- Email: [email protected]
Identification and molecular cloning Moplaa gene, a homologue of Homo sapiens PLAA, in Magnaporthe oryzae
Microbiological Research 167 (2011) 8–13
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.de/micres
Identification and molecular cloning Moplaa gene, a homologue of Homo sapiens PLAA, in Magnaporthe oryzae Xiao-Hong Liu a , Fei-Long Zhuang a , Jian-Ping Lu b , Fu-Cheng Lin a,∗ a b
State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, China College of Life Sciences, Zhejiang University, Hangzhou 310058, China
a r t i c l e
i n f o
Article history: Received 28 November 2010 Received in revised form 20 February 2011 Accepted 21 February 2011 Keywords: Magnaporthe oryzae Growth Appressorial turgor pressure Pathogenicity
a b s t r a c t Magnaporthe oryzae has been used as a model fungal pathogen to study the molecular basis of plant–fungus interactions due to its economic and genetic importance. In this study, we identified a novel gene, Moplaa, which is the homologue of Homo sapiens PLAA encoding a phospholipase A2 -activating protein. Moplaa is conserved in some eukaryotic organisms by multiple alignment analysis. The function of the Moplaa gene was studied using the gene target replacement method. The Moplaa deletion mutant exhibited retarded growth and conidial germination, reduced conidiation, appressorial turgor pressure and pathogenicity to rice CO-39. Reintroduction of the gene restored defects of the Moplaa deletion mutant. © 2011 Elsevier GmbH. All rights reserved.
Introduction Magnaporthe oryzae, the casual agent of rice blast disease, is one of the most destructive pathogens of cultivated rice worldwide (Howard and Valent 1996). Infection is triggered when a fungal conidium lands on and attaches to a suitable host leaf under appropriate conditions. Subsequently, a ripple reaction is initiated, which results in the germination of conidium, development of dome-shaped melanin-pigmented appressorium, penetration into the host tissue and invasive growth of the fungus. Due to its welldescribed infection process, the rice blast fungus is regarded as a good model organism for studying plant pathogenic filamentous fungi (Ebbole 2007; Talbot 2003). Phospholipase A2 (PLA2 ) catalytically hydrolyzes the ester bond at the sn-2 acyl position of phospholipid with releasing lysophospholipid and free fatty acid. In vivo, polyunsaturated fatty acids are frequently present at the sn-2 acyl position of phospholipids, and when released, these fatty acids can be metabolized to form various eicosanoids and related bioactive lipid mediators. The remaining lysophospholipids can also play important roles in biological processes (Dennis 1997; Six and Dennis 2000). Moreover, the phospholipase A2 -activating protein (PLAA) is regarded as a novel activator of phospholipases (Chopra et al. 1999; Koumanov et al. 2003). In mouse macrophages, an antisense PLAA
∗ Corresponding author at: State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, China. Tel.: +86 571 88982291; fax: +86 571 88982183. E-mail address: [email protected] (F.-C. Lin). 0944-5013/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2011.02.003
oligonucleotide blocked cholera toxin-induced arachidonic acid release, indicating a role for PLAA in the regulation of phospholipase A2 activation. Sequencing of fungal genomes has revealed a wide range of genes that encode PLA2 activities in fungi. Some phospholipase A2 s play a role in pathogenesis and virulence (Kohler et al. 2006). However, there is no mechanistic data on PLAA function in filamentous fungi. Therefore, understanding the functions of PLAA in M. oryzae may lead to a better understanding of phospholipase A2 functions in this organism. Here, we present the report on the cloning and initial characterization of a putative gene encoding the phospholipase A2 -activating protein homolog from M. oryzae. Materials and methods Fungal strains and culture conditions M. oryzae strain Guy11 was used as the wild-type strain throughout this study. This strain and its mutants (transformants and Moplaa-knockout mutants generated from Guy11) were cultured on complete medium (CM) (Talbot et al. 1993) plates at 25 ◦ C with a 14 h light and 10 h dark cycle using fluorescent lights. Studies that involved crossing with strain 2539 were conducted on oatmeal agar (OMA) medium (30 g oatmeal in 1 L distilled water) (Liu et al. 2007). DNA/RNA isolation and manipulation For DNA/RNA extraction, conidial suspensions of individual strains were cultured in liquid CM. Genomic DNA and total RNA
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13 Table 1 Primers were used in this study. Name
Sequence (5 –3 )
s66upp1 s66upp2 s66lowp1 s66lowp2 s66checkp1 s66checkp2 s66CDSp1 s66CDSp2 s66hbp1 s66hbp2
TTGGGCCCCAGGGGTTGCTTATGTCGGTTCGTT TTGTCGACGCGGGTTGCGGAGCGGTCAG CCGGATCCTCAGCCGCCCAGAGGAGCCAGGAC CCTCTAGACCGCAGGACGAGGGACACTTTACC TCATCCCGCCTTCAACCAACCATC CATCGCTAGCGCCCGTGACAATA CCGGATCCATGTCAATTTTCAAGCTTTCCG AAGGATCCTCACCCCAGCGCCTGCTCTACC AACCCGGGTTCGCCGGTGTGAGAGTTCCAGAT AACCCGGGGGCCGGCGACTTTGTCGTCGGCAG
9
was determined using the incipient cytorrhysis assay, as reported previously (Howard et al. 1991). Each assay was completely independent and replicated at least three times. Plant infection assays Pathogenicity assays were performed as described previously (Liu et al. 2007). 105 conidia/ml were sprayed evenly onto twoweek-old rice plants (CO-39) using an artist’s airbrush (Badger Co., Illinois). The inoculated plants were placed in a dew chamber at 25 ◦ C for 48 h in the dark and then transferred and raised in a growth chamber under a photoperiod of 12 h, which was achieved using fluorescent lights. Lesion formation was examined 7 days after inoculation. The disease severity in rice was rated on the scale developed by Bonman et al. (1986). Each assay was completely independent and replicated at least three times.
were extracted as described by Liu et al. (2007). Molecular biology techniques including plasmid DNA preparation, restriction enzyme digestion, polymerase chain reaction (PCR), cloning, ligation reactions and gel electrophoresis were performed according to standard procedures.
Results
Isolation and sequence analysis of Moplaa
Isolation of Moplaa
BLAST searches of the M. oryzae genome database with EST (GenBank accn. no.: CK828281.1, named s66), which was identified from the ESTs of a suppression subtractive hybridization cDNA library of M. oryzae strain Guy11 (Lu et al. 2005a,b), led to the identification of a single gene MGG 14014.6, which was designated as Moplaa. The fragment containing the coding sequence of Moplaa was amplified and cloned. We then constructed the Moplaa null mutant by targeted gene replacement. The cDNA fragment containing the complete coding sequence of the Moplaa gene was cloned from the cDNA library (Lu et al. 2005a,b) by PCR using primers s66CDSp1 and s66CDSp2. It was then cloned into the T-vector pUCm-T (Sangon, Shanghai, China) and sequenced on an ABI377 DNA sequencer (Invitrogen, USA). The putative protein Moplaa was assessed for homology using BLASTP (Altschul et al. 1997).
An expressed sequence tag (EST, GenBank accn. no.: CK828281.1) was identified from the ESTs of a suppression subtractive hybridization cDNA library of M. oryzae strain Guy11. This EST is expressed in hyphae, conidia and appressoria (Lu et al. 2005a,b). After searching the M. oryzae database (http://www.broad.mit.edu/), this EST was found to correspond to the hypothetical protein MGG 14014.6 in strain 70-15. The full coding sequence (CDS) fragment was then cloned from the 24 h-appressorium cDNA library of Guy11 using high-fidelity PCR and subsequently sequenced (GenBank accn. no.: HQ650870). The CDS obtained was 2394 bp long and predicted to encode the predicted mature polypeptide of 797 amino acids (molecular mass 85.54 kDa) containing the WD40, PFU (PLAA family ubiquitin binding) and PUL domains. Multiple alignment analysis showed that the PLAA protein is conserved in several other eukaryotic organisms as shown in Fig. 1. The Moplaa protein sequence showed 33% sequence identity to the DOA1 protein of Saccharomyces cerevisiae (Lis and Romesberg, 2006), 32% identity to the sequence of the Lub1 protein of Schizosaccharomyces pombe (Ogiso et al., 2004) and 35% identity to the phospholipase A2 -activating protein (PLAA) of Homo sapiens (Clark et al., 1991).
Construction of disruption and complementation vectors We amplified two flanking sequences of Moplaa from the Guy11 genomic DNA and inserted into the pBS-HPH1 vector (Liu et al. 2007). First, 1.0 kb flanking fragment of Moplaa was amplified with s66-up-p1 and s66-up-p2 and cloned between the ApaI and SalI sites on pBS-HPH1 to generate pBS-s66up. Then, 1.2 kb sequence of Moplaa was amplified with s66-low-p1 and s66-low-p2 and inserted between the BamHI and XbaI sites of pBS-s66up to generate the final Moplaa replacement vector pBS-Moplaa (Fig. 2A). The 5.8 kb PCR products containing 1.7 kb upstream sequence, full-length Moplaa gene, and 1.5 kb downstream sequence were amplified from Guy11 genomic DNA by using primers s66hbp1 and s66hup2 and inserted into the SmaI site of pBarKS1 (Pall and Brunelli 1993) to generate complementation vector pBarPlaa. All the primers used in this study are listed in Table 1. The fungal protoplasts were produced and transformed with DNA as previously described (Liu et al. 2007). Phenotypic analysis For the conidiation analysis, conidia taken from three mycelial discs (diameter 1 cm each) were suspended in 1 ml sterile water and counted with a hemocytometer under a microscope. 40 l of 105 conidia/ml conidia suspension of each strain were inoculated on plastic cover slips and incubated at 25 ◦ C for 2–48 h. Conidia germination and appressoria formation were observed and counted under the microscope. The appressorial turgor pressure
Disruption of Moplaa and complementation To better understand the physiological function of Moplaa in M. oryzae, the target gene replacement method was used in this study. The 6.7 kb XbaI-linearized fragment of pBS-Moplaa (Fig. 2A) was transformed into the protoplasts of Guy11 as described previously (Liu et al. 2007). Initially, hygromycin-resistant transformants were identified by PCR with s66checkp1 and s66checkp2. Three candidate mutants, i.e., s33, s40 and s42, were purified by single conidia isolation. DNA gel blot hybridization analysis was used to confirm the single integration event of the three mutants (Fig. 2B). Because all three mutants were identical in terms of growth rate, conidiation, and pathogenicity, one mutant, i.e., s40 (referred to hereafter as Moplaa), was used in subsequent experiments. To confirm that the phenotype exhibited by the null mutant was due to the deletion of Moplaa, complementation assays were carried out. The s40 mutant was complemented by introducing the 10.3 kb NotI fragment (linearized pBarPlaa) carrying full-length Moplaa via protoplast-mediated transformation. And NotI-lineared pBarKS1 was transformed to the s40 mutant as control. One complemented transformant, 40hb-5, which contained a single copy of Moplaa (data no shown), was selected for further studies.
10
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
Fig. 1. Moplaa protein shares sequence homology with PLAA proteins of several other eukaryotic organisms. A A phylogenetic tree of PLAA protein was generated based on alignment of entire protein sequences using MEGA 4.0.2 program (Tamura et al. 2007). B Sequences were aligned using ClustalW (http://align.genome.jp/) and viewed by GeneDoc program. Identical amino acids are highlighted in black, conserved residues are displayed in grey. The compared sequences were from Homo sapiens (no. NP 001026859.1), Drosophila melanogaster (no. NP 524666.2), Schizosaccharomyces pombe (no. NP 596478.1), Saccharomyces cerevisiae (no. NP 012709.1), Magnaporthe oryzae (no. HQ650870), Neurospora crassa (no. XP 325060.1), Arabidopsis thaliana (no. NP 566620.1).
Moplaa affects the vegetative development of the colony
The Moplaa deletion mutant showed reduced conidiation
The Moplaa mutant cultured on CM plates showed white and sparse aerial mycelium, while the wild-type strain had dark and dense hyphae (Fig. 3). Under the same culture conditions, the Moplaa mutant showed a retarded growth rate on CM in comparison with that of the wild-type (Table 2). In other words, the colony of the Moplaa mutant spread more slowly than that of the wild type. These data indicated that the Moplaa gene is involved in maintaining the morphology and growth of the colony.
The Moplaa deletion mutant produced a dramatically reduced number of conidia. The Moplaa mutant produced 1.91 ± 0.41 × 103 conidia/mm2 on plates of CM in contrast with 5.82 ± 1.48 × 103 conidia/mm2 produced by wild-type Guy11. When the Moplaa gene was reintroduced into the Moplaa mutant, conidiogenesis was rescued to 6.21 ± 1.64 × 103 conidia/mm2 . These results suggested that the Moplaa gene affects conidiation.
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
11
Table 2 Comparison of growth rate, conidiation, germination and appressorium formation among strains. Strains
Growth (cm)1
Conidiation (×103 conidia/ml)2
Guy11 Moplaa 40hb-5
3.19 ± 0.09a 2.91 ± 0.22b 3.24 ± 0.07a
5.82 ± 1.48a 1.91 ± 0.41b 6.21 ± 1.64a
Conidial germination (%)3
2h
4h
95.51 ± 3.47a 84.90 ± 2.30b 92.02 ± 2.49a
99.40 ± 0.54a 98.87 ± 0.45a 99.36 ± 0.60a
Appressorium formation 6 h (%)4
97.95 ± 2.08a 97.44 ± 2.45a 97.99 ± 1.26a
Collapsed Appressoria (%)5
2 M glycerol
3 M glycerol
10.13 ± 1.58b 38.57 ± 8.50a 16.46 ± 3.71b
29.37 ± 6.32b 61.69 ± 3.70a 27.92 ± 10.00b
Growth was measured as the diameter of fungal mycelia grown on complete medium for 7 days. Conidiation was measured as the number of conidia on a 1cm-dimeter disc in 1 mL of water. Conidial suspension was counted by using a haemocytometer under a microscope. Conidial germination was measured as the percentage of germinated conidia on plastic cover slips after 2 or 4 h incubation. Appressorium formation was measured as the percentage of appressorium formation among germinated conidia on plastic cover slips after 6 h incubation. Appressoria were allowed to form on plastic cover slips for 24 h. The percentage of appressoria that had collapsed after 10 min in glycerol solution was recorded. The difference estimated by Duncan’s test (SSR) (P ≤ 0.05).
that the Moplaa gene influences the early germination of the rice blast fungus. The appressorial turgor pressure was reduced in the Moplaa deletion mutant The turgor pressure exerted by a mature appressorium was measured using an incipient cytorrhysis test reported earlier (Howard et al. 1991). The rate of appressoria formation on a hydrophobic surface was similar in both the wild-type strain Guy11 and the Moplaa deletion mutant, as shown in Table 2. Nevertheless, the appressorial turgor pressure was significantly lower in the Moplaa mutant but was restored in the rescued mutant 40hb-5 (Table 2). In 2 M glycerol, 10.13 ± 1.58% of the 24 h old appressoria of the wild-type and 16.46 ± 3.71% of those of the rescued strain collapsed, which was in contrast to 38.57 ± 8.50% of those of the null mutant. In 3 M glycerol, 61.69 ± 3.70% of the appressoria of the mutant collapsed in contrast to about 30% of those of Guy11 or the rescued stain 40hb-5. These results demonstrated that the appressorial turgor pressure in the Moplaa mutant was dramatically lower than that in Guy11. Fig. 2. Deletion of the Moplaa target gene. A, Construction of the Moplaa gene replacement vector. pBS-Moplaa was linearized and transformed into the M. oryzae protoplast. A = ApaI, S = SalI, Sm = SmaI, B = BamHI, X = XbaI. B, Genomic DNAs of wildtype Guy11 and three mutants (s33, s40, and s42) were digested with SmaI and probed with a 1 kb fragment amplified with primers s66-up-p1 and s66-up-p2.
The Moplaa deletion mutant showed delayed conidial germination In the conidal germination assay, it was observed that the Moplaa deletion mutant took longer to germinate than the wildtype strain Guy11 (Table 2). After 2 h post inoculation (hpi), 84.90 ± 2.30% of the conidia in the Moplaa deletion mutant germinated in comparison to 95.51 ± 3.47% in the wild-type strain Guy11. However, the conidial germination of the Moplaa mutant was similar to that of the wild-type strain after 4 hpi. We concluded
Moplaa affects the pathogenicity To investigate the role of Moplaa gene in pathogenicity, infection assays were performed in a susceptible rice cultivar CO-39. We found that a significant reduction in pathogenicity was observed in the Moplaa mutant in comparison with Guy11 (Fig. 4). Plants were sprayed with the conidia of Guy11, Moplaa or 40hb-5 respectively. Moplaa only caused small and separated lesions on the rice leaves while Guy11 or rescued strain 40hb-5 caused typical diamond-shaped, gray-centered and proliferating lesions on leaves. Rated on the scale developed by Bonman et al. (1986), about 85% plants inoculated with Moplaa mutants were graded as 2–3, while 92% those inoculated with the wild-type Guy11 or rescued
Fig. 3. Growth of Guy11 and Moplaa on CM. Photos were taken 7 days after inoculation.
12
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
in the regulation of specific inflammatory disease processes (Clark et al. 1991). Human PLAA is potentially important in regulating the inflammatory response through its activation of phospholipase A2 , which catalyzes the release of arachidonic acid. How the Moplaa have effect on regulation of phospholipase A2 is further to study. Targeted deletion of Moplaa in M. oryzae showed slow hyphal growth and reduced conidiation. However, the mutants were not sensitive to stress conditions such as nutrient starvation, temperature exchange and high Ca2+ concentration (data not shown). When the Moplaa gene is deleted, regulatory networks might be induced to repair the defects in response to the stress conditions in M. oryzae. In summary, Moplaa, a homologue of Human PLAA was studied in M. oryzae. Moplaa had effect on the fungal growth, production of conidiation, appressorial turgor pressure and pathogenicity to rice. Acknowledgments
Fig. 4. Pathogenicity test. Conidial suspensions were sprayed onto 3-week-old rice leaves. Infectious growth was observed 7 days after inoculation.
strain were graded as 4–5. Severity of disease caused by Moplaa mutant was reduced. Simultaneity, plants sprayed with the conidia of Moplaa showed less intense disease lesions in the susceptible rice CO-39. In 5 cm of rice leaf, the mean disease density was 63.69 ± 12.22 lesions for the Moplaa mutant in comparison with 151.07 ± 12.5 for Guy11. The severity of disease and mean disease density recovered to the similar with the wild type Guy11 when we reintroduced the Moplaa gene to the Moplaa mutant. These suggest that the Moplaa null mutant has reduced pathogenicity and that Moplaa is a crucial virulence determinant in M. oryzae. Discussion Conidia and appressoria, which play crucial roles in the rice blast disease cycle, are important development stages in M. oryzae (Talbot, 2003). It is necessary to accumulate glycerol to generate adequate turgor pressure in the appressoria in order to rupture the cuticle of the host. It has been reported that the appressorial turgor pressure is related to the pathogenicity of M. oryzae (Balhadere and Talbot, 2001; Howard et al., 1991; Nishimura et al., 2009; Park et al., 2004; Wang et al., 2007). In our study, we demonstrated that the targeted deletion of Moplaa resulted in reduced pathogenicity in rice. The number of conidia produced by the Moplaa mutant was 1/3 of that produced by wild-type Guy11. In the turgor pressure assay, approximately 60% of the appressoria had collapsed in contrast with less than 20% that had collapsed in Guy11 in 3 M glycerol. In our earlier studies, the deletion of MoFLP1 (Liu et al., 2009) or Mocmk1 (Liu et al., 2010) resulted in reduced conidia formation and turgor pressure, and the pathogenicity of the organism was significantly lower. Disruption of the MgATG1 gene to create the null mutant led to the formation of disabled appressoria, and the organism lost its ability to infect the rice leaf (Liu et al. 2007). The reduced pathogenicity of the Moplaa mutant may be attributed to reduced conidiation and turgor pressure. In S. cerevisia, the loss of Doa1 resulted in a wide range of defects such as growth defects, decreased sporulation and increased sensitivity to stress conditions (Lis and Romesberg, 2006). Lub1 of S. pombe is responsible for the maintenance of cellular ubiquitin, presumably by negative regulation of vacuole-dependent ubiquitin degradation. Lub1-deleted mutants showed very high sensitivity to UV irradiation and high temperature as well as to several stressinducing agents such as Ca2+ , methyl methanesulfonate and sodium arsenite (Ogiso et al. 2004). Human PLAA plays an important role
This work was supported by grants (no. 30925025, 30870101 and 31000077) funded by the National Natural Science Foundation of China, and our staff and graduate students at the Fungal Laboratory, Biotechnology Institute, Zhejiang University. This work was supported by the Fundamental Research Funds for the Central Universities. References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389–402. Balhadere PV, Talbot NJ. PDE1 encodes a P-type ATPase involved in appressoriummediated plant infection by the rice blast fungus Magnaporthe grisea. Plant Cell 2001;13:1987–2004. Bonman JM, Vergel De Dios TI, Khin MM. Physiologic specialization of Pyricularia oryzae in the Philippines. Plant Dis 1986;70:767–9. Chopra AK, Ribardo DA, Wood TG, Prusak DJ, Xu XJ, Peterson JW. Molecular characterization of cDNA for phospholipase A2 -activating protein. Biochim Biophys Acta 1999;1444:125–30. Clark MA, Ozgur LE, Conway TM, Dispoto J, Crooke ST, Bomalaski JS. Cloning of a phospholipase A2 -activating protein. Proc Natl Acad Sci USA 1991;88:5418–22. Dennis EA. The growing phospholipase A2 superfamily of signal transduction enzymes. Trends Biochem Sci 1997;22:1–2. Ebbole DJ. Magnaporthe as a model for understanding host-pathogen interactions. Annu Rev Phytopathol 2007;45:437–56. Howard RJ, Valent B. Breaking and entering: host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu Rev Microbiol 1996;50:491–512. Howard RJ, Ferrari MA, Roach DH, Money NP. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proc Natl Acad Sci USA 1991;88:11281–4. Kohler GA, Brenot A, Haas-Stapleton E, Agabian N, Deva R, Nigam S. Phospholipase A2 and phospholipase B activities in fungi. Biochim Biophys Acta 2006;1761:1391–9. Koumanov K, Momchilova A, Wolf C. Bimodal regulatory effect of melittin and phospholipase A2 -activating protein on human type II secretory phospholipase A2 . Cell Biol Int 2003;27:871–7. Lis ET, Romesberg FE. Role of Doa1 in the Saccharomyces cerevisiae DNA damage response. Mol Cell Biol 2006;26:4122–33. Liu TB, Chen GQ, Min H, Lin FC. MoFLP1, encoding a novel fungal fasciclin-like protein, is involved in conidiation and pathogenicity in Magnaporthe oryzae. J Zhejiang Univ Sci B 2009;10:434–44. Liu XH, Lu JP, Dong B, Gu Y, Lin FC. Disruption of MoCMK1, encoding a putative calcium/calmodulin-dependent kinase, in Magnaporthe oryzae. Microbiol Res 2010;165:402–10. Liu XH, Lu JP, Zhang L, Dong B, Min H, Lin FC. Involvement of a Magnaporthe grisea serine/threonine kinase gene, MgATG1, in appressorium turgor and pathogenesis. Eukaryot Cell 2007;6:997–1005. Lu JP, Liu TB, Lin FC. Identification of mature appressorium-enriched transcripts in Magnaporthe grisea, the rice blast fungus, using suppression subtractive hybridization. FEMS Microbiol Lett 2005a;245:131–7. Lu JP, Liu TB, Yu XY, Lin FC. Representative appressorium stage cDNA library of Magnaporthe grisea. J Zhejiang Univ Sci B 2005b;6:132–6. Nishimura M, Fukada J, Moriwaki A, Fujikawa T, Ohashi M, Hibi T. Mstu1, an APSES transcription factor, is required for appressorium-mediated infection in Magnaporthe grisea. Biosci Biotechnol Biochem 2009;73:1779–86. Ogiso Y, Sugiura R, Kamo T, Yanagiya S, Lu Y, Okazaki K. Lub1 participates in ubiquitin homeostasis and stress response via maintenance of cellular ubiquitin contents in fission yeast. Mol Cell Biol 2004;24:2324–31.
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13 Pall ML, Brunelli JP. A series of six compact fungal transformation vectors containing polylinkers with multiple unique restriction sites. Fungal Genet Newsl 1993;40:59–62. Park G, Bruno KS, Staiger CJ, Talbot NJ, Xu JR. Independent genetic mechanisms mediate turgor generation and penetration peg formation during plant infection in the rice blast fungus. Mol Microbiol 2004;53:1695–707. Six DA, Dennis EA. The expanding superfamily of phospholipase A(2) enzymes: classification and characterization. Biochim Biophys Acta 2000;1488:1–19. Talbot NJ. On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Annu Rev Microbiol 2003;57:177–202.
13
Talbot NJ, Ebbole DJ, Hamer JE. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell 1993;5:1575–90. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24: 1596–9. Wang ZY, Soanes DM, KershawMJ, Talbot NJ. Functional analysis of lipid metabolism in Magnaporthe grisea reveals a requirement for peroxisomal fatty acid betaoxidation during appressorium-mediated plant infection. Mol Plant Microbe Interact 2007;20:475–91.
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.de/micres
Identification and molecular cloning Moplaa gene, a homologue of Homo sapiens PLAA, in Magnaporthe oryzae Xiao-Hong Liu a , Fei-Long Zhuang a , Jian-Ping Lu b , Fu-Cheng Lin a,∗ a b
State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, China College of Life Sciences, Zhejiang University, Hangzhou 310058, China
a r t i c l e
i n f o
Article history: Received 28 November 2010 Received in revised form 20 February 2011 Accepted 21 February 2011 Keywords: Magnaporthe oryzae Growth Appressorial turgor pressure Pathogenicity
a b s t r a c t Magnaporthe oryzae has been used as a model fungal pathogen to study the molecular basis of plant–fungus interactions due to its economic and genetic importance. In this study, we identified a novel gene, Moplaa, which is the homologue of Homo sapiens PLAA encoding a phospholipase A2 -activating protein. Moplaa is conserved in some eukaryotic organisms by multiple alignment analysis. The function of the Moplaa gene was studied using the gene target replacement method. The Moplaa deletion mutant exhibited retarded growth and conidial germination, reduced conidiation, appressorial turgor pressure and pathogenicity to rice CO-39. Reintroduction of the gene restored defects of the Moplaa deletion mutant. © 2011 Elsevier GmbH. All rights reserved.
Introduction Magnaporthe oryzae, the casual agent of rice blast disease, is one of the most destructive pathogens of cultivated rice worldwide (Howard and Valent 1996). Infection is triggered when a fungal conidium lands on and attaches to a suitable host leaf under appropriate conditions. Subsequently, a ripple reaction is initiated, which results in the germination of conidium, development of dome-shaped melanin-pigmented appressorium, penetration into the host tissue and invasive growth of the fungus. Due to its welldescribed infection process, the rice blast fungus is regarded as a good model organism for studying plant pathogenic filamentous fungi (Ebbole 2007; Talbot 2003). Phospholipase A2 (PLA2 ) catalytically hydrolyzes the ester bond at the sn-2 acyl position of phospholipid with releasing lysophospholipid and free fatty acid. In vivo, polyunsaturated fatty acids are frequently present at the sn-2 acyl position of phospholipids, and when released, these fatty acids can be metabolized to form various eicosanoids and related bioactive lipid mediators. The remaining lysophospholipids can also play important roles in biological processes (Dennis 1997; Six and Dennis 2000). Moreover, the phospholipase A2 -activating protein (PLAA) is regarded as a novel activator of phospholipases (Chopra et al. 1999; Koumanov et al. 2003). In mouse macrophages, an antisense PLAA
∗ Corresponding author at: State Key Laboratory for Rice Biology, Biotechnology Institute, Zhejiang University, Hangzhou 310058, China. Tel.: +86 571 88982291; fax: +86 571 88982183. E-mail address: [email protected] (F.-C. Lin). 0944-5013/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2011.02.003
oligonucleotide blocked cholera toxin-induced arachidonic acid release, indicating a role for PLAA in the regulation of phospholipase A2 activation. Sequencing of fungal genomes has revealed a wide range of genes that encode PLA2 activities in fungi. Some phospholipase A2 s play a role in pathogenesis and virulence (Kohler et al. 2006). However, there is no mechanistic data on PLAA function in filamentous fungi. Therefore, understanding the functions of PLAA in M. oryzae may lead to a better understanding of phospholipase A2 functions in this organism. Here, we present the report on the cloning and initial characterization of a putative gene encoding the phospholipase A2 -activating protein homolog from M. oryzae. Materials and methods Fungal strains and culture conditions M. oryzae strain Guy11 was used as the wild-type strain throughout this study. This strain and its mutants (transformants and Moplaa-knockout mutants generated from Guy11) were cultured on complete medium (CM) (Talbot et al. 1993) plates at 25 ◦ C with a 14 h light and 10 h dark cycle using fluorescent lights. Studies that involved crossing with strain 2539 were conducted on oatmeal agar (OMA) medium (30 g oatmeal in 1 L distilled water) (Liu et al. 2007). DNA/RNA isolation and manipulation For DNA/RNA extraction, conidial suspensions of individual strains were cultured in liquid CM. Genomic DNA and total RNA
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13 Table 1 Primers were used in this study. Name
Sequence (5 –3 )
s66upp1 s66upp2 s66lowp1 s66lowp2 s66checkp1 s66checkp2 s66CDSp1 s66CDSp2 s66hbp1 s66hbp2
TTGGGCCCCAGGGGTTGCTTATGTCGGTTCGTT TTGTCGACGCGGGTTGCGGAGCGGTCAG CCGGATCCTCAGCCGCCCAGAGGAGCCAGGAC CCTCTAGACCGCAGGACGAGGGACACTTTACC TCATCCCGCCTTCAACCAACCATC CATCGCTAGCGCCCGTGACAATA CCGGATCCATGTCAATTTTCAAGCTTTCCG AAGGATCCTCACCCCAGCGCCTGCTCTACC AACCCGGGTTCGCCGGTGTGAGAGTTCCAGAT AACCCGGGGGCCGGCGACTTTGTCGTCGGCAG
9
was determined using the incipient cytorrhysis assay, as reported previously (Howard et al. 1991). Each assay was completely independent and replicated at least three times. Plant infection assays Pathogenicity assays were performed as described previously (Liu et al. 2007). 105 conidia/ml were sprayed evenly onto twoweek-old rice plants (CO-39) using an artist’s airbrush (Badger Co., Illinois). The inoculated plants were placed in a dew chamber at 25 ◦ C for 48 h in the dark and then transferred and raised in a growth chamber under a photoperiod of 12 h, which was achieved using fluorescent lights. Lesion formation was examined 7 days after inoculation. The disease severity in rice was rated on the scale developed by Bonman et al. (1986). Each assay was completely independent and replicated at least three times.
were extracted as described by Liu et al. (2007). Molecular biology techniques including plasmid DNA preparation, restriction enzyme digestion, polymerase chain reaction (PCR), cloning, ligation reactions and gel electrophoresis were performed according to standard procedures.
Results
Isolation and sequence analysis of Moplaa
Isolation of Moplaa
BLAST searches of the M. oryzae genome database with EST (GenBank accn. no.: CK828281.1, named s66), which was identified from the ESTs of a suppression subtractive hybridization cDNA library of M. oryzae strain Guy11 (Lu et al. 2005a,b), led to the identification of a single gene MGG 14014.6, which was designated as Moplaa. The fragment containing the coding sequence of Moplaa was amplified and cloned. We then constructed the Moplaa null mutant by targeted gene replacement. The cDNA fragment containing the complete coding sequence of the Moplaa gene was cloned from the cDNA library (Lu et al. 2005a,b) by PCR using primers s66CDSp1 and s66CDSp2. It was then cloned into the T-vector pUCm-T (Sangon, Shanghai, China) and sequenced on an ABI377 DNA sequencer (Invitrogen, USA). The putative protein Moplaa was assessed for homology using BLASTP (Altschul et al. 1997).
An expressed sequence tag (EST, GenBank accn. no.: CK828281.1) was identified from the ESTs of a suppression subtractive hybridization cDNA library of M. oryzae strain Guy11. This EST is expressed in hyphae, conidia and appressoria (Lu et al. 2005a,b). After searching the M. oryzae database (http://www.broad.mit.edu/), this EST was found to correspond to the hypothetical protein MGG 14014.6 in strain 70-15. The full coding sequence (CDS) fragment was then cloned from the 24 h-appressorium cDNA library of Guy11 using high-fidelity PCR and subsequently sequenced (GenBank accn. no.: HQ650870). The CDS obtained was 2394 bp long and predicted to encode the predicted mature polypeptide of 797 amino acids (molecular mass 85.54 kDa) containing the WD40, PFU (PLAA family ubiquitin binding) and PUL domains. Multiple alignment analysis showed that the PLAA protein is conserved in several other eukaryotic organisms as shown in Fig. 1. The Moplaa protein sequence showed 33% sequence identity to the DOA1 protein of Saccharomyces cerevisiae (Lis and Romesberg, 2006), 32% identity to the sequence of the Lub1 protein of Schizosaccharomyces pombe (Ogiso et al., 2004) and 35% identity to the phospholipase A2 -activating protein (PLAA) of Homo sapiens (Clark et al., 1991).
Construction of disruption and complementation vectors We amplified two flanking sequences of Moplaa from the Guy11 genomic DNA and inserted into the pBS-HPH1 vector (Liu et al. 2007). First, 1.0 kb flanking fragment of Moplaa was amplified with s66-up-p1 and s66-up-p2 and cloned between the ApaI and SalI sites on pBS-HPH1 to generate pBS-s66up. Then, 1.2 kb sequence of Moplaa was amplified with s66-low-p1 and s66-low-p2 and inserted between the BamHI and XbaI sites of pBS-s66up to generate the final Moplaa replacement vector pBS-Moplaa (Fig. 2A). The 5.8 kb PCR products containing 1.7 kb upstream sequence, full-length Moplaa gene, and 1.5 kb downstream sequence were amplified from Guy11 genomic DNA by using primers s66hbp1 and s66hup2 and inserted into the SmaI site of pBarKS1 (Pall and Brunelli 1993) to generate complementation vector pBarPlaa. All the primers used in this study are listed in Table 1. The fungal protoplasts were produced and transformed with DNA as previously described (Liu et al. 2007). Phenotypic analysis For the conidiation analysis, conidia taken from three mycelial discs (diameter 1 cm each) were suspended in 1 ml sterile water and counted with a hemocytometer under a microscope. 40 l of 105 conidia/ml conidia suspension of each strain were inoculated on plastic cover slips and incubated at 25 ◦ C for 2–48 h. Conidia germination and appressoria formation were observed and counted under the microscope. The appressorial turgor pressure
Disruption of Moplaa and complementation To better understand the physiological function of Moplaa in M. oryzae, the target gene replacement method was used in this study. The 6.7 kb XbaI-linearized fragment of pBS-Moplaa (Fig. 2A) was transformed into the protoplasts of Guy11 as described previously (Liu et al. 2007). Initially, hygromycin-resistant transformants were identified by PCR with s66checkp1 and s66checkp2. Three candidate mutants, i.e., s33, s40 and s42, were purified by single conidia isolation. DNA gel blot hybridization analysis was used to confirm the single integration event of the three mutants (Fig. 2B). Because all three mutants were identical in terms of growth rate, conidiation, and pathogenicity, one mutant, i.e., s40 (referred to hereafter as Moplaa), was used in subsequent experiments. To confirm that the phenotype exhibited by the null mutant was due to the deletion of Moplaa, complementation assays were carried out. The s40 mutant was complemented by introducing the 10.3 kb NotI fragment (linearized pBarPlaa) carrying full-length Moplaa via protoplast-mediated transformation. And NotI-lineared pBarKS1 was transformed to the s40 mutant as control. One complemented transformant, 40hb-5, which contained a single copy of Moplaa (data no shown), was selected for further studies.
10
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
Fig. 1. Moplaa protein shares sequence homology with PLAA proteins of several other eukaryotic organisms. A A phylogenetic tree of PLAA protein was generated based on alignment of entire protein sequences using MEGA 4.0.2 program (Tamura et al. 2007). B Sequences were aligned using ClustalW (http://align.genome.jp/) and viewed by GeneDoc program. Identical amino acids are highlighted in black, conserved residues are displayed in grey. The compared sequences were from Homo sapiens (no. NP 001026859.1), Drosophila melanogaster (no. NP 524666.2), Schizosaccharomyces pombe (no. NP 596478.1), Saccharomyces cerevisiae (no. NP 012709.1), Magnaporthe oryzae (no. HQ650870), Neurospora crassa (no. XP 325060.1), Arabidopsis thaliana (no. NP 566620.1).
Moplaa affects the vegetative development of the colony
The Moplaa deletion mutant showed reduced conidiation
The Moplaa mutant cultured on CM plates showed white and sparse aerial mycelium, while the wild-type strain had dark and dense hyphae (Fig. 3). Under the same culture conditions, the Moplaa mutant showed a retarded growth rate on CM in comparison with that of the wild-type (Table 2). In other words, the colony of the Moplaa mutant spread more slowly than that of the wild type. These data indicated that the Moplaa gene is involved in maintaining the morphology and growth of the colony.
The Moplaa deletion mutant produced a dramatically reduced number of conidia. The Moplaa mutant produced 1.91 ± 0.41 × 103 conidia/mm2 on plates of CM in contrast with 5.82 ± 1.48 × 103 conidia/mm2 produced by wild-type Guy11. When the Moplaa gene was reintroduced into the Moplaa mutant, conidiogenesis was rescued to 6.21 ± 1.64 × 103 conidia/mm2 . These results suggested that the Moplaa gene affects conidiation.
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
11
Table 2 Comparison of growth rate, conidiation, germination and appressorium formation among strains. Strains
Growth (cm)1
Conidiation (×103 conidia/ml)2
Guy11 Moplaa 40hb-5
3.19 ± 0.09a 2.91 ± 0.22b 3.24 ± 0.07a
5.82 ± 1.48a 1.91 ± 0.41b 6.21 ± 1.64a
Conidial germination (%)3
2h
4h
95.51 ± 3.47a 84.90 ± 2.30b 92.02 ± 2.49a
99.40 ± 0.54a 98.87 ± 0.45a 99.36 ± 0.60a
Appressorium formation 6 h (%)4
97.95 ± 2.08a 97.44 ± 2.45a 97.99 ± 1.26a
Collapsed Appressoria (%)5
2 M glycerol
3 M glycerol
10.13 ± 1.58b 38.57 ± 8.50a 16.46 ± 3.71b
29.37 ± 6.32b 61.69 ± 3.70a 27.92 ± 10.00b
Growth was measured as the diameter of fungal mycelia grown on complete medium for 7 days. Conidiation was measured as the number of conidia on a 1cm-dimeter disc in 1 mL of water. Conidial suspension was counted by using a haemocytometer under a microscope. Conidial germination was measured as the percentage of germinated conidia on plastic cover slips after 2 or 4 h incubation. Appressorium formation was measured as the percentage of appressorium formation among germinated conidia on plastic cover slips after 6 h incubation. Appressoria were allowed to form on plastic cover slips for 24 h. The percentage of appressoria that had collapsed after 10 min in glycerol solution was recorded. The difference estimated by Duncan’s test (SSR) (P ≤ 0.05).
that the Moplaa gene influences the early germination of the rice blast fungus. The appressorial turgor pressure was reduced in the Moplaa deletion mutant The turgor pressure exerted by a mature appressorium was measured using an incipient cytorrhysis test reported earlier (Howard et al. 1991). The rate of appressoria formation on a hydrophobic surface was similar in both the wild-type strain Guy11 and the Moplaa deletion mutant, as shown in Table 2. Nevertheless, the appressorial turgor pressure was significantly lower in the Moplaa mutant but was restored in the rescued mutant 40hb-5 (Table 2). In 2 M glycerol, 10.13 ± 1.58% of the 24 h old appressoria of the wild-type and 16.46 ± 3.71% of those of the rescued strain collapsed, which was in contrast to 38.57 ± 8.50% of those of the null mutant. In 3 M glycerol, 61.69 ± 3.70% of the appressoria of the mutant collapsed in contrast to about 30% of those of Guy11 or the rescued stain 40hb-5. These results demonstrated that the appressorial turgor pressure in the Moplaa mutant was dramatically lower than that in Guy11. Fig. 2. Deletion of the Moplaa target gene. A, Construction of the Moplaa gene replacement vector. pBS-Moplaa was linearized and transformed into the M. oryzae protoplast. A = ApaI, S = SalI, Sm = SmaI, B = BamHI, X = XbaI. B, Genomic DNAs of wildtype Guy11 and three mutants (s33, s40, and s42) were digested with SmaI and probed with a 1 kb fragment amplified with primers s66-up-p1 and s66-up-p2.
The Moplaa deletion mutant showed delayed conidial germination In the conidal germination assay, it was observed that the Moplaa deletion mutant took longer to germinate than the wildtype strain Guy11 (Table 2). After 2 h post inoculation (hpi), 84.90 ± 2.30% of the conidia in the Moplaa deletion mutant germinated in comparison to 95.51 ± 3.47% in the wild-type strain Guy11. However, the conidial germination of the Moplaa mutant was similar to that of the wild-type strain after 4 hpi. We concluded
Moplaa affects the pathogenicity To investigate the role of Moplaa gene in pathogenicity, infection assays were performed in a susceptible rice cultivar CO-39. We found that a significant reduction in pathogenicity was observed in the Moplaa mutant in comparison with Guy11 (Fig. 4). Plants were sprayed with the conidia of Guy11, Moplaa or 40hb-5 respectively. Moplaa only caused small and separated lesions on the rice leaves while Guy11 or rescued strain 40hb-5 caused typical diamond-shaped, gray-centered and proliferating lesions on leaves. Rated on the scale developed by Bonman et al. (1986), about 85% plants inoculated with Moplaa mutants were graded as 2–3, while 92% those inoculated with the wild-type Guy11 or rescued
Fig. 3. Growth of Guy11 and Moplaa on CM. Photos were taken 7 days after inoculation.
12
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13
in the regulation of specific inflammatory disease processes (Clark et al. 1991). Human PLAA is potentially important in regulating the inflammatory response through its activation of phospholipase A2 , which catalyzes the release of arachidonic acid. How the Moplaa have effect on regulation of phospholipase A2 is further to study. Targeted deletion of Moplaa in M. oryzae showed slow hyphal growth and reduced conidiation. However, the mutants were not sensitive to stress conditions such as nutrient starvation, temperature exchange and high Ca2+ concentration (data not shown). When the Moplaa gene is deleted, regulatory networks might be induced to repair the defects in response to the stress conditions in M. oryzae. In summary, Moplaa, a homologue of Human PLAA was studied in M. oryzae. Moplaa had effect on the fungal growth, production of conidiation, appressorial turgor pressure and pathogenicity to rice. Acknowledgments
Fig. 4. Pathogenicity test. Conidial suspensions were sprayed onto 3-week-old rice leaves. Infectious growth was observed 7 days after inoculation.
strain were graded as 4–5. Severity of disease caused by Moplaa mutant was reduced. Simultaneity, plants sprayed with the conidia of Moplaa showed less intense disease lesions in the susceptible rice CO-39. In 5 cm of rice leaf, the mean disease density was 63.69 ± 12.22 lesions for the Moplaa mutant in comparison with 151.07 ± 12.5 for Guy11. The severity of disease and mean disease density recovered to the similar with the wild type Guy11 when we reintroduced the Moplaa gene to the Moplaa mutant. These suggest that the Moplaa null mutant has reduced pathogenicity and that Moplaa is a crucial virulence determinant in M. oryzae. Discussion Conidia and appressoria, which play crucial roles in the rice blast disease cycle, are important development stages in M. oryzae (Talbot, 2003). It is necessary to accumulate glycerol to generate adequate turgor pressure in the appressoria in order to rupture the cuticle of the host. It has been reported that the appressorial turgor pressure is related to the pathogenicity of M. oryzae (Balhadere and Talbot, 2001; Howard et al., 1991; Nishimura et al., 2009; Park et al., 2004; Wang et al., 2007). In our study, we demonstrated that the targeted deletion of Moplaa resulted in reduced pathogenicity in rice. The number of conidia produced by the Moplaa mutant was 1/3 of that produced by wild-type Guy11. In the turgor pressure assay, approximately 60% of the appressoria had collapsed in contrast with less than 20% that had collapsed in Guy11 in 3 M glycerol. In our earlier studies, the deletion of MoFLP1 (Liu et al., 2009) or Mocmk1 (Liu et al., 2010) resulted in reduced conidia formation and turgor pressure, and the pathogenicity of the organism was significantly lower. Disruption of the MgATG1 gene to create the null mutant led to the formation of disabled appressoria, and the organism lost its ability to infect the rice leaf (Liu et al. 2007). The reduced pathogenicity of the Moplaa mutant may be attributed to reduced conidiation and turgor pressure. In S. cerevisia, the loss of Doa1 resulted in a wide range of defects such as growth defects, decreased sporulation and increased sensitivity to stress conditions (Lis and Romesberg, 2006). Lub1 of S. pombe is responsible for the maintenance of cellular ubiquitin, presumably by negative regulation of vacuole-dependent ubiquitin degradation. Lub1-deleted mutants showed very high sensitivity to UV irradiation and high temperature as well as to several stressinducing agents such as Ca2+ , methyl methanesulfonate and sodium arsenite (Ogiso et al. 2004). Human PLAA plays an important role
This work was supported by grants (no. 30925025, 30870101 and 31000077) funded by the National Natural Science Foundation of China, and our staff and graduate students at the Fungal Laboratory, Biotechnology Institute, Zhejiang University. This work was supported by the Fundamental Research Funds for the Central Universities. References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389–402. Balhadere PV, Talbot NJ. PDE1 encodes a P-type ATPase involved in appressoriummediated plant infection by the rice blast fungus Magnaporthe grisea. Plant Cell 2001;13:1987–2004. Bonman JM, Vergel De Dios TI, Khin MM. Physiologic specialization of Pyricularia oryzae in the Philippines. Plant Dis 1986;70:767–9. Chopra AK, Ribardo DA, Wood TG, Prusak DJ, Xu XJ, Peterson JW. Molecular characterization of cDNA for phospholipase A2 -activating protein. Biochim Biophys Acta 1999;1444:125–30. Clark MA, Ozgur LE, Conway TM, Dispoto J, Crooke ST, Bomalaski JS. Cloning of a phospholipase A2 -activating protein. Proc Natl Acad Sci USA 1991;88:5418–22. Dennis EA. The growing phospholipase A2 superfamily of signal transduction enzymes. Trends Biochem Sci 1997;22:1–2. Ebbole DJ. Magnaporthe as a model for understanding host-pathogen interactions. Annu Rev Phytopathol 2007;45:437–56. Howard RJ, Valent B. Breaking and entering: host penetration by the fungal rice blast pathogen Magnaporthe grisea. Annu Rev Microbiol 1996;50:491–512. Howard RJ, Ferrari MA, Roach DH, Money NP. Penetration of hard substrates by a fungus employing enormous turgor pressures. Proc Natl Acad Sci USA 1991;88:11281–4. Kohler GA, Brenot A, Haas-Stapleton E, Agabian N, Deva R, Nigam S. Phospholipase A2 and phospholipase B activities in fungi. Biochim Biophys Acta 2006;1761:1391–9. Koumanov K, Momchilova A, Wolf C. Bimodal regulatory effect of melittin and phospholipase A2 -activating protein on human type II secretory phospholipase A2 . Cell Biol Int 2003;27:871–7. Lis ET, Romesberg FE. Role of Doa1 in the Saccharomyces cerevisiae DNA damage response. Mol Cell Biol 2006;26:4122–33. Liu TB, Chen GQ, Min H, Lin FC. MoFLP1, encoding a novel fungal fasciclin-like protein, is involved in conidiation and pathogenicity in Magnaporthe oryzae. J Zhejiang Univ Sci B 2009;10:434–44. Liu XH, Lu JP, Dong B, Gu Y, Lin FC. Disruption of MoCMK1, encoding a putative calcium/calmodulin-dependent kinase, in Magnaporthe oryzae. Microbiol Res 2010;165:402–10. Liu XH, Lu JP, Zhang L, Dong B, Min H, Lin FC. Involvement of a Magnaporthe grisea serine/threonine kinase gene, MgATG1, in appressorium turgor and pathogenesis. Eukaryot Cell 2007;6:997–1005. Lu JP, Liu TB, Lin FC. Identification of mature appressorium-enriched transcripts in Magnaporthe grisea, the rice blast fungus, using suppression subtractive hybridization. FEMS Microbiol Lett 2005a;245:131–7. Lu JP, Liu TB, Yu XY, Lin FC. Representative appressorium stage cDNA library of Magnaporthe grisea. J Zhejiang Univ Sci B 2005b;6:132–6. Nishimura M, Fukada J, Moriwaki A, Fujikawa T, Ohashi M, Hibi T. Mstu1, an APSES transcription factor, is required for appressorium-mediated infection in Magnaporthe grisea. Biosci Biotechnol Biochem 2009;73:1779–86. Ogiso Y, Sugiura R, Kamo T, Yanagiya S, Lu Y, Okazaki K. Lub1 participates in ubiquitin homeostasis and stress response via maintenance of cellular ubiquitin contents in fission yeast. Mol Cell Biol 2004;24:2324–31.
X.-H. Liu et al. / Microbiological Research 167 (2011) 8–13 Pall ML, Brunelli JP. A series of six compact fungal transformation vectors containing polylinkers with multiple unique restriction sites. Fungal Genet Newsl 1993;40:59–62. Park G, Bruno KS, Staiger CJ, Talbot NJ, Xu JR. Independent genetic mechanisms mediate turgor generation and penetration peg formation during plant infection in the rice blast fungus. Mol Microbiol 2004;53:1695–707. Six DA, Dennis EA. The expanding superfamily of phospholipase A(2) enzymes: classification and characterization. Biochim Biophys Acta 2000;1488:1–19. Talbot NJ. On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Annu Rev Microbiol 2003;57:177–202.
13
Talbot NJ, Ebbole DJ, Hamer JE. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell 1993;5:1575–90. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24: 1596–9. Wang ZY, Soanes DM, KershawMJ, Talbot NJ. Functional analysis of lipid metabolism in Magnaporthe grisea reveals a requirement for peroxisomal fatty acid betaoxidation during appressorium-mediated plant infection. Mol Plant Microbe Interact 2007;20:475–91.