 32, 1399–1410. Holmes, M., Liwak, U., Pricop, I., Wang, X., Tomavo, S., Ananvoranich, S., 2010. Silencing of tachyzoite enolase 2 alters nuclear targeting of bradyzoite enolase 1 in Toxoplasma gondii. Microbes Infect. 12, 19–27. Hong, S.J., Seong, K.Y., Sohn, W.M., Song, K.Y., 2000. Molecular cloning and immunological characterization of phosphoglycerate kinase from Clonorchis sinensis. Mol. Biochem. Parasitol. 108, 207–216. Iida, H., Yahara, I., 1985. Yeast heat-shock protein of Mr 48,000 is an isoprotein of enolase. Nature 315 (6021), 6688–6690. Jones, B.R., Smith, B.F., LeFlore, W.B., 1979. The ultrastructural localization of alkaline phosphatase activity in the tegument of the cysticercus of Hydatigera taeniaeformis. Cytobios 24, 195–209. Khalifa, R.M., Mazen, N.A., Marawan, A.M., Thabit, H.T., 2011. Histochemical and ultrastructural studies on the calcareous corpuscles and eggs of Taenia taeniaeformis and Dipylidium caninum. J. Egypt. Soc. Parasitol. 41, 513–528. Kibe, M.K., Coppin, A., Dendouga, N., Oria, G., Meurice, E., Mortuaire, M., Madec, E., Tomavo, S., 2005. Transcriptional regulation of two stage-specifically expressed genes in the protozoan parasite Toxoplasma gondii. Nucleic Acids Res. 33, 1722–1736. Kim, J.W., Dang, C.V., 2005. Multifaceted roles of glycolytic enzymes. Trends Biochem. Sci. 30, 142–150. Li, W., Wan, Y., Tao, Z., Chen, H.C., Zhou, R., 2013. A novel fibronectin-binding protein of Streptococcus suis serotype 2 contributes to epithelial cell invasion and in vivo dissemination. Vet. Microbiol. 162, 186–194. Liu, F., Cui, S.J., Hu, W., Feng, Z., Wang, Z.Q., Han, Z.G., 2009. Excretory/secretory proteome of the adult developmental stage of human blood fluke, Schistosoma japonicum. Mol. Cell. Proteomics 8, 1236–1251. Loos-Frank, B., 2000. An up-date of Verster’s (1969) ‘Taxonomic revision of the genus Taenia Linnaeus’ (Cestoda) in table format. Syst. Parasitol. 45, 155–183. McCullough, J.S., Fairweather, I., 1987. The structure, composition, formation and possible functions of calcareous corpuscles in Trilocularia acanthiaevulgaris Olsson 1867 (Cestoda, Tetraphyllidea). Parasitol. Res. 74, 175–182. Navarro, M.V.D.S., Dias, S.M.G., Mello, L.V., Giotto, M.T.D., Gavalda, S., Blonski, C., Garratt, R.C., Rigden, D.J., 2007. Structural flexibility in Trypanosoma brucei enolase revealed by X-ray crystallography and molecular dynamics. FEBS J. 274, 5077–5089. Pancholi, V., Fischetti, V.A., 1998. alpha-enolase, a novel strong plasmin(ogen) binding protein on the surface of pathogenic streptococci. J. Biol. Chem. 273, 14503–14515. Pancholi, V., Fontan, P., Jin, H., 2003. Plasminogen-mediated group A streptococcal adherence to and pericellular invasion of human pharyngeal cells. Microb. Pathog. 35, 293–303. Pancholi, V., 2001. Multifunctional a-enolase: its role in diseases. Cell. Mol. Life Sci. 58 (57), 902–920. Park, Park, J.H., Guk, S.M., Shin, E.H., Chai, J.Y., 2005. A new method for concentration of proteins in the calcareous corpuscles separated from the spargana of Spirometra erinacei. Korean J. Parasitol. 43, 119–122.

40

S. Zhang et al. / Acta Tropica 144 (2015) 31–40

Rajasekariah, G.R., Rickard, M.D., O’Donnell, I.J., 1985. Taenia pisiformis: protective immunization of rabbits with solubilized oncospheral antigens Taenia pisiformis: protective immunization of rabbits with solubilized oncospheral antigens. Exp. Parasitol. 59, 321–327. Ramajo-Hernandez, A., Perez-Sanchez, R., Ramajo-Martin, V., Oleaga, A., 2007. Schistosoma bovis: plasminogen binding in adults and the identification of plasminogen-binding proteins from the worm tegument. Exp. Parasitol. 115, 83–91. Rodriguez, E., Romaris, F., Lorenzo, S., Moreno, J., Bonay, P., Ubeira, F.M., Garate, T., 2006. A recombinant enolase from Anisakis simplex is differentially recognized in natural human and mouse experimental infections. Med. Microbiol. Immunol. 195, 1–10. Segovia-Gamboa, N.C., Chavez-Munguia, B., Medina-Flores, Y., Cazares-Raga, F.E., Hernandez-Ramirez, V.I., Martinez-Palomo, A., Talamas-Rohana, P., 2010. Entamoeba invadens, encystation process and enolase Entamoeba invadens, encystation process and enolase. Exp. Parasitol. 125, 63–69. Senorale-Pose, M., Chalar, C., Dauphin, Y., Massard, P., Pradel, P., Marin, M., 2008. Monohydrocalcite in calcareous corpuscles of Mesocestoides corti. Exp. Parasitol. 118, 54–58. Sriram, G., Martinez, J.A., McCabe, E.R.B., Liao, J.C., Dipple, K.M., 2005. Single-gene disorders: what role could moonlighting enzymes play? Am. J. Hum. Genet. 76, 911–924. Subramanian, A., Miller, D.M., 2000. Structural analysis of alpha-enolase – mapping the functional domains involved in down-regulation of the c-myc protooncogene. J. Biol. Chem. 275, 5958–5965. Sun, H.M., 2006. The interaction between pathogens and the host coagulation system. Physiology 21, 281–288. Sun, X.L., Cai, C.H., 2008. A histopathologic study on Cysticercus pisiformis infected rabbits. Acta Vet. Zootech. Sin. 39, 1100–1106. Toral-Bastida, E., Garza-Rodriguez, A., Jimenez-Gonzalez, D.E., Garcia-Cortes, R., Avila-Ramirez, G., Maravilla, P., Flisser, A., 2011. Development of Taenia pisiformis in golden hamster (Mesocricetus auratus). Parasit. Vectors 4, 147. Tovy, A., Tov, R.S., Gaentzsch, R., Helm, M., Ankri, S., 2010. A new nuclear function of the Entamoeba histolytica glycolytic enzyme enolase: the metabolic regulation of cytosine-5 methyltransferase 2 (Dnmt2) activity. PLoS Pathog., 6. Vargas-Parada, L., Laclette, J.P., 1999. Role of the calcareous corpuscles in cestode physiology: a review. Rev. Latinoam Microbiol. 41, 303–307.

Victor, B., Kanobana, K., Gabriel, S., Polman, K., Deckers, N., Dorny, P., Deelder, A.M., Palmblad, M., 2012. Proteomic analysis of Taenia solium metacestode excretion–secretion proteins. Proteomics 12, 1860–1869. Von Brand, T., Nylen, M.U., Martin, G.N., Churchwell, F.K., Stites, E., 1969. Cestode calcareous corpuscles: phosphate relationships, crystallization patterns, and variations in size and shape. Exp. Parasitol. 25, 291–310. Walker, M.J., McArthur, J.D., McKay, F., Ranson, M., 2005. Is plasminogen deployed as a Streptococcus pyogenes virulence factor? Trends Microbiol. 13, 308–313. Wang, X.Y., Chen, W.J., Hu, F.Y., Deng, C.H., Zhou, C.H., Lv, X.L., Fan, Y.X., Men, J.T., Huang, Y., Sun, J.F., Hu, D., Chen, J.F., Yang, Y.B., Liang, C., Zheng, H.Q., Hu, X.C., Xu, J., Wu, Z.D., Yu, X.B., 2011. Clonorchis sinensis enolase: identification and biochemical characterization of a glycolytic enzyme from excretory/secretory products Clonorchis sinensis enolase: identification and biochemical characterization of a glycolytic enzyme from excretory/secretory products. Mol. Biochem. Parasitol. 177, 135–142. Wold, F., Ballou, C.E., 1957. Studies on the enzyme enolase. II. Kinetic studies. J. Biol. Chem. 227, 313–328. Yang, D.Y., Fu, Y., Wu, X.H., Xie, Y., Nie, H.M., Chen, L., Nong, X., Gu, X.B., Wang, S.X., Peng, X.R., Yan, N., Zhang, R.H., Zheng, W.P., Yang, G.Y., 2012. Annotation of the transcriptome from Taenia pisiformis and its comparative analysis with three Taeniidae species. PLoS ONE 7. Yang, H.J., 2000. Separation of calcareous corpuscles from plerocercoids of Spirometra mansoni and their binding proteins. Parasitol. Res. 86, 781–782. Yang, H.J., 2004. Immunoblot findings of calcareous corpuscles binding proteins in cyst fluid of Taenia solium metacestodes. Korean J. Parasitol. 42, 141–143. Yang, J.M., Qiu, C.H., Xia, Y.X., Yao, L.X., Fu, Z.Q., Yuan, C.X., Feng, X.G., Lin, J.J., 2010. Molecular cloning and functional characterization of Schistosoma japonicum enolase which is highly expressed at the schistosomulum stage. Parasitol. Res. 107, 667–677. Zhang, A., Chen, B., Mu, X., Li, R., Zheng, P., Zhao, Y., Chen, H., Jin, M., 2009. Identification and characterization of a novel protective antigen, enolase of Streptococcus suis serotype 2. Vaccine 27, 1348–1353. Zurabian, R., Carrero, J.C., Rodriguez-Contreras, D., Willms, K., Laclette, J.P., 2005. Antigenic proteins associated with calcareous corpuscules of Taenia solium: partial characterization of a calcium-binding protein. Arch. Med. Res. 36, 4–9.