- Email: [email protected]
Identification and molecular analysis of a stress-inducible Hsp70 from Sciaenops ocellatus
Fish & Shellfish Immunology 29 (2010) 600e607
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Identification and molecular analysis of a stress-inducible Hsp70 from Sciaenops ocellatus Wei Dang a, b, Yong-hua Hu a, Min Zhang a, Li Sun a, * a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing 100049, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 December 2009 Received in revised form 12 May 2010 Accepted 1 June 2010 Available online 9 June 2010
Hsp70 proteins are a family of molecular chaperones that are involved in many aspects of protein homeostasis. In this study, an Hsp70 homologue (SoHsp70) was identified from red drum Sciaenops ocellatus and analyzed at molecular level. The open reading frame of SoHsp70 is 1920 bp and intronless, with a 50 -untranslated region (UTR) of 399 bp and a 30 -UTR of 241 bp. The deduced amino acid sequence of SoHsp70 shares 84e92% overall identities with the Hsp70s of a number of fish species. In silico analysis identified in SoHsp70 three conserved Hsp70 domains involved in nucleotide and substrate binding. The coding sequence of SoHsp70 was subcloned into Escherichia coli, from which recombinant SoHsp70 was purified and, upon ATPase assay, found to exhibit apparent ATPase activity. Expressional analysis showed that constitutive expression of SoHsp70 was detectable in heart, liver, spleen, kidney, brain, blood, and gill. Experimental challenges with poly(I:C) and bacterial pathogens of Gram-positive and Gram-negative nature induced SoHsp70 expression in kidney to different levels. Stress-responsive analysis of SoHsp70 expression in primary cultures of red drum hepatocytes showed that acute heat shock treatment elicited a rapid induction of SoHsp70 expression which appeared after 10 min and 30 min of treatment. Exposure of hepatocytes separately to iron, copper, mercury, and hydrogen peroxide significantly upregulated SoHsp70 expression in time-dependent manners. Vaccination of red drum with a Streptococcus iniae bacterin was also found to induce SoHsp70 expression. Furthermore, recombinant SoHsp70 enhanced the immunoprotective effect of a subunit vaccine. Taken together, these results suggest that SoHsp70 is a stress-inducible protein that is likely to play a role in immunity and in coping with environmental and biological stresses. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Heat shock protein Hsp70 Sciaenops Ocellatus Stress
1. Introduction The 70-kDa heat shock proteins (Hsp70s) are a family of molecular chaperones existing ubiquitously in most living organisms ranging from bacteria to humans. These proteins are highly conserved and play essential roles under both stress and physiological conditions [1,2]. Structurally, Hsp70s possess three functional domains: (i) a w44 kDa amino-terminal adenine nucleotide-binding domain (NBD) or ATPase domain, which binds and hydrolyzes ATP, whereby providing energy for substrate binding and releasing; (ii) an w18 kDa substrate binding domain (SBD), which consists of two b-sheets that form a pocket structure where substrate-interaction occurs; (iii) a w10 kDa carboxy-terminal domain (CTD), which is rich in a-helices and adopts a lid-like structure that is positioned over SBD [3e7]. The short stretch of linker sequence that connects NBD and SBD is highly conserved among Hsp70 proteins and plays
* Corresponding author. Tel./fax: þ86 532 82898829. E-mail address: [email protected] (L. Sun). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.06.001
an important role in communicating signals of structural changes between the two domains [8e10]. Hsp70 in the ATP-bound form has a low affinity for substrate; in this state, the carboxy-terminal “lid” is open and allows the access of substrate peptide to SBD. Substrate binding at SBD induces a conformational change at SBD, which is transmitted to NBD and stimulates the ATPase activity of NBD [11e13]. In addition to being activated by substrate binding, the ATPase activity of NBD can also be modulated by a group of cofactors known as J-domain co-chaperones, which promote the conversion of ATP-bound Hsp70 to ADP-bound Hsp70 [14,15]. In the ADP-bound form of Hsp70, the carboxy-terminal “lid” is closed upon SBD, thus trapping the bound substrate inside the binding pocket of SBD. The ADP-bound Hsp70 is subsequently reverted to ATP-bound form with the assistance of nucleotide exchange factors which facilitate the exchange of nucleoside diphosphates for fresh nucleoside triphosphates. Hsp70s assist protein folding and unfolding by recognizing and binding to improperly or partially folded proteins with exposed hydrophobic amino acid residues. As molecular chaperones, Hsp70s are involved in many important cellular processes including protein
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
synthesis, translocation, assembly, and degradation [16]. In addition, recent studies have shown that Hsp70s also play an immunological role by participating in antigen presentation and activation of lymphocytes and dendritic cells [17]. In eukaryotic organisms, several types of Hsp70 have been identified, which differ in expression pattern and cellular function. Of the known Hsp70 isoforms, the cognate hsc70 is expressed in a constitutive manner and functions largely under physiological conditions, whereas the inducible hsp70 is expressed under biological and environmental stress such as those caused by microbial infection and heat shock [18,19]. Regulation of the expression of inducible hsp70 is primarily at the transcription level by heat shock transcription factors (HSFs) which bind to the heat shock element (HSE) in the promoter region of hsp70 [20]. Both Hsp70 and Hsc70 have been identified in a number of fish species. Like in other eukaryotic species, in fish, hsc70s are constitutively expressed in tissue-specific manners as determined by development [21e25], whereas hsp70s are known to be induced by stress factors such as high temperature, microbial infection, and heavy metals [26,27]. Red drum (Sciaenops ocellatus) is an economic fish species that has been extensively cultured in China since 1991. In recent years, disease outbreaks have been reported to occur in red drum farms across China, with the etiological agents being often identified as Streptococcus, Vibrio, and iridovirus [28]. Compared to fish species such as rainbow trout (Oncorhynchus mykiss), red drum is largely unexplored at the genetic and immunological levels. In this report, we described the identification and analysis of an Hsp70 homologue (SoHsp70) from red drum. We found that the expression of SoHsp70 was induced under stress conditions caused by exposures to heat shock, toxic metals, oxidant challenge, and bacterial infections. In addition, SoHsp70 was also upregulated by vaccination with a Streptococcus bacterin. 2. Materials and methods 2.1. Fish Red drum (S. ocellatus) and Japanese flounder (Paralichthys olivaceus) were purchased from commercial fish farms in China and maintained at 24 C and 18 C, respectively, in aerated seawater. Fish were acclimatized in the laboratory for two weeks before experimental manipulation. Fish were anaesthetized with tricaine methanesulfonate (Sigma, USA) prior to experiments involving injection, blood collection, and tissue removal. 2.2. Bacterial strains Streptococcus iniae G26 and Edwardsiella tarda TX1 are fish pathogens that have been described previously [29,30]. Listonella anguillarum C312 is a pathogenic strain isolated from diseased flounder; it was virulent to both Japanese flounder and red drum (median lethal doses less than 5 106 CFU) in live animal infection studies. All strains were cultured in Luria-Bertani broth (LB) [29] medium at 28 C. 2.3. Bacterial challenge and tissue collection for cDNA library construction S. iniae G26 and E. tarda TX1 were cultured in LB medium to midlogarithmic phase and resuspended in phosphate-buffered saline (PBS). Red drum (860e910 g) were randomly divided into two groups (3/group) named A and B. Group A was injected intraperitoneally (i.p.) with 1 108 CFU of G26 and TX1, while group B was injected with PBS. At 24 h post-infection, the fish were sacrificed with a lethal dose of tricaine methanesulfonate, and the spleen, liver,
601
and head kidney were collected under aseptic conditions. Tissues from each fish were pooled together at equal amount and frozen in liquid nitrogen. The pooled tissues were grounded in a mortar, and equal amounts of grounded tissues from each fish were mixed and used for RNA extraction. 2.4. RNA extraction and cDNA library construction Total RNA was isolated from the pooled fish tissues with the RNAprep Tissue/Bacteria Kit (Tiangen, Beijing, China). The RNA was used for the construction of cDNA library with the Super SMART PCR cDNA Synthesis Kit (Clontech, USA) according to manufacturer’s instructions. 2.5. DNA sequencing and cloning of SoHsp70 Plasmid DNA was isolated from w2000 clones of the cDNA library and subjected to DNA sequencing with the standard T7 primer. Blast analysis indicated that one of the expressed sequence tags shares high sequence identities with known Hsp70. The 50 and 30 ends of this Hsp70 homologue (named SoHsp70 for S. ocellatus Hsp70) was obtained by rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, USA) according to manufacturer’s recommendations. 2.6. Sequence analysis The cDNA and amino acid sequences of SoHsp70 were analyzed using the BLAST program at the National Center for Biotechnology Information (NCBI) and the Expert Protein Analysis System. Domain search was performed with the simple modular architecture research tool (SMART) version 4.0 and the conserved domain search program of NCBI. The molecular mass and theoretical isoelectric point were predicted by using EditSeq in DNASTAR software package. 2.7. Plasmid construction pET260 was constructed by inserting linker L812 (50 -TATGAGTACTGGATCCC-30 ) into pET258 [29] between NdeI/XhoI sites. To construct pETRH70, the coding region of SoHsp70 was amplified by PCR with primers RH70F2 (50 - GATATCACCACCATGCCTGCAGCTAAAGGT -30 ; underlined sequence, EcoRV site) and RH70R2 (50 GCGATATCGTCCACCTCCTCAATGGT -30 ; underlined sequence, EcoRV site); the PCR products were ligated with the T-A cloning vector pBS-T (Tiangen, Beijing, China), and the recombinant plasmid was digested with EcoRV to retrieve the 1.9 kb fragment, which was inserted into pET260 at the ScaI site. 2.8. Purification of recombinant protein Escherichia coli BL21(DE3)pLysS (Tiangen, Beijing, China) was transformed with pETRH70. The transformant BL21(DE3)pLysS/ pETRH70 was cultured in LB medium at 37 C to mid-log phase, and the expression of SoHsp70 was induced by adding isopropyl-b-Dthiogalactopyranoside to a final concentration of 0.1 mM. After growth at 37 C for an additional 4.5 h, the cells were harvested by centrifugation, and His-tagged SoHsp70 was purified under native conditions using nickel-nitrilotriacetic acid columns (GE Healthcare, USA) as recommended by the manufacturer. The purified proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized after staining with Coommassie brilliant blue R-250.
602
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
2.9. ATPase assay The basal ATPase activity of recombinant SoHsp70 was determined according to the method of Matambo et al. [31] with slight modification. Briefly, recombinant SoHsp70 was mixed at different concentrations with Buffer I (10 mM Hepes, 10 mM MgCl2, 20 mM KCl, 0.5 mM dithiothreitol, and 1 mM ATP) and incubated at 37 C for 1 h, followed by adding trichloroacetic acid to 15% to stop the reaction. An equal volume of Buffer II (1% ammonium molybdate, 6% ascorbic acid, 2% sodium citrate, and 2% acetic acid) was added to the assay mixture, followed by incubation at 45 C for 25 min. Absorbance at 660 nm was then recorded. As a negative control, recombinant SoHsp70 inactivated by boiling at 100 C for 10 min was also used in the assay. 2.10. Quantitative real time reverse transcriptase PCR (qRT-PCR) analysis of SoHsp70 expression in fish tissues Brain, heart, gill, kidney, spleen, liver, muscle, and blood were taken aseptically from five fish and used for total RNA extraction as described above. One microgram of total RNA was used for cDNA synthesis with the Superscript II reverse transcriptase (Invitrogen, USA). qRT-PCR was carried out in an ABI 7300 Real-time Detection System (Applied Biosystems, USA) by using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously [32]. Each assay was performed in triplicate with b-actin mRNA as the control. The primers used to amplify the b-actin gene were ATF1 (50 -GCCCCACCTGAGCGTAAAT-30 ) and ATR1 (50 -CGGACTCATCATACTCCTGCTT-30 ); the primers used to amplify SoHsp70 were SoH70F1 (50 - TGAGGCGGTGGCTTATGGT-30 ) and SoH70R1 (50 -TGGGTGTGTTTAGCGGGGA-30 ). All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.11. Expression of SoHsp70 in response to experimental challenge E. tarda TX1, L. anguillarum C312, and S. iniae G26 were cultured in LB medium and resuspended in PBS as described above to 5 106 CFU/ml (for TX1 and C312) or 2 107 CFU/ml (for G26). Polyinosinic-polycytidylic acid (poly(I:C)) (Sigma, USA) was suspended in PBS to 0.5 mg/ml. Red drum (w10 g) were divided randomly into five groups (5 fish/group) and injected i.p. with 100 ml of TX1, C312, G26, poly(I:C), and PBS, respectively. Fish were sacrificed at various times post-challenge, and the kidney was removed under aseptic conditions. Total RNA extraction, cDNA synthesis, and qRT-PCR were performed as described above.
from Sangon, Shanghai, China) were added into the cell culture at the final concentrations of 20 mM, 20 mM, 55 nM, and 100 mM, respectively, based on previous reports [34e37]. After incubation at 25 C for various times, the cells (w2 105) were collected and used for RNA extraction with the Total RNA Kit I of Omega Bio-tek (Beijing, China). SoHsp70 expression was then determined by qRTPCR as described above. For heat shock treatment, the cells were shifted from 25 C to 37 C and incubated at the latter temperature for various times. The cells were collected for RNA extraction and qRT-PCR analysis as described above. 2.14. Vaccination S. iniae bacterin was prepared as follows. S. iniae G26 was cultured in LB medium to OD600 of 0.8 and resuspended in PBS containing 1% formalin (Sangon, Shanghai, China). The cells were placed at 4 C for 24 h and then washed several times with PBS. The cells were resuspended in PBS to 1 109 CFU/ml. Red drum (w10 g) were divided randomly into two groups and injected i.p. with 100 ml of G26 or PBS. At four weeks post-vaccination, the fish were challenged with 1 107 CFU of S. iniae G26 that had been cultured in LB medium to mid-logarithmic phase and resuspended in PBS. At various times post-vaccination, fish were sacrificed, and the kidney was removed under aseptic conditions. Preparation of RNA from the kidney and qRT-PCR analysis of SoHsp70 expression were as described above. To determine the adjuvant effect of SoHsp70, two vaccine formulations were prepared: (i) purified recombinant Sip11, a S. iniae antigen [38], was diluted in PBS to 150 mg/ml; (ii) Sip11 plus SoHsp70, which contains 150 mg/ml of purified recombinant Sip11 and SoHsp70 in PBS. Japanese flounder (w8.9 g) were divided randomly into three groups (16 fish/group) and injected i.p. with 100 ml Sip11, Sip11 plus SoHsp70, or PBS. At four weeks post-vaccination, the fish were challenged as described above. Fish were monitored for mortality for 20 days post-challenge, and relative percent of survival (RPS) was calculated according to the following formula: RPS ¼ {1 (% mortality in vaccinated fish/% mortality in control fish)} 100 [39]. 2.15. Statistical analysis All statistical analyses were performed with SPSS 15.0 software (SPSS Inc., USA). Data are presented as means SE, and statistical significances were determined with Student’s t-test. In all cases, significance was defined as P < 0.05. 3. Results
2.12. Cell culture
3.1. Sequence characterization of SoHsp70
Primary cultures of red drum hepatocytes were established as described by Schmid et al. [33]. In brief, red drum liver was removed under aseptic conditions and washed three times with PBS containing 100 U of penicillin and streptomycin (Thermo Scientific HyClone, Beijing, China). The liver was cut into small pieces and digested with trypsin (Sigma, USA). The digested solution was centrifuged at 500 g for 10 min, and cell pellet was resuspended in RPMI 1640 (Thermo Scientific HyClone, Beijing, China) containing 15% fetal bovine serum (FBS) (Thermo Scientific HyClone, Beijing, China) and 100 U of penicillin and streptomycin (1640P). The cells were seeded in monolayers in 96-well culture plates with 1640P and cultivated at 25 C.
The full length cDNA of SoHsp70 (GenBank accession no: GU244375) is 2621 bp, which contains a 50 -untranslated region (UTR) of 399 bp, an open reading frame (ORF) of 1920 bp, and a 30 UTR of 241 bp (Fig. 1). The 30 -UTR is followed by a putative polyadenylation signal AATAAA, which lies 25 bp upstream of the poly-A tail. The ORF encodes a putative protein of 639 amino acids with a predicted molecular mass of 70.4 kDa and a theoretical isoelectric point of 5.43. PCR analysis using red drum genomic DNA as template and the primers specific to the up- and down-stream regions of SoHsp70 ORF produced DNA products that contain the entire ORF without any intron sequence. BLAST analysis showed that SoHsp70 shares high (84e92%) sequence identities with the Hsp70 of Seriola quinqueradiata, Oreochromis aureus, Acanthopagrus schlegelii, Oreochromis niloticus, Fundulus heteroclitus macrolepidotus, Oryzias latipes, and P. olivaceus. In silico analysis using ScanProsite identified in SoHsp70 three Hsp70 family signatures: IDLGTTYS (residues 11e18), IFDLGGGTFDVSIL (residues 199e212),
2.13. Expression of SoHsp70 in response to stress conditions Red drum primary liver cells were maintained in 1640P as described above. FeCl2, CuSO4, HgCl2, and H2O2 (all were purchased
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
603
Fig. 1. The nucleotide and deduced amino acid sequences of SoHsp70. The nucleotides and amino acids are numbered along the left margin. The translation start (ATG) and stop (TAA) codons are in bold, the three Hsp70 family signatures are in grey, the conserved P149 and R157 residues are boxed, and the EEVD motif is underlined.
and IVLVGGSTRIPKIQK (residues 336e350) (Fig. 1). The three conserved Hsp70 domains were identified in SoHsp70 as follows: the NBD between residues 1e383 (42 kDa), the SBD between residues 387 and 545 (17.4 kDa), and the CTD between residues 539 and 622 (9.5 kDa). The NBD and SBD domains are connected by the sequence of DLLLLD, which is a highly conserved interdomain linker found in most Hsp70 proteins. SoHsp70 terminates with the EEVD motif (residues 636e639), a feature of cytosolic Hsp70s, and
possesses the universally conserved P143 and R151 residues (P149 and R157, respectively, in SoHsp70), which are essential to the chaperone activity of Hsp70s [8e10]. 3.2. Expression and purification of recombinant SoHsp70 In order to examine the basal ATPase activity of SoHsp70, the coding sequence of SoHsp70 was subcloned into E. coli BL21(DE3)
604
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
pLysS, and recombinant SoHsp70 with a 6-histidine tag was purified from the E. coli transformant under native conditions. SDSPAGE analysis showed that the purified protein exhibited a molecular mass comparable to that predicted for recombinant SoHsp70 (71 kDa) (Fig. 2). 3.3. ATPase activity of purified recombinant SoHsp70 The ATPase activity of recombinant SoHsp70 was determined by measuring the release of inorganic phosphate. The results showed that recombinant SoHsp70 exhibited apparent ATPase activity which increased with the concentration of the protein (Fig. 3). In contrast, heat-inactivated SoHsp70 exhibited no detectable ATPase activity at low concentrations and only very weak ATPase activity at high concentrations. 3.4. Constitutive expression of SoHsp70 in red drum tissues qRT-PCR was carried out to examine the expression profile of SoHsp70 in muscle, liver, spleen, kidney, heart, brain, blood, and gill of red drum. The results showed that the highest and lowest levels of SoHsp70 expression were found in heart and muscle, respectively (Fig. 4). Compared to SoHsp70 expression in heart, SoHsp70 expressions in liver, spleen, kidney, brain, and blood were moderate but were significantly (P < 0.05) higher than those in muscle and gill. 3.5. Expression of SoHsp70 in response to bacterial challenge To examine whether SoHsp70 expression could be modulated by microbial infections, red drum were experimentally challenged with the Gram-negative fish pathogens E. tarda and L. anguillarum, the Gram-positive fish pathogen S. iniae, and poly(I:C). SoHsp70 expression in kidney was analyzed by qRT-PCR at various times post-challenge. The results showed that both bacterial and poly(I: C) challenges elicited time-dependent expression of SoHsp70 (Fig. 5). The highest induction was observed with poly(I:C) challenge, which caused a 16.6-fold increase at 72 h post-challenge. The stimulating effect of poly(I:C) on SoHsp70 expression was detected throughout the examined time frame and became stronger with time. In contrast, the effect of E. tarda was transient, peaking abruptly at 24 h post-challenge and disappearing completely by 48 h post-challenge. Compared to poly(I:C) and E. tarda, L. anguillarum and S. iniae exhibited moderate enhancing effects on SoHsp70
Fig. 2. SDS-PAGE analysis of purified recombinant SoHsp70. Recombinant SoHsp70 (lane 2) was analyzed by SDS-PAGE (15%) and viewed after staining with Coommassie brilliant blue R-250. Lane 1, protein markers.
Fig. 3. Analysis of the basal ATPase activity of recombinant SoHsp70. The ability of recombinant SoHsp70 to hydrolyze ATP was analyzed in a colorimetric assay. The released inorganic phosphate was quantified by measuring absorbance at 660 nm. As a control, heat-denatured recombinant SoHsp70 was also included in the assay.
expression, which maximized at 8 h and 72 h after L. anguillarum and S. iniae challenges, respectively. 3.6. SoHsp70 expression in red drum hepatocytes in response to stress conditions 3.6.1. SoHsp70 expression in response to thermal stress To examine whether SoHsp70 expression responded to elevated temperature, the primary liver cells of red drum were subjected to heat shock at 37 C for various times and then analyzed for SoHsp70 expression. The results showed that SoHsp70 expression was increased 4.1- and 5.9-fold, respectively, after 10 and 30 min exposure to heat shock treatment but reverted to the control level when the treatment was prolonged to 60 min. 3.6.2. SoHsp70 expression in response to toxic metals and oxidative stress To examine SoHsp70 expression under stress conditions caused by toxic metals and oxidant, primary hepatocytes of red drum were exposed separately to challenges of Fe, Cu, Hg, and H2O2. Subsequent qRT-PCR analyses showed that all the stress conditions induced SoHsp70 expression in time-dependent manners (Fig. 6). The maximum inductions effected by these stressors were comparable, ranging between 2.9-fold in the case of Cu treatment to 3.6-fold in the case of Hg treatment. The effect of Cu appeared to be most
Fig. 4. SoHsp70 expression in different tissues of red drum detected by quantitative real time reverse transcriptase PCR. SoHsp70 expression levels in liver, spleen, kidney, heart, brain, blood, and gill are normalized to that of b-actin mRNA. The normalized SoHsp70mRNA level in kidney was set as 1. Vertical bars represent means SE (N ¼ 5).
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
605
Sip11 plus recombinant SoHsp70, or PBS. The results showed that, following challenge with S. iniae, the accumulated mortalities of the fish vaccinated in the above order were 25%, 12.5%, and 56.3%, respectively, which correspond to RPS rates of 55.6% and 77.8% for fish vaccinated with Sip11 and Sip11 plus SoHsp70, respectively. 4. Discussion
Fig. 5. Expression of SoHsp70 in red drum kidney in response to experimental challenges. Red drum were challenged separately with poly(I:C), Streptococcus iniae, Edwardsiella tarda, Listonella anguillarum, and PBS (control). SoHsp70 expression in kidney was determined by quantitative real time reverse transcriptase PCR at various times postchallenge. The mRNA level of SoHsp70 was normalized to that of b-actin. Values are shown as means SE (N ¼ 5). Significances between PBS-challenged fish and bacterium/ poly(I:C)-challenged fish are indicated with asterisks. *P < 0.05; **P < 0.01.
transient, which peaked at 24 h and dropped to the control level at 48 h of treatment. In contrast, the stimulating effect of Hg lasted from 24 h to 72 h. The expression profiles of SoHsp70 induced by Fe and H2O2 were similar, both showed significant inductions at 48 h and 72 h of treatment. 3.7. SoHsp70 expression in response to vaccination Since Hsp70s are known to possess immunological properties, we examined the expression profile of SoHsp70 following vaccination. For this purpose, red drum were vaccinated with a S. iniae bacterin, and SoHsp70 expression in the kidney was analyzed at 1, 7, and 23 days post-vaccination and 12 h post-bacterial challenge. The results showed that SoHsp70 expression was significantly upregulated at all the examined time points, with drastic inductions (11.4and 16.7-fold respectively) occurring at 7 days post-vaccination and 12 h post-bacterial challenge (Fig. S1 in Supplemental material). 3.8. Adjuvant effect of SoHsp70 To examine whether SoHsp70 possessed any adjuvant effect, Japanese flounder were vaccinated with the S. iniae antigen Sip11,
Fig. 6. SoHsp70 expression in red drum hepatocytes in response to copper, mercury, iron, and hydrogen peroxide. Red drum primary hepatocytes were treated with CuSO4, HgCl2, FeCl2, and H2O2, respectively, and SoHsp70 expression was determined by quantitative real time reverse transcriptase PCR at various times. The mRNA level of SoHsp70 was normalized to that of b-actin. Values are shown as means SE (N ¼ 5). Significances between control (untreated cells) and metal/H2O2-treated cells are indicated with asterisks. *P < 0.05; **P < 0.01.
In this study, we identified and analyzed an Hsp70 homologue, SoHsp70, from red drum. SoHsp70 shares over 90% sequence identities with a number of fish Hsp70s and contains the conserved NBD, SBD, and CTD domains of Hsp70 proteins. The presence of the highly conserved R151 and P143 equivalents and the DLLLLD interdomain linker sequence in SoHsp70 suggests that SoHsp70 may operate through an allosteric mechanism like other Hsp70s. It is known that the EEVD motif at the end of eukaryotic Hsp70s is involved in interactions with cofactors like Hsp40 and TPR domain-containing proteins [40,41]; the possession of this motif by SoHsp70 suggests the possibility that the activity of SoHsp70 may be modulated by cochaperones. Consistent with the presence of Hsp70-characteristic features at the sequence level, SoHsp70 in the form of recombinant protein purified from E. coli exhibited apparent ATPase activity. These results suggest that SoHsp70 is likely to be a functional chaperone and participate in the protein homeostasis of red drum. Like most living organisms, fish react to stress conditions by producing a series of physiological and cellular responses [26,27]. Heat shock, one of the most used stress inducers in experimental studies, is known to upregulate the expression of hsp70 in many fish species [21,42e46]. In our study, we found that SoHsp70 expression was stimulated by exposure to acute thermal challenge in a timedependent manner. Compared to the heat shock effect on hsp70 observed in fish such as Chinook salmon [47], the induction of SoHsp70 by heat shock was rapid and transient, beginning at 10 min and disappearing at 1 h post-stress treatment. This is probably due to the specificities of the experimental system, as it is known that heat-induced hsp70 response varies with factors such as fish species, cell/tissue type, and the temperature at which the cells/tissue/fish were acclimatized before being subjected to thermal stress [48e50]. In our study, the rapid induction of SoHsp70 expression in response to heat shock is consistent with the fact that, like most inducible hsp70 genes, the SoHsp70 gene is intronless, which should enable the messenger RNA of SoHsp70 to be rapidly translated into proteins following stress exposure. Many studies have indicated that environmental stressors such as metal pollutants and toxic chemicals modulate hsp70 expression in fish [27]. For example, Cu, Cd, Pb, and Zn were found to induce the expression of hsp70 in fathead minnow, yellow perch, and rainbow trout [51e54]; arsenite and the herbicide oxyfluoren are known to stimulate hsp70 expression in salmon and the Egyptian Nile fish [55,56]. In addition, oxidative stress has also been found to affect hsp70 expression in some fish species [57,58]. In our study, we found that SoHsp70 expression was significantly upregulated by challenges with Fe, Cu, Hg, and H2O2. H2O2 is a strong oxidant and a highly reactive oxygen species. Likewise, both Fe and Cu are promoters of oxidative stress via their ability to catalyze the production of reactive hydroxyl radicals that have detrimental effects on DNA, protein, and lipids. Given these facts, it is possible that Fe, Cu, and H2O2 may induce SoHsp70 expression via the same mechanism which activates SoHsp70 expression as a protective strategy against the damaging effect of oxidative stress. The difference in the induction profiles of SoHsp70 effected by the different stress factors may reflect the difference in the chemical mechanism through which oxidative pressure is induced. Biological stresses such as those caused by microbial infection are known to induce hsp70 expression. In fish, it is reported that
606
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
infections with the pathogens Renibacterium salmoninarum, Vibrio anguillarum, and Edwardsiella ictaluri upregulated the expression of hsp70 in Coho salmon, rainbow trout, and Channel catfish, respectively [59e61]. Similarly, in the case of SoHsp70, we found that its expression was enhanced by experimental challenges with the fish pathogens E. tarda, L. anguillarum, S. iniae, as well as the doublestranded RNA analogue poly(I:C). These results suggest a role for SoHsp70 in immune defense against bacterial and viral infections. The immune effects of heat shock proteins, particularly Hsp70s, have been reported by many research groups. It is known that, by binding to antigenic peptides, Hsp70s facilitate antigen presentation via the endogenous pathway, which leads to the activation of cytotoxic T cells. In addition, Hsp70s can also activate natural killer cells and elicit innate immune response by the secretion of immunostimulatory cytokines [62,63]. In our study, we found that SoHsp70 was activated at transcription level by vaccination and exhibited apparent adjuvant effect on a subunit vaccine. These results indicate that SoHsp70 participates in vaccine-induced immune response. In conclusion, the results of this study demonstrate that SoHsp70 is an inducible Hsp70 homologue whose expression was modulated by toxic metals, oxidant, bacterial infection, and vaccination. These observations support the idea that SoHsp70 may play a role in multi-aspects of protein homeostasis associated with stress conditions and immune reactions. Acknowledgements This work was supported by the National Basic Research Program of China grant 2006CB101807. Appendix. Supplementary material Supplementary data associated with this article can be found in the online version at doi:10.1016/j.fsi.2010.06.001. References [1] Morano KA. New tricks for an old dog: the evolving world of Hsp70. Ann N Y Acad Sci 2007;1113:1e14. [2] Tavaria M, Gabriele T, Kola I, Anderson RL. A hitchhiker’s guide to the human Hsp70 family. Cell Stress Chaperones 1996;1:23e8. [3] Flaherty KM, DeLuca-Flaherty C, McKay DB. Three-dimensional structure of the ATPase fragment of a 70 K heat-shock cognate protein. Nature 1990;346:623e8. [4] Mayer MP, Brehmer D, Gässler CS, Bukau B. Hsp70 chaperonee machines. Adv Protein Chem 2001;59:1e44. [5] Revington M, Zhang Y, Yip GN, Kurochkin AV, Zuiderweg ER. NMR investigations of allosteric processes in a two-domain Thermus thermophilus Hsp70 molecular chaperonee. J Mol Biol 2005;349:163e83. [6] Scheufler C, Brinker A, Bourenkov G, Pegoraro S, Moroder L, Bartunik H, et al. Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70eHsp90 multichaperonee machine. Cell 2000;101:199e210. [7] Zhu X, Zhao X, Burkholder WF, Gragerov A, Ogata CM, Gottesman ME, et al. Structural analysis of substrate binding by the molecular chaperonee DnaK. Science 1996;272:1606e14. [8] Swain JF, Dinler G, Sivendran R, Montgomery DL, Stotz M, Gierasch LM. Hsp70 chaperonee ligands control domain association via an allosteric mechanism mediated by the interdomain linker. Mol Cell 2007;26:27e39. [9] Vogel M, Bukau B, Mayer MP. Allosteric regulation of Hsp70 chaperonees by a proline switch. Mol Cell 2006;21:359e67. [10] Vogel M, Mayer MP, Bukau B. Allosteric regulation of Hsp70 chaperonees involves a conserved interdomain linker. J Biol Chem 2006;281:38705e11. [11] Han W, Christen P. Interdomain communication in the molecular chaperonee DnaK. Biochem J 2003;369:627e34. [12] Jiang J, Prasad K, Lafer EM, Sousa R. Structural basis of interdomain communication in the Hsc70 chaperonee. Mol Cell 2005;20:513e24. [13] Mayer MP, Bukau B. Hsp70 chaperonees: cellular functions and molecular mechanisms. Cell Mol Life Sci 2005;62:670e84. [14] Craig EA, Huang P, Aron R, Andrew A. The diverse roles of J-proteins, the obligate Hsp70 cochaperonee. Rev Physiol Biochem Pharmacol 2006;156:1e21. [15] Walsh P, Bursac D, Law YC, Cyr D, Lithgow T. The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep 2004;5:567e71. [16] Sharma D, Masison DC. Hsp70 structure, function, regulation and influence on yeast prions. Protein Pept Lett 2009;16:571e81.
[17] Tsan MF, Gao B. Heat shock proteins and immune system. J Leukoc Biol 2009; 85:905e10. [18] Gunther E, Walter L. Genetic aspects of the hsp70 multigene family in vertebrates. Experientia 1994;50:987e1001. [19] Yamashita M, Hirayoshi K, Nagata K. Characterization of multiple members of the HSP70 family in platyfish culture cells: molecular evolution of stress protein HSP70 in vertebrates. Gene 2004;336:207e18. [20] Morimoto RI, Sarge KD, Abravaya K. Transcriptional regulation of heat shock genes. J Biol Chem 1992;267:21987e90. [21] Arai A, Naruse K, Mitani H, Shima A. Cloning and characterization of cDNA for 70-kDa heat-shock protein (Hsp70) from two fish species of genus Oryzias. Jpn J Genet 1995;70:423e33. [22] Graser R, Malner-Dragojevic D, Vincek V. Cloning and characterization of a 70 kD heat shock protein cognate (hsc70) gene from the zebrafish (Danio rerio). Genetica 1996;98:273e6. [23] Park JH, Lee JJ, Yoon S, Lee J, Choe SY, Choe Y, et al. Genomic cloning of the Hsc71 gene in the hermaphroditic teleost Rivulus marmoratus and analysis of its expression in skeletal muscles: identification of a novel muscle-preferred regulatory element. Nucleic Acids Res 2001;29:3041e50. [24] Santacruz H, Vriz S, Angelier N. Molecular characterization of a heat shock cognate cDNA of zebraWsh, hsc70, and developmental expression of corresponding transcripts. Dev Genet 1997;21:223e33. [25] Zafarulla M, Wisnieski J, Shieman S, Shworak N, Misra S, Gedamu L. Molecular cloning and characterization of a constitutively expressed heat-shock-cognate hsc71 gene from rainbow trout. Eur J Biochem 1992;204:893e900. [26] Iwama GK, Vijayan MM, Forsyth RB, Ackerman PA. Heat shock proteins and physiological stress in fish. Am Zool 1999;39:901e9. [27] Iwama GK, Afonso LO, Todgham A, Ackerman P, Nakano K. Are hsps suitable for indicating stressed states in fish? J Exp Biol 2004;207:15e9. [28] Shen ZH, Qian D, Xu WJ, Gu JH, Shao JZ. Isolation, identification and pathogenicity of Streptococcus iniae isolated from red drum Sciaenops Ocellatus. Acta Hydrobiologica Sinica 2005;29:678e83. [29] Zhang WW, Sun L. Cloning, characterization, and molecular application of a beta-agarase gene from Vibrio sp. strain V134. Appl Environ Microbiol 2007; 73:2825e31. [30] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154: 2060e9. [31] Matambo TS, Odunuga OO, Boshoff A, Blatch GL. Over-production, purification and characterization of the Plasmodium falciparum heat shock protein 70. Protein Expr Purif 2004;33:214e22. [32] Zhang WW, Sun K, Cheng S, Sun L. Characterization of DegQVh, a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254e62. [33] Schmid A, Kloas W, Reinecke M. Establishment of a primary liver cell culture from a teleost, Oreochromis mossambicus, the tilapia: a valid tool for physiological studies. In: Bernard A, et al., editors. Animal cell technology: products from cells. Cells as Products; 1999. p. 143e5. [34] Brinker A, Scheufler C, Von Der Mulbe F, Fleckenstein B, Herrmann C, Jung G, et al. Ligand discrimination by TPR domains. Relevance and selectivity of EEVD-recognition in Hsp70 Hop Hsp90 complexes. J Biol Chem 2002;277: 19265e75. [35] Lescure AM, Proudhon D, Pesey H, Ragland M, Theil EC, Briat JF. Ferritin gene transcription is regulated by iron in soybean cell cultures. Proc Natl Acad Sci U S A 1991;88:8222e6. [36] Gauley J, Heikkila JJ. Examination of the expression of the heat shock protein gene, hsp110, in Xenopus laevis cultured cells and embryos. Comp Biochem Physiol A Mol Integr Physiol 2006;145:225e34. [37] Feldlite M, Juanicó M, Karplus I, Milstein A. Towards a safe standard for heavy metals in reclaimed water used for fish aquaculture. Aquaculture 2008;284: 115e26. [38] Cheng S, Hu Y, Jiao X, Sun L. Identification and immunoprotective analysis of a Streptococcus iniae subunit vaccine candidate. Vaccine 2010;28:2636e41. [39] Amend D.F.. Potency testing of fish vaccines. In: International symposium on fish biologics: serodiagnostics and vaccines. Dev Biol Stand 1981;vols. 49: 447e454. [40] Fauconneau B, Petegnief V, Sanfeliu C, Piriou A, Planas AM. Induction of heat shock proteins (HSPs) by sodium arsenite in cultured astrocytes and reduction of hydrogen peroxide-induced cell death. J Neurochem 2002;83:1338e48. [41] Freeman BC, Myers MP, Schumacher R, Morimoto RI. Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J 1995;14:2281e92. [42] Basu N, Todgham AE, Ackerman PA, Bibeau MR, Nakano K, Schulte PM, et al. Heat shock protein genes and their functional significance in fish. Gene 2002;295:173e83. [43] Currie S, Moyes CD, Tufts BL. The effects of heat shock and acclimation temperature on hsp70 and hsp30 mRNA expression in rainbow trout: in vivo and in vitro comparisons. J Fish Biol 2000;56:398e408. [44] Lele Z, Engel S, Krone P. Hsp47 and hsp70 gene expression is differentially regulated in a stress- and tissue-specific manner in zebrafish embryos. Dev Genet 1997;21:123e33. [45] Modisakeng KW, Jiwaji M, Pesce ER, Robert J, Amemiya CT, Dorrington RA, et al. Isolation of a Latimeria menadoensis heat shock protein 70 (Lmhsp70) that has all the features of an inducible gene and encodes a functional molecular chaperonee. Mol Genet Genomics 2009;282:185e96.
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607 [46] Molina A, Biemar F, Müller F, Iyengar A, Prunet P, Maclean N, et al. Cloning and expression analysis of an inducible HSP70 gene from tilapia Wsh. FEBS Lett 2000;474:5e10. [47] Gedamu L, Culham B, Heikkila JJ. Analysis of the temperature-dependent temporal pattern of heat-shock-protein synthesis in fish cells. Biosci Rep 1983;3:647e58. [48] Clark MS, Peck LS. Triggers of the HSP70 stress response: environmental responses and laboratory manipulation in an Antarctic marine invertebrate (Nacella concinna). Cell Stress Chaperones 2009;14:649e60. [49] Dietz TJ, Somero GN. Species- and tissue-specific synthesis patterns for heatshock proteins HSP70 and HSP90 in several marine teleost fishes. Physiol Zool 1993;66:863e80. [50] Dyer SD, Dickson KL, Zimmerman EG. Tissue-specific patterns of synthesis of heat-shock proteins and thermal tolerance of the fathead minnow (Pimephales promelas). Can J Zool 1991;69:2021e7. [51] Sanders BM, Nguyen J, Martin LS, Howe SR, Coventry S. Induction and subcellular localization of two major stress proteins in response to copper in the fathead minnow Pimephales promelas. Comp Biochem Physiol 1995;112:335e43. [52] Pierron F, Bourret V, St-Cyr J, Campbell PG, Bernatchez L, Couture P. Transcriptional responses to environmental metal exposure in wild yellow perch (Perca flavescens) collected in lakes with differing environmental metal concentrations (Cd, Cu, Ni). Ecotoxicology 2009;18:620e31. [53] Feng Q, Boone AN, Vijayan MM. Copper impact on heat shock protein 70 expression and apoptosis in rainbow trout hepatocytes. Comp Biochem Physiol C Toxicol Pharmacol 2003;135C:345e55. [54] Williams JH, Farag AM, Stansbury MA, Young PA, Bergman HL, Petersen NS. Accumulation of hsp70 in juvenile and adult rainbow trout gill exposed to metal-contaminated water and/or diet. Environ Toxicol Chem 1996;15:1324e8.
607
[55] Grosvik BE, Goksoyr A. Biomarker protein expression in primary cultures of salmon (Salmo salar L.) hepatocytes exposed to environmental pollutants. Biomarkers 1996;1:45e53. [56] Hassanein HMA, Banhawy MA, Soliman FM, Abdel-Rehim SA, Muller WEG, Schroder HC. Induction of hsp70 by the herbicide oxyfluoren (goal) in the Egyptian Nile fish, Oreochromis niloticus. Arch Environ Contam Toxicol 1999; 37:78e84. [57] Padmini E, Geetha BV. Modulation of ASK1 expression during overexpression of Trx and HSP70 in stressed fish liver mitochondria. Cell Stress Chaperones 2009;14:459e67. [58] Padmini E, Rani MU. Impact of seasonal variation on HSP70 expression quantitated in stressed fish hepatocytes. Comp Biochem Physiol B Biochem Mol Biol 2008;151:278e85. [59] Forsyth RB, Candido EPM, Babich SL, Iwama GK. Stress protein expression in coho salmon with bacterial kidney disease. J Aquat Anim Health 1997;9: 18e25. [60] Ackerman PA, Iwama GK. Physiological and cellular stress responses of juvenile rainbow trout to vibriosis. J Aquat Anim Health 2001;13:173e80. [61] Elibol-Flemming B, Waldbieser GC, Wolters WR, Boyle CR, Hanson LA. Expression analysis of selected immune-relevant genes in channel catfish during Edwardsiella ictaluri infection. J Aquat Anim Health 2009;21:23e35. [62] Gastpar R, Gross C, Rossbacher L, Ellwart J, Riegger J, Multhoff G. The cell surface-localized heat shock protein 70 epitope TKD induces migration and cytolytic activity selectively in human NK cells. J Immunol 2004;172:972e80. [63] Asea A, Kraeft S-K, Kurt-Jones EA, Stevenson MA, Chen LB, Finberg RW, et al. Hsp70 stimulates cytokine production through a CD14-dependent pathway, demonstrating its dual role as a chaperonee and cytokine. Nat Med 2000;6: 435e42.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Identification and molecular analysis of a stress-inducible Hsp70 from Sciaenops ocellatus Wei Dang a, b, Yong-hua Hu a, Min Zhang a, Li Sun a, * a b
Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, PR China Graduate University of the Chinese Academy of Sciences, Beijing 100049, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 December 2009 Received in revised form 12 May 2010 Accepted 1 June 2010 Available online 9 June 2010
Hsp70 proteins are a family of molecular chaperones that are involved in many aspects of protein homeostasis. In this study, an Hsp70 homologue (SoHsp70) was identified from red drum Sciaenops ocellatus and analyzed at molecular level. The open reading frame of SoHsp70 is 1920 bp and intronless, with a 50 -untranslated region (UTR) of 399 bp and a 30 -UTR of 241 bp. The deduced amino acid sequence of SoHsp70 shares 84e92% overall identities with the Hsp70s of a number of fish species. In silico analysis identified in SoHsp70 three conserved Hsp70 domains involved in nucleotide and substrate binding. The coding sequence of SoHsp70 was subcloned into Escherichia coli, from which recombinant SoHsp70 was purified and, upon ATPase assay, found to exhibit apparent ATPase activity. Expressional analysis showed that constitutive expression of SoHsp70 was detectable in heart, liver, spleen, kidney, brain, blood, and gill. Experimental challenges with poly(I:C) and bacterial pathogens of Gram-positive and Gram-negative nature induced SoHsp70 expression in kidney to different levels. Stress-responsive analysis of SoHsp70 expression in primary cultures of red drum hepatocytes showed that acute heat shock treatment elicited a rapid induction of SoHsp70 expression which appeared after 10 min and 30 min of treatment. Exposure of hepatocytes separately to iron, copper, mercury, and hydrogen peroxide significantly upregulated SoHsp70 expression in time-dependent manners. Vaccination of red drum with a Streptococcus iniae bacterin was also found to induce SoHsp70 expression. Furthermore, recombinant SoHsp70 enhanced the immunoprotective effect of a subunit vaccine. Taken together, these results suggest that SoHsp70 is a stress-inducible protein that is likely to play a role in immunity and in coping with environmental and biological stresses. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Heat shock protein Hsp70 Sciaenops Ocellatus Stress
1. Introduction The 70-kDa heat shock proteins (Hsp70s) are a family of molecular chaperones existing ubiquitously in most living organisms ranging from bacteria to humans. These proteins are highly conserved and play essential roles under both stress and physiological conditions [1,2]. Structurally, Hsp70s possess three functional domains: (i) a w44 kDa amino-terminal adenine nucleotide-binding domain (NBD) or ATPase domain, which binds and hydrolyzes ATP, whereby providing energy for substrate binding and releasing; (ii) an w18 kDa substrate binding domain (SBD), which consists of two b-sheets that form a pocket structure where substrate-interaction occurs; (iii) a w10 kDa carboxy-terminal domain (CTD), which is rich in a-helices and adopts a lid-like structure that is positioned over SBD [3e7]. The short stretch of linker sequence that connects NBD and SBD is highly conserved among Hsp70 proteins and plays
* Corresponding author. Tel./fax: þ86 532 82898829. E-mail address: [email protected] (L. Sun). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.06.001
an important role in communicating signals of structural changes between the two domains [8e10]. Hsp70 in the ATP-bound form has a low affinity for substrate; in this state, the carboxy-terminal “lid” is open and allows the access of substrate peptide to SBD. Substrate binding at SBD induces a conformational change at SBD, which is transmitted to NBD and stimulates the ATPase activity of NBD [11e13]. In addition to being activated by substrate binding, the ATPase activity of NBD can also be modulated by a group of cofactors known as J-domain co-chaperones, which promote the conversion of ATP-bound Hsp70 to ADP-bound Hsp70 [14,15]. In the ADP-bound form of Hsp70, the carboxy-terminal “lid” is closed upon SBD, thus trapping the bound substrate inside the binding pocket of SBD. The ADP-bound Hsp70 is subsequently reverted to ATP-bound form with the assistance of nucleotide exchange factors which facilitate the exchange of nucleoside diphosphates for fresh nucleoside triphosphates. Hsp70s assist protein folding and unfolding by recognizing and binding to improperly or partially folded proteins with exposed hydrophobic amino acid residues. As molecular chaperones, Hsp70s are involved in many important cellular processes including protein
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
synthesis, translocation, assembly, and degradation [16]. In addition, recent studies have shown that Hsp70s also play an immunological role by participating in antigen presentation and activation of lymphocytes and dendritic cells [17]. In eukaryotic organisms, several types of Hsp70 have been identified, which differ in expression pattern and cellular function. Of the known Hsp70 isoforms, the cognate hsc70 is expressed in a constitutive manner and functions largely under physiological conditions, whereas the inducible hsp70 is expressed under biological and environmental stress such as those caused by microbial infection and heat shock [18,19]. Regulation of the expression of inducible hsp70 is primarily at the transcription level by heat shock transcription factors (HSFs) which bind to the heat shock element (HSE) in the promoter region of hsp70 [20]. Both Hsp70 and Hsc70 have been identified in a number of fish species. Like in other eukaryotic species, in fish, hsc70s are constitutively expressed in tissue-specific manners as determined by development [21e25], whereas hsp70s are known to be induced by stress factors such as high temperature, microbial infection, and heavy metals [26,27]. Red drum (Sciaenops ocellatus) is an economic fish species that has been extensively cultured in China since 1991. In recent years, disease outbreaks have been reported to occur in red drum farms across China, with the etiological agents being often identified as Streptococcus, Vibrio, and iridovirus [28]. Compared to fish species such as rainbow trout (Oncorhynchus mykiss), red drum is largely unexplored at the genetic and immunological levels. In this report, we described the identification and analysis of an Hsp70 homologue (SoHsp70) from red drum. We found that the expression of SoHsp70 was induced under stress conditions caused by exposures to heat shock, toxic metals, oxidant challenge, and bacterial infections. In addition, SoHsp70 was also upregulated by vaccination with a Streptococcus bacterin. 2. Materials and methods 2.1. Fish Red drum (S. ocellatus) and Japanese flounder (Paralichthys olivaceus) were purchased from commercial fish farms in China and maintained at 24 C and 18 C, respectively, in aerated seawater. Fish were acclimatized in the laboratory for two weeks before experimental manipulation. Fish were anaesthetized with tricaine methanesulfonate (Sigma, USA) prior to experiments involving injection, blood collection, and tissue removal. 2.2. Bacterial strains Streptococcus iniae G26 and Edwardsiella tarda TX1 are fish pathogens that have been described previously [29,30]. Listonella anguillarum C312 is a pathogenic strain isolated from diseased flounder; it was virulent to both Japanese flounder and red drum (median lethal doses less than 5 106 CFU) in live animal infection studies. All strains were cultured in Luria-Bertani broth (LB) [29] medium at 28 C. 2.3. Bacterial challenge and tissue collection for cDNA library construction S. iniae G26 and E. tarda TX1 were cultured in LB medium to midlogarithmic phase and resuspended in phosphate-buffered saline (PBS). Red drum (860e910 g) were randomly divided into two groups (3/group) named A and B. Group A was injected intraperitoneally (i.p.) with 1 108 CFU of G26 and TX1, while group B was injected with PBS. At 24 h post-infection, the fish were sacrificed with a lethal dose of tricaine methanesulfonate, and the spleen, liver,
601
and head kidney were collected under aseptic conditions. Tissues from each fish were pooled together at equal amount and frozen in liquid nitrogen. The pooled tissues were grounded in a mortar, and equal amounts of grounded tissues from each fish were mixed and used for RNA extraction. 2.4. RNA extraction and cDNA library construction Total RNA was isolated from the pooled fish tissues with the RNAprep Tissue/Bacteria Kit (Tiangen, Beijing, China). The RNA was used for the construction of cDNA library with the Super SMART PCR cDNA Synthesis Kit (Clontech, USA) according to manufacturer’s instructions. 2.5. DNA sequencing and cloning of SoHsp70 Plasmid DNA was isolated from w2000 clones of the cDNA library and subjected to DNA sequencing with the standard T7 primer. Blast analysis indicated that one of the expressed sequence tags shares high sequence identities with known Hsp70. The 50 and 30 ends of this Hsp70 homologue (named SoHsp70 for S. ocellatus Hsp70) was obtained by rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, USA) according to manufacturer’s recommendations. 2.6. Sequence analysis The cDNA and amino acid sequences of SoHsp70 were analyzed using the BLAST program at the National Center for Biotechnology Information (NCBI) and the Expert Protein Analysis System. Domain search was performed with the simple modular architecture research tool (SMART) version 4.0 and the conserved domain search program of NCBI. The molecular mass and theoretical isoelectric point were predicted by using EditSeq in DNASTAR software package. 2.7. Plasmid construction pET260 was constructed by inserting linker L812 (50 -TATGAGTACTGGATCCC-30 ) into pET258 [29] between NdeI/XhoI sites. To construct pETRH70, the coding region of SoHsp70 was amplified by PCR with primers RH70F2 (50 - GATATCACCACCATGCCTGCAGCTAAAGGT -30 ; underlined sequence, EcoRV site) and RH70R2 (50 GCGATATCGTCCACCTCCTCAATGGT -30 ; underlined sequence, EcoRV site); the PCR products were ligated with the T-A cloning vector pBS-T (Tiangen, Beijing, China), and the recombinant plasmid was digested with EcoRV to retrieve the 1.9 kb fragment, which was inserted into pET260 at the ScaI site. 2.8. Purification of recombinant protein Escherichia coli BL21(DE3)pLysS (Tiangen, Beijing, China) was transformed with pETRH70. The transformant BL21(DE3)pLysS/ pETRH70 was cultured in LB medium at 37 C to mid-log phase, and the expression of SoHsp70 was induced by adding isopropyl-b-Dthiogalactopyranoside to a final concentration of 0.1 mM. After growth at 37 C for an additional 4.5 h, the cells were harvested by centrifugation, and His-tagged SoHsp70 was purified under native conditions using nickel-nitrilotriacetic acid columns (GE Healthcare, USA) as recommended by the manufacturer. The purified proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized after staining with Coommassie brilliant blue R-250.
602
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
2.9. ATPase assay The basal ATPase activity of recombinant SoHsp70 was determined according to the method of Matambo et al. [31] with slight modification. Briefly, recombinant SoHsp70 was mixed at different concentrations with Buffer I (10 mM Hepes, 10 mM MgCl2, 20 mM KCl, 0.5 mM dithiothreitol, and 1 mM ATP) and incubated at 37 C for 1 h, followed by adding trichloroacetic acid to 15% to stop the reaction. An equal volume of Buffer II (1% ammonium molybdate, 6% ascorbic acid, 2% sodium citrate, and 2% acetic acid) was added to the assay mixture, followed by incubation at 45 C for 25 min. Absorbance at 660 nm was then recorded. As a negative control, recombinant SoHsp70 inactivated by boiling at 100 C for 10 min was also used in the assay. 2.10. Quantitative real time reverse transcriptase PCR (qRT-PCR) analysis of SoHsp70 expression in fish tissues Brain, heart, gill, kidney, spleen, liver, muscle, and blood were taken aseptically from five fish and used for total RNA extraction as described above. One microgram of total RNA was used for cDNA synthesis with the Superscript II reverse transcriptase (Invitrogen, USA). qRT-PCR was carried out in an ABI 7300 Real-time Detection System (Applied Biosystems, USA) by using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China) as described previously [32]. Each assay was performed in triplicate with b-actin mRNA as the control. The primers used to amplify the b-actin gene were ATF1 (50 -GCCCCACCTGAGCGTAAAT-30 ) and ATR1 (50 -CGGACTCATCATACTCCTGCTT-30 ); the primers used to amplify SoHsp70 were SoH70F1 (50 - TGAGGCGGTGGCTTATGGT-30 ) and SoH70R1 (50 -TGGGTGTGTTTAGCGGGGA-30 ). All data are given in terms of relative mRNA, expressed as means plus or minus standard errors of the means (SE). 2.11. Expression of SoHsp70 in response to experimental challenge E. tarda TX1, L. anguillarum C312, and S. iniae G26 were cultured in LB medium and resuspended in PBS as described above to 5 106 CFU/ml (for TX1 and C312) or 2 107 CFU/ml (for G26). Polyinosinic-polycytidylic acid (poly(I:C)) (Sigma, USA) was suspended in PBS to 0.5 mg/ml. Red drum (w10 g) were divided randomly into five groups (5 fish/group) and injected i.p. with 100 ml of TX1, C312, G26, poly(I:C), and PBS, respectively. Fish were sacrificed at various times post-challenge, and the kidney was removed under aseptic conditions. Total RNA extraction, cDNA synthesis, and qRT-PCR were performed as described above.
from Sangon, Shanghai, China) were added into the cell culture at the final concentrations of 20 mM, 20 mM, 55 nM, and 100 mM, respectively, based on previous reports [34e37]. After incubation at 25 C for various times, the cells (w2 105) were collected and used for RNA extraction with the Total RNA Kit I of Omega Bio-tek (Beijing, China). SoHsp70 expression was then determined by qRTPCR as described above. For heat shock treatment, the cells were shifted from 25 C to 37 C and incubated at the latter temperature for various times. The cells were collected for RNA extraction and qRT-PCR analysis as described above. 2.14. Vaccination S. iniae bacterin was prepared as follows. S. iniae G26 was cultured in LB medium to OD600 of 0.8 and resuspended in PBS containing 1% formalin (Sangon, Shanghai, China). The cells were placed at 4 C for 24 h and then washed several times with PBS. The cells were resuspended in PBS to 1 109 CFU/ml. Red drum (w10 g) were divided randomly into two groups and injected i.p. with 100 ml of G26 or PBS. At four weeks post-vaccination, the fish were challenged with 1 107 CFU of S. iniae G26 that had been cultured in LB medium to mid-logarithmic phase and resuspended in PBS. At various times post-vaccination, fish were sacrificed, and the kidney was removed under aseptic conditions. Preparation of RNA from the kidney and qRT-PCR analysis of SoHsp70 expression were as described above. To determine the adjuvant effect of SoHsp70, two vaccine formulations were prepared: (i) purified recombinant Sip11, a S. iniae antigen [38], was diluted in PBS to 150 mg/ml; (ii) Sip11 plus SoHsp70, which contains 150 mg/ml of purified recombinant Sip11 and SoHsp70 in PBS. Japanese flounder (w8.9 g) were divided randomly into three groups (16 fish/group) and injected i.p. with 100 ml Sip11, Sip11 plus SoHsp70, or PBS. At four weeks post-vaccination, the fish were challenged as described above. Fish were monitored for mortality for 20 days post-challenge, and relative percent of survival (RPS) was calculated according to the following formula: RPS ¼ {1 (% mortality in vaccinated fish/% mortality in control fish)} 100 [39]. 2.15. Statistical analysis All statistical analyses were performed with SPSS 15.0 software (SPSS Inc., USA). Data are presented as means SE, and statistical significances were determined with Student’s t-test. In all cases, significance was defined as P < 0.05. 3. Results
2.12. Cell culture
3.1. Sequence characterization of SoHsp70
Primary cultures of red drum hepatocytes were established as described by Schmid et al. [33]. In brief, red drum liver was removed under aseptic conditions and washed three times with PBS containing 100 U of penicillin and streptomycin (Thermo Scientific HyClone, Beijing, China). The liver was cut into small pieces and digested with trypsin (Sigma, USA). The digested solution was centrifuged at 500 g for 10 min, and cell pellet was resuspended in RPMI 1640 (Thermo Scientific HyClone, Beijing, China) containing 15% fetal bovine serum (FBS) (Thermo Scientific HyClone, Beijing, China) and 100 U of penicillin and streptomycin (1640P). The cells were seeded in monolayers in 96-well culture plates with 1640P and cultivated at 25 C.
The full length cDNA of SoHsp70 (GenBank accession no: GU244375) is 2621 bp, which contains a 50 -untranslated region (UTR) of 399 bp, an open reading frame (ORF) of 1920 bp, and a 30 UTR of 241 bp (Fig. 1). The 30 -UTR is followed by a putative polyadenylation signal AATAAA, which lies 25 bp upstream of the poly-A tail. The ORF encodes a putative protein of 639 amino acids with a predicted molecular mass of 70.4 kDa and a theoretical isoelectric point of 5.43. PCR analysis using red drum genomic DNA as template and the primers specific to the up- and down-stream regions of SoHsp70 ORF produced DNA products that contain the entire ORF without any intron sequence. BLAST analysis showed that SoHsp70 shares high (84e92%) sequence identities with the Hsp70 of Seriola quinqueradiata, Oreochromis aureus, Acanthopagrus schlegelii, Oreochromis niloticus, Fundulus heteroclitus macrolepidotus, Oryzias latipes, and P. olivaceus. In silico analysis using ScanProsite identified in SoHsp70 three Hsp70 family signatures: IDLGTTYS (residues 11e18), IFDLGGGTFDVSIL (residues 199e212),
2.13. Expression of SoHsp70 in response to stress conditions Red drum primary liver cells were maintained in 1640P as described above. FeCl2, CuSO4, HgCl2, and H2O2 (all were purchased
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
603
Fig. 1. The nucleotide and deduced amino acid sequences of SoHsp70. The nucleotides and amino acids are numbered along the left margin. The translation start (ATG) and stop (TAA) codons are in bold, the three Hsp70 family signatures are in grey, the conserved P149 and R157 residues are boxed, and the EEVD motif is underlined.
and IVLVGGSTRIPKIQK (residues 336e350) (Fig. 1). The three conserved Hsp70 domains were identified in SoHsp70 as follows: the NBD between residues 1e383 (42 kDa), the SBD between residues 387 and 545 (17.4 kDa), and the CTD between residues 539 and 622 (9.5 kDa). The NBD and SBD domains are connected by the sequence of DLLLLD, which is a highly conserved interdomain linker found in most Hsp70 proteins. SoHsp70 terminates with the EEVD motif (residues 636e639), a feature of cytosolic Hsp70s, and
possesses the universally conserved P143 and R151 residues (P149 and R157, respectively, in SoHsp70), which are essential to the chaperone activity of Hsp70s [8e10]. 3.2. Expression and purification of recombinant SoHsp70 In order to examine the basal ATPase activity of SoHsp70, the coding sequence of SoHsp70 was subcloned into E. coli BL21(DE3)
604
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
pLysS, and recombinant SoHsp70 with a 6-histidine tag was purified from the E. coli transformant under native conditions. SDSPAGE analysis showed that the purified protein exhibited a molecular mass comparable to that predicted for recombinant SoHsp70 (71 kDa) (Fig. 2). 3.3. ATPase activity of purified recombinant SoHsp70 The ATPase activity of recombinant SoHsp70 was determined by measuring the release of inorganic phosphate. The results showed that recombinant SoHsp70 exhibited apparent ATPase activity which increased with the concentration of the protein (Fig. 3). In contrast, heat-inactivated SoHsp70 exhibited no detectable ATPase activity at low concentrations and only very weak ATPase activity at high concentrations. 3.4. Constitutive expression of SoHsp70 in red drum tissues qRT-PCR was carried out to examine the expression profile of SoHsp70 in muscle, liver, spleen, kidney, heart, brain, blood, and gill of red drum. The results showed that the highest and lowest levels of SoHsp70 expression were found in heart and muscle, respectively (Fig. 4). Compared to SoHsp70 expression in heart, SoHsp70 expressions in liver, spleen, kidney, brain, and blood were moderate but were significantly (P < 0.05) higher than those in muscle and gill. 3.5. Expression of SoHsp70 in response to bacterial challenge To examine whether SoHsp70 expression could be modulated by microbial infections, red drum were experimentally challenged with the Gram-negative fish pathogens E. tarda and L. anguillarum, the Gram-positive fish pathogen S. iniae, and poly(I:C). SoHsp70 expression in kidney was analyzed by qRT-PCR at various times post-challenge. The results showed that both bacterial and poly(I: C) challenges elicited time-dependent expression of SoHsp70 (Fig. 5). The highest induction was observed with poly(I:C) challenge, which caused a 16.6-fold increase at 72 h post-challenge. The stimulating effect of poly(I:C) on SoHsp70 expression was detected throughout the examined time frame and became stronger with time. In contrast, the effect of E. tarda was transient, peaking abruptly at 24 h post-challenge and disappearing completely by 48 h post-challenge. Compared to poly(I:C) and E. tarda, L. anguillarum and S. iniae exhibited moderate enhancing effects on SoHsp70
Fig. 2. SDS-PAGE analysis of purified recombinant SoHsp70. Recombinant SoHsp70 (lane 2) was analyzed by SDS-PAGE (15%) and viewed after staining with Coommassie brilliant blue R-250. Lane 1, protein markers.
Fig. 3. Analysis of the basal ATPase activity of recombinant SoHsp70. The ability of recombinant SoHsp70 to hydrolyze ATP was analyzed in a colorimetric assay. The released inorganic phosphate was quantified by measuring absorbance at 660 nm. As a control, heat-denatured recombinant SoHsp70 was also included in the assay.
expression, which maximized at 8 h and 72 h after L. anguillarum and S. iniae challenges, respectively. 3.6. SoHsp70 expression in red drum hepatocytes in response to stress conditions 3.6.1. SoHsp70 expression in response to thermal stress To examine whether SoHsp70 expression responded to elevated temperature, the primary liver cells of red drum were subjected to heat shock at 37 C for various times and then analyzed for SoHsp70 expression. The results showed that SoHsp70 expression was increased 4.1- and 5.9-fold, respectively, after 10 and 30 min exposure to heat shock treatment but reverted to the control level when the treatment was prolonged to 60 min. 3.6.2. SoHsp70 expression in response to toxic metals and oxidative stress To examine SoHsp70 expression under stress conditions caused by toxic metals and oxidant, primary hepatocytes of red drum were exposed separately to challenges of Fe, Cu, Hg, and H2O2. Subsequent qRT-PCR analyses showed that all the stress conditions induced SoHsp70 expression in time-dependent manners (Fig. 6). The maximum inductions effected by these stressors were comparable, ranging between 2.9-fold in the case of Cu treatment to 3.6-fold in the case of Hg treatment. The effect of Cu appeared to be most
Fig. 4. SoHsp70 expression in different tissues of red drum detected by quantitative real time reverse transcriptase PCR. SoHsp70 expression levels in liver, spleen, kidney, heart, brain, blood, and gill are normalized to that of b-actin mRNA. The normalized SoHsp70mRNA level in kidney was set as 1. Vertical bars represent means SE (N ¼ 5).
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
605
Sip11 plus recombinant SoHsp70, or PBS. The results showed that, following challenge with S. iniae, the accumulated mortalities of the fish vaccinated in the above order were 25%, 12.5%, and 56.3%, respectively, which correspond to RPS rates of 55.6% and 77.8% for fish vaccinated with Sip11 and Sip11 plus SoHsp70, respectively. 4. Discussion
Fig. 5. Expression of SoHsp70 in red drum kidney in response to experimental challenges. Red drum were challenged separately with poly(I:C), Streptococcus iniae, Edwardsiella tarda, Listonella anguillarum, and PBS (control). SoHsp70 expression in kidney was determined by quantitative real time reverse transcriptase PCR at various times postchallenge. The mRNA level of SoHsp70 was normalized to that of b-actin. Values are shown as means SE (N ¼ 5). Significances between PBS-challenged fish and bacterium/ poly(I:C)-challenged fish are indicated with asterisks. *P < 0.05; **P < 0.01.
transient, which peaked at 24 h and dropped to the control level at 48 h of treatment. In contrast, the stimulating effect of Hg lasted from 24 h to 72 h. The expression profiles of SoHsp70 induced by Fe and H2O2 were similar, both showed significant inductions at 48 h and 72 h of treatment. 3.7. SoHsp70 expression in response to vaccination Since Hsp70s are known to possess immunological properties, we examined the expression profile of SoHsp70 following vaccination. For this purpose, red drum were vaccinated with a S. iniae bacterin, and SoHsp70 expression in the kidney was analyzed at 1, 7, and 23 days post-vaccination and 12 h post-bacterial challenge. The results showed that SoHsp70 expression was significantly upregulated at all the examined time points, with drastic inductions (11.4and 16.7-fold respectively) occurring at 7 days post-vaccination and 12 h post-bacterial challenge (Fig. S1 in Supplemental material). 3.8. Adjuvant effect of SoHsp70 To examine whether SoHsp70 possessed any adjuvant effect, Japanese flounder were vaccinated with the S. iniae antigen Sip11,
Fig. 6. SoHsp70 expression in red drum hepatocytes in response to copper, mercury, iron, and hydrogen peroxide. Red drum primary hepatocytes were treated with CuSO4, HgCl2, FeCl2, and H2O2, respectively, and SoHsp70 expression was determined by quantitative real time reverse transcriptase PCR at various times. The mRNA level of SoHsp70 was normalized to that of b-actin. Values are shown as means SE (N ¼ 5). Significances between control (untreated cells) and metal/H2O2-treated cells are indicated with asterisks. *P < 0.05; **P < 0.01.
In this study, we identified and analyzed an Hsp70 homologue, SoHsp70, from red drum. SoHsp70 shares over 90% sequence identities with a number of fish Hsp70s and contains the conserved NBD, SBD, and CTD domains of Hsp70 proteins. The presence of the highly conserved R151 and P143 equivalents and the DLLLLD interdomain linker sequence in SoHsp70 suggests that SoHsp70 may operate through an allosteric mechanism like other Hsp70s. It is known that the EEVD motif at the end of eukaryotic Hsp70s is involved in interactions with cofactors like Hsp40 and TPR domain-containing proteins [40,41]; the possession of this motif by SoHsp70 suggests the possibility that the activity of SoHsp70 may be modulated by cochaperones. Consistent with the presence of Hsp70-characteristic features at the sequence level, SoHsp70 in the form of recombinant protein purified from E. coli exhibited apparent ATPase activity. These results suggest that SoHsp70 is likely to be a functional chaperone and participate in the protein homeostasis of red drum. Like most living organisms, fish react to stress conditions by producing a series of physiological and cellular responses [26,27]. Heat shock, one of the most used stress inducers in experimental studies, is known to upregulate the expression of hsp70 in many fish species [21,42e46]. In our study, we found that SoHsp70 expression was stimulated by exposure to acute thermal challenge in a timedependent manner. Compared to the heat shock effect on hsp70 observed in fish such as Chinook salmon [47], the induction of SoHsp70 by heat shock was rapid and transient, beginning at 10 min and disappearing at 1 h post-stress treatment. This is probably due to the specificities of the experimental system, as it is known that heat-induced hsp70 response varies with factors such as fish species, cell/tissue type, and the temperature at which the cells/tissue/fish were acclimatized before being subjected to thermal stress [48e50]. In our study, the rapid induction of SoHsp70 expression in response to heat shock is consistent with the fact that, like most inducible hsp70 genes, the SoHsp70 gene is intronless, which should enable the messenger RNA of SoHsp70 to be rapidly translated into proteins following stress exposure. Many studies have indicated that environmental stressors such as metal pollutants and toxic chemicals modulate hsp70 expression in fish [27]. For example, Cu, Cd, Pb, and Zn were found to induce the expression of hsp70 in fathead minnow, yellow perch, and rainbow trout [51e54]; arsenite and the herbicide oxyfluoren are known to stimulate hsp70 expression in salmon and the Egyptian Nile fish [55,56]. In addition, oxidative stress has also been found to affect hsp70 expression in some fish species [57,58]. In our study, we found that SoHsp70 expression was significantly upregulated by challenges with Fe, Cu, Hg, and H2O2. H2O2 is a strong oxidant and a highly reactive oxygen species. Likewise, both Fe and Cu are promoters of oxidative stress via their ability to catalyze the production of reactive hydroxyl radicals that have detrimental effects on DNA, protein, and lipids. Given these facts, it is possible that Fe, Cu, and H2O2 may induce SoHsp70 expression via the same mechanism which activates SoHsp70 expression as a protective strategy against the damaging effect of oxidative stress. The difference in the induction profiles of SoHsp70 effected by the different stress factors may reflect the difference in the chemical mechanism through which oxidative pressure is induced. Biological stresses such as those caused by microbial infection are known to induce hsp70 expression. In fish, it is reported that
606
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607
infections with the pathogens Renibacterium salmoninarum, Vibrio anguillarum, and Edwardsiella ictaluri upregulated the expression of hsp70 in Coho salmon, rainbow trout, and Channel catfish, respectively [59e61]. Similarly, in the case of SoHsp70, we found that its expression was enhanced by experimental challenges with the fish pathogens E. tarda, L. anguillarum, S. iniae, as well as the doublestranded RNA analogue poly(I:C). These results suggest a role for SoHsp70 in immune defense against bacterial and viral infections. The immune effects of heat shock proteins, particularly Hsp70s, have been reported by many research groups. It is known that, by binding to antigenic peptides, Hsp70s facilitate antigen presentation via the endogenous pathway, which leads to the activation of cytotoxic T cells. In addition, Hsp70s can also activate natural killer cells and elicit innate immune response by the secretion of immunostimulatory cytokines [62,63]. In our study, we found that SoHsp70 was activated at transcription level by vaccination and exhibited apparent adjuvant effect on a subunit vaccine. These results indicate that SoHsp70 participates in vaccine-induced immune response. In conclusion, the results of this study demonstrate that SoHsp70 is an inducible Hsp70 homologue whose expression was modulated by toxic metals, oxidant, bacterial infection, and vaccination. These observations support the idea that SoHsp70 may play a role in multi-aspects of protein homeostasis associated with stress conditions and immune reactions. Acknowledgements This work was supported by the National Basic Research Program of China grant 2006CB101807. Appendix. Supplementary material Supplementary data associated with this article can be found in the online version at doi:10.1016/j.fsi.2010.06.001. References [1] Morano KA. New tricks for an old dog: the evolving world of Hsp70. Ann N Y Acad Sci 2007;1113:1e14. [2] Tavaria M, Gabriele T, Kola I, Anderson RL. A hitchhiker’s guide to the human Hsp70 family. Cell Stress Chaperones 1996;1:23e8. [3] Flaherty KM, DeLuca-Flaherty C, McKay DB. Three-dimensional structure of the ATPase fragment of a 70 K heat-shock cognate protein. Nature 1990;346:623e8. [4] Mayer MP, Brehmer D, Gässler CS, Bukau B. Hsp70 chaperonee machines. Adv Protein Chem 2001;59:1e44. [5] Revington M, Zhang Y, Yip GN, Kurochkin AV, Zuiderweg ER. NMR investigations of allosteric processes in a two-domain Thermus thermophilus Hsp70 molecular chaperonee. J Mol Biol 2005;349:163e83. [6] Scheufler C, Brinker A, Bourenkov G, Pegoraro S, Moroder L, Bartunik H, et al. Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70eHsp90 multichaperonee machine. Cell 2000;101:199e210. [7] Zhu X, Zhao X, Burkholder WF, Gragerov A, Ogata CM, Gottesman ME, et al. Structural analysis of substrate binding by the molecular chaperonee DnaK. Science 1996;272:1606e14. [8] Swain JF, Dinler G, Sivendran R, Montgomery DL, Stotz M, Gierasch LM. Hsp70 chaperonee ligands control domain association via an allosteric mechanism mediated by the interdomain linker. Mol Cell 2007;26:27e39. [9] Vogel M, Bukau B, Mayer MP. Allosteric regulation of Hsp70 chaperonees by a proline switch. Mol Cell 2006;21:359e67. [10] Vogel M, Mayer MP, Bukau B. Allosteric regulation of Hsp70 chaperonees involves a conserved interdomain linker. J Biol Chem 2006;281:38705e11. [11] Han W, Christen P. Interdomain communication in the molecular chaperonee DnaK. Biochem J 2003;369:627e34. [12] Jiang J, Prasad K, Lafer EM, Sousa R. Structural basis of interdomain communication in the Hsc70 chaperonee. Mol Cell 2005;20:513e24. [13] Mayer MP, Bukau B. Hsp70 chaperonees: cellular functions and molecular mechanisms. Cell Mol Life Sci 2005;62:670e84. [14] Craig EA, Huang P, Aron R, Andrew A. The diverse roles of J-proteins, the obligate Hsp70 cochaperonee. Rev Physiol Biochem Pharmacol 2006;156:1e21. [15] Walsh P, Bursac D, Law YC, Cyr D, Lithgow T. The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep 2004;5:567e71. [16] Sharma D, Masison DC. Hsp70 structure, function, regulation and influence on yeast prions. Protein Pept Lett 2009;16:571e81.
[17] Tsan MF, Gao B. Heat shock proteins and immune system. J Leukoc Biol 2009; 85:905e10. [18] Gunther E, Walter L. Genetic aspects of the hsp70 multigene family in vertebrates. Experientia 1994;50:987e1001. [19] Yamashita M, Hirayoshi K, Nagata K. Characterization of multiple members of the HSP70 family in platyfish culture cells: molecular evolution of stress protein HSP70 in vertebrates. Gene 2004;336:207e18. [20] Morimoto RI, Sarge KD, Abravaya K. Transcriptional regulation of heat shock genes. J Biol Chem 1992;267:21987e90. [21] Arai A, Naruse K, Mitani H, Shima A. Cloning and characterization of cDNA for 70-kDa heat-shock protein (Hsp70) from two fish species of genus Oryzias. Jpn J Genet 1995;70:423e33. [22] Graser R, Malner-Dragojevic D, Vincek V. Cloning and characterization of a 70 kD heat shock protein cognate (hsc70) gene from the zebrafish (Danio rerio). Genetica 1996;98:273e6. [23] Park JH, Lee JJ, Yoon S, Lee J, Choe SY, Choe Y, et al. Genomic cloning of the Hsc71 gene in the hermaphroditic teleost Rivulus marmoratus and analysis of its expression in skeletal muscles: identification of a novel muscle-preferred regulatory element. Nucleic Acids Res 2001;29:3041e50. [24] Santacruz H, Vriz S, Angelier N. Molecular characterization of a heat shock cognate cDNA of zebraWsh, hsc70, and developmental expression of corresponding transcripts. Dev Genet 1997;21:223e33. [25] Zafarulla M, Wisnieski J, Shieman S, Shworak N, Misra S, Gedamu L. Molecular cloning and characterization of a constitutively expressed heat-shock-cognate hsc71 gene from rainbow trout. Eur J Biochem 1992;204:893e900. [26] Iwama GK, Vijayan MM, Forsyth RB, Ackerman PA. Heat shock proteins and physiological stress in fish. Am Zool 1999;39:901e9. [27] Iwama GK, Afonso LO, Todgham A, Ackerman P, Nakano K. Are hsps suitable for indicating stressed states in fish? J Exp Biol 2004;207:15e9. [28] Shen ZH, Qian D, Xu WJ, Gu JH, Shao JZ. Isolation, identification and pathogenicity of Streptococcus iniae isolated from red drum Sciaenops Ocellatus. Acta Hydrobiologica Sinica 2005;29:678e83. [29] Zhang WW, Sun L. Cloning, characterization, and molecular application of a beta-agarase gene from Vibrio sp. strain V134. Appl Environ Microbiol 2007; 73:2825e31. [30] Zhang M, Sun K, Sun L. Regulation of autoinducer 2 production and luxS expression in a pathogenic Edwardsiella tarda strain. Microbiology 2008;154: 2060e9. [31] Matambo TS, Odunuga OO, Boshoff A, Blatch GL. Over-production, purification and characterization of the Plasmodium falciparum heat shock protein 70. Protein Expr Purif 2004;33:214e22. [32] Zhang WW, Sun K, Cheng S, Sun L. Characterization of DegQVh, a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008;74:6254e62. [33] Schmid A, Kloas W, Reinecke M. Establishment of a primary liver cell culture from a teleost, Oreochromis mossambicus, the tilapia: a valid tool for physiological studies. In: Bernard A, et al., editors. Animal cell technology: products from cells. Cells as Products; 1999. p. 143e5. [34] Brinker A, Scheufler C, Von Der Mulbe F, Fleckenstein B, Herrmann C, Jung G, et al. Ligand discrimination by TPR domains. Relevance and selectivity of EEVD-recognition in Hsp70 Hop Hsp90 complexes. J Biol Chem 2002;277: 19265e75. [35] Lescure AM, Proudhon D, Pesey H, Ragland M, Theil EC, Briat JF. Ferritin gene transcription is regulated by iron in soybean cell cultures. Proc Natl Acad Sci U S A 1991;88:8222e6. [36] Gauley J, Heikkila JJ. Examination of the expression of the heat shock protein gene, hsp110, in Xenopus laevis cultured cells and embryos. Comp Biochem Physiol A Mol Integr Physiol 2006;145:225e34. [37] Feldlite M, Juanicó M, Karplus I, Milstein A. Towards a safe standard for heavy metals in reclaimed water used for fish aquaculture. Aquaculture 2008;284: 115e26. [38] Cheng S, Hu Y, Jiao X, Sun L. Identification and immunoprotective analysis of a Streptococcus iniae subunit vaccine candidate. Vaccine 2010;28:2636e41. [39] Amend D.F.. Potency testing of fish vaccines. In: International symposium on fish biologics: serodiagnostics and vaccines. Dev Biol Stand 1981;vols. 49: 447e454. [40] Fauconneau B, Petegnief V, Sanfeliu C, Piriou A, Planas AM. Induction of heat shock proteins (HSPs) by sodium arsenite in cultured astrocytes and reduction of hydrogen peroxide-induced cell death. J Neurochem 2002;83:1338e48. [41] Freeman BC, Myers MP, Schumacher R, Morimoto RI. Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J 1995;14:2281e92. [42] Basu N, Todgham AE, Ackerman PA, Bibeau MR, Nakano K, Schulte PM, et al. Heat shock protein genes and their functional significance in fish. Gene 2002;295:173e83. [43] Currie S, Moyes CD, Tufts BL. The effects of heat shock and acclimation temperature on hsp70 and hsp30 mRNA expression in rainbow trout: in vivo and in vitro comparisons. J Fish Biol 2000;56:398e408. [44] Lele Z, Engel S, Krone P. Hsp47 and hsp70 gene expression is differentially regulated in a stress- and tissue-specific manner in zebrafish embryos. Dev Genet 1997;21:123e33. [45] Modisakeng KW, Jiwaji M, Pesce ER, Robert J, Amemiya CT, Dorrington RA, et al. Isolation of a Latimeria menadoensis heat shock protein 70 (Lmhsp70) that has all the features of an inducible gene and encodes a functional molecular chaperonee. Mol Genet Genomics 2009;282:185e96.
W. Dang et al. / Fish & Shellfish Immunology 29 (2010) 600e607 [46] Molina A, Biemar F, Müller F, Iyengar A, Prunet P, Maclean N, et al. Cloning and expression analysis of an inducible HSP70 gene from tilapia Wsh. FEBS Lett 2000;474:5e10. [47] Gedamu L, Culham B, Heikkila JJ. Analysis of the temperature-dependent temporal pattern of heat-shock-protein synthesis in fish cells. Biosci Rep 1983;3:647e58. [48] Clark MS, Peck LS. Triggers of the HSP70 stress response: environmental responses and laboratory manipulation in an Antarctic marine invertebrate (Nacella concinna). Cell Stress Chaperones 2009;14:649e60. [49] Dietz TJ, Somero GN. Species- and tissue-specific synthesis patterns for heatshock proteins HSP70 and HSP90 in several marine teleost fishes. Physiol Zool 1993;66:863e80. [50] Dyer SD, Dickson KL, Zimmerman EG. Tissue-specific patterns of synthesis of heat-shock proteins and thermal tolerance of the fathead minnow (Pimephales promelas). Can J Zool 1991;69:2021e7. [51] Sanders BM, Nguyen J, Martin LS, Howe SR, Coventry S. Induction and subcellular localization of two major stress proteins in response to copper in the fathead minnow Pimephales promelas. Comp Biochem Physiol 1995;112:335e43. [52] Pierron F, Bourret V, St-Cyr J, Campbell PG, Bernatchez L, Couture P. Transcriptional responses to environmental metal exposure in wild yellow perch (Perca flavescens) collected in lakes with differing environmental metal concentrations (Cd, Cu, Ni). Ecotoxicology 2009;18:620e31. [53] Feng Q, Boone AN, Vijayan MM. Copper impact on heat shock protein 70 expression and apoptosis in rainbow trout hepatocytes. Comp Biochem Physiol C Toxicol Pharmacol 2003;135C:345e55. [54] Williams JH, Farag AM, Stansbury MA, Young PA, Bergman HL, Petersen NS. Accumulation of hsp70 in juvenile and adult rainbow trout gill exposed to metal-contaminated water and/or diet. Environ Toxicol Chem 1996;15:1324e8.
607
[55] Grosvik BE, Goksoyr A. Biomarker protein expression in primary cultures of salmon (Salmo salar L.) hepatocytes exposed to environmental pollutants. Biomarkers 1996;1:45e53. [56] Hassanein HMA, Banhawy MA, Soliman FM, Abdel-Rehim SA, Muller WEG, Schroder HC. Induction of hsp70 by the herbicide oxyfluoren (goal) in the Egyptian Nile fish, Oreochromis niloticus. Arch Environ Contam Toxicol 1999; 37:78e84. [57] Padmini E, Geetha BV. Modulation of ASK1 expression during overexpression of Trx and HSP70 in stressed fish liver mitochondria. Cell Stress Chaperones 2009;14:459e67. [58] Padmini E, Rani MU. Impact of seasonal variation on HSP70 expression quantitated in stressed fish hepatocytes. Comp Biochem Physiol B Biochem Mol Biol 2008;151:278e85. [59] Forsyth RB, Candido EPM, Babich SL, Iwama GK. Stress protein expression in coho salmon with bacterial kidney disease. J Aquat Anim Health 1997;9: 18e25. [60] Ackerman PA, Iwama GK. Physiological and cellular stress responses of juvenile rainbow trout to vibriosis. J Aquat Anim Health 2001;13:173e80. [61] Elibol-Flemming B, Waldbieser GC, Wolters WR, Boyle CR, Hanson LA. Expression analysis of selected immune-relevant genes in channel catfish during Edwardsiella ictaluri infection. J Aquat Anim Health 2009;21:23e35. [62] Gastpar R, Gross C, Rossbacher L, Ellwart J, Riegger J, Multhoff G. The cell surface-localized heat shock protein 70 epitope TKD induces migration and cytolytic activity selectively in human NK cells. J Immunol 2004;172:972e80. [63] Asea A, Kraeft S-K, Kurt-Jones EA, Stevenson MA, Chen LB, Finberg RW, et al. Hsp70 stimulates cytokine production through a CD14-dependent pathway, demonstrating its dual role as a chaperonee and cytokine. Nat Med 2000;6: 435e42.