- Email: [email protected]
Identification and validation of a novel lead compound targeting 4-diphosphocytidyl-2-C-methylerythritol synthetase (IspD) of mycobacteria
European Journal of Pharmacology 694 (2012) 45–52
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Molecular and cellular pharmacology
Identification and validation of a novel lead compound targeting 4-diphosphocytidyl-2-C-methylerythritol synthetase (IspD) of mycobacteria Peng Gao a, Yanhui Yang b, Chunling Xiao b,n, Yishuang Liu b, Maoluo Gan b, Yan Guan b, Xueqin Hao b, Jianzhou Meng b, Shuang Zhou b, Xiaojuan Chen b, Jiafei Cui b a b
Department of Microbiology, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong, China Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China
a r t i c l e i n f o
abstract
Article history: Received 17 January 2012 Received in revised form 21 August 2012 Accepted 27 August 2012 Available online 5 September 2012
Tuberculosis is a serious threat to world-wide public health usually caused in humans by Mycobacterium tuberculosis (M. tuberculosis). It exclusively utilizes the methylerythritol phosphate (MEP) pathway for biosynthesis of isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP), the precursors of all isoprenoid compounds. The 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase (IspD; EC 2.7.7.60) is the key enzyme of the MEP pathway. It is also of interest as a new chemotherapeutic target, as the enzyme is absent in mammals and ispD is an essential gene for growth. A high-throughput screening method was therefore developed to identify compounds that inhibit IspD. This process was applied to identify a lead compound, domiphen bromide (DMB), that may effectively inhibit IspD. The inhibitory action of DMB was confirmed by over-expressing or downregulating IspD in Mycobacterium smegmatis (M. smegmatis), demonstrating that DMB inhibit M. smegmatis growth additionally through an IspD-independent pathway. This also led to higher levels of growth inhibition when combined with IspD knockdown. This novel IspD inhibitor was also reported to exhibit antimycobacterial activity in vitro, an effect that likely occurs as a result of perturbation of cell wall biosynthesis. & 2012 Elsevier B.V. All rights reserved.
Keywords: 4-diphosphocytidyl-2-C-methyl-Derythritol synthase (CDP-MEP synthase, IspD) Inhibitor DMB (Domiphen bromide) Antituberculosis activity Target
1. Introduction The World Health Organization (WHO) recently reported that in 2010 there were an estimated 8.5–9.2 million new tuberculosis cases and 1.2–1.5 million deaths from tuberculosis, including those among HIV-positive populations (Rysavy et al., 2010). Although the global incidence of tuberculosis remains stable or in decline, the total number of tuberculosis cases is still gradually rising. In fact, there are more contemporary tuberculosis cases than at any other single time in history (Das and Horton, 2010). Each year, approximately 3.2% of new cases correspond to multidrug-resistant tuberculosis (MDR-TB), a form of tuberculosis that exhibits resistance to both rifampin and isoniazid (Gandhi et al., 2010). Thus, tuberculosis is one of the most prevalent infectious diseases worldwide. Since the 1960s, however, no new anti-tuberculosis drugs have been introduced. In this context, novel anti-tuberculosis drugs and strategies are urgently needed to combat the global threat posed by Mycobacterium tuberculosis (M. tuberculosis), the primary causative agent of tuberculosis in humans.
n
Corresponding author. Tel./fax: þ 86 10 63020226. E-mail address: [email protected] (C. Xiao).
0014-2999/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ejphar.2012.08.012
Isoprenoids, a ubiquitous class of organic molecules synthesized from the five-carbon starter unit isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP), play many essential roles in M. tuberculosis metabolism. For instance, in peptidoglycan biosynthesis, the polyprenyl phosphate molecule is transferred to the key ‘‘linker unit’’ of mycobacterial arabinogalactan, lipid I, and lipid II (Eoh et al., 2007). It can also carry the activated sugars necessary for the biosynthesis of arabinogalactan, arabinomannan, and lipoarabinomannan (Wolucka et al., 1994). In addition, the side chain of menaquinone, the only lipoquinone in the electron transport chain of M. tuberculosis, is made up of polyprenyl diphosphate (Hiratsuka et al., 2008; Holsclaw et al., 2008; Mustafa et al., 2008). All evidence suggests that IPP and DMAPP may be potential targets for antimycobacterial drugs. There are two different biosynthetic pathways that produce IPP and DMAPP, the universal precursors of isoprenoids. The mevalonate pathway is found in animals, whereas the methylerythritol phosphate (MEP) pathway is found in many bacteria, parasites, some protozoa, and plants (Rohmer, 1999). Since the MEP pathway is the only source of IPP and DMAPP in M. tuberculosis and it is absent in mammalian cells (Brennan and Crick, 2007), blocking or impairing this pathway is considered to be a promising strategy for the development of antimicrobials,
46
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
antimalarials, and herbicidal agents (Rohmer, 1999). Therefore, identification of lead compounds targeting the MEP pathway by high throughput screening is direct approach to the search for new antituberculosis therapeutics. In M. tuberculosis, the MEP pathway begins with the condensation of pyruvic acid and glyceraldehyde-3-phosphate (Eoh et al., 2007), resulting in the final products IPP and its isomer, DMAPP (Eoh et al., 2007; Illarionova et al., 2006; Richard et al., 2004; Shi et al., 2007; Testa et al., 2006). This pathway is catalyzed by the eight enzymes 1deoxy-D-xylulose 5-phosphate synthase (DXS), 1-deoxy-D-xylulose-5phosphate reductoisomerase (IspC), 4-diphosphocytidyl-2-C-methylD-erythritol synthase (IspD), 4-diphosphocytidyl-2-C-methyl-D-erythritol-2-phosphate synthase (IspE), 2-C-methyl-D-erythritol 2,4cyclodiphosphate synthase (IspF), 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase (IspG), 1-hydroxy-2-methyl-2-(E)-butenyl-4diphosphate reductase (IspH), and isopentenyl diphosphate isomerase (Idi) (Eoh et al., 2009, 2007). It is reasonable to propose that the enzymes involved in MEP biosynthesis may provide novel and effective drug targets. The inhibitors of IspC, fosmidomycin and its derivatives, can effectively cure malaria (Jomaa et al., 1999). Trifluoroethanesulfonamide, a 5-iodocytosine derivative (Hirsch et al., 2007) and thiazolopyrimidine (Geist et al., 2010) have also been identified as inhibitors of IspE or IspF, respectively. IspD, another key enzyme in the MEP pathway, is capable of catalyzing the formation of 4diphosphocytidyl-2-C-methyl-D-erythritol in the presence of MEP and CTP (cytidine triphosphate) (Eoh et al., 2007). Furthermore, it has been shown that the IspD encoding gene, ispD, is essential for M. tuberculosis growth (Bernal et al., 2005). Therefore, identifying inhibitors of IspD would be an alternative and effective strategy for the development of novel antitubercular agents. In this study, a novel high-throughput screening model was successfully established. An inhibitor of IspD, domiphen bromide (DMB), was identified by this model and the inhibition was further confirmed by a high-performance liquid chromatography (HPLC)based in vitro IspD assay. Moreover, DMB was found to enhance drug sensitivity in M. smegmatis strain MC2155 by down-regulating IspD. Furthermore, drug resistance was increased by up-regulating IspD. Finally, DMB was demonstrated to provide significant antituberculosis activity in vitro for the treatment of drug-resistant M. tuberculosis.
2. Materials and methods 2.1. Bacterial strains, media, and growth conditions All chemicals used were of at least analytical grade and, unless otherwise stated, were obtained from Merck & Company, Germany. All E. coli strains were grown in LB broth or on LB-agar plates. M. smegmatis MC2155 was grown at 37 1C in 7H9 broth supplemented with 0.05% Tween-80 and ADC (5% BSA, 2% dextrose, 0.85% NaCl) or on 7H10 agar solid media supplemented with 0.05% Tween-80 and OADC (ADCþ0.003% oleic acid), as described previously (Allen, 1998). Kanamycin was always added at a concentration of 50 mg/ml for E. coli and 25 mg/ml for M. smegmatis MC2155. Growth curves were performed using quadruple cultures grown in static culture in an incubator at 37 1C in 7H9 broth containing 0.05% Tween-80 and supplemented with ADC. Tetracycline was used as an inducer. 2.2. Plasmid construction M. tuberculosis (H37Rv) genomic DNA was provided by the Beijing Research Institute for Tuberculosis Control. All PCR reagents and cloning materials, unless otherwise stated, were purchased from Takara (TaKaRa, Dalian City, Japan). The M. tuberculosis ispD gene was amplified using oligonucleotide primers designed from
sequences available in PubMed (http://www.ncbi.nlm.nih.gov). The primers used were 50 –TTCATCCATATGGTCAGGGAAGCGGGCGAAGTAGTTGCG–30 and 50 –GTCTTATCTCGAGCCCGCGCACTATAGCTTGGGC CAGC–30 , containing NdeI and XhoI restriction enzyme sites, respectively. The PCR product was cloned into the NdeI and XhoI sites of the pET28a(þ) vector and subsequently purified. Ligation mixtures were used to transform E. coli DH5a cells, creating DH5a [pET28a (þ)::MtbispD], in which the target pET28a(þ)::MtbispD plasmid was propagated. The plasmid was isolated using Omega Plasmid Miniprep kits (Omega Bio-Tek, Inc., Norcross, USA) and sequenced by Sangon Biotech Co. Ltd. (Shanghai). 2.3. Inducible ispD antisense knockdown in M. smegmatis Genomic DNA from M. smegmatis was isolated using the method of Parish and Stoker (1998). The M. smegmatis ispD gene (MSMEG_6076) was amplified using the primers 50 –GGACTAGTATGGCGACGGTTGCCGTCGT-30 and 50 –CGGGATCCTCATGCGCCG CGCGCCAGGA–30 , containing SpeI and BamHI restriction enzyme sites, respectively. In accordance with the method described by Blokpoel et al. (2005), the PCR product was cloned into the SpeI and BamHI sites of the pMind vector, generating the tetracyclineinducible pMind::MsispD antisense plasmid, which was then sequenced and electroporated into M. smegmatis MC2155. 2.4. Inducible ispD overexpression in M. smegmatis and real-time PCR The method used was similar to that used for pMind::MsispD. The H37Rv ispD gene was amplified from the pET28a(þ)::MtbispD plasmid using the primers 50 –TGCGGATCCAGTGGTCAGGGAAGCGGG CGA–30 and 50 –GATAAGCTTTCACCCGCGCACTATAGCTTG–30 , containing BamHI and HindIII restriction enzyme sites, respectively. The PCR product was cloned into the BamHI and HindIII sites of the pMV261 vector, generating the thermal-inducible pMV261::ispD plasmid, which was then sequenced and electroporated into M. smegmatis MC2155. Real-time PCR was used to detect IspD expression. Briefly, single-stranded cDNA was synthesized using a reverse transcription system kit (Promega Corporation, Madison, WI, USA,), according to the protocol supplied by the manufacturer. Real-time PCR was performed using a Corbett RG-6000 real-time (quantitative) PCR machine. The housekeeping gene 16s was used as an inner control. The forward primer of M. smegmatis IspD is 50 –AGATCCAGC GGTGTGGTGAT–30 and the reverse primer is 50 –GTGGGAGGC GTCGTTGTT–30 . The forward primer of 16s is 50 –TGGAGGGAGCCGTCGAA–30 and reverse primer is 50 –TTCCGGTACGGCTACCTTGTT–30 . The following PCR reaction mixture in a total volume of 20 ml was used: 10 ml 2 mix; 1 ng of template cDNA in 2 ml; 0.4 ml of forward primer and 0.4 ml of reverse primer; and 7.2 ml of ddH2O. Real-time PCR was performed with an initial denaturation of 3 min at 95 1C, followed by 40 cycles of 3 s at 95 1C, 20 s at 60 1C, and melting from 65 1C to 95 1C. Fluorescence detection was performed at the annealing phase and during the subsequent dissociation curve analysis to confirm the amplification of a single product. 2.5. Expression and purification of recombinant IspD Recombinant ispD was expressed and purified as previously described (Eoh et al., 2007). Briefly, transformation of E. coli BL21(DE3) pLysS (Novagen, San Diego, CA) with pET28a(þ)::MtbispD resulted in the recombinant strain BL21(DE3) pLysS [pET28a(þ):: ispD]. Protein expression was induced with 1 mM isopropyl-b-Dthiogalactopyranoside (IPTG) at 20 1C. The recombinant protein, carrying an N-terminal hexahistidine tag, was purified by Ni2þ ionaffinity chromatography using a linear gradient of 20–500 mM imidazole in washing buffer (50 mM Tris–HCl pH 7.9, 300 mM NaCl). Eluted fractions were analyzed by SDS-PAGE and visualized with
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Coomassie Brilliant Blue R-250 gel staining or by western blotting with an anti-His antibody (Abmart, Shanghai, China). Briefly, proteins were transferred electrically from the gel onto the PVDF membrane (Millipore, Bedford, MA). The blots were blocked for 1 h with 5% low fat milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) at room temperature and incubated with anti-His antibody overnight at 4 1C. The blots were washed three times in TBST and incubated with HRP-conjugated anti-mouse IgG antibody at room temperature for 2 h. After rinsing with TBST, blots were developed using a chemiluminescence assay kit (Pierce, Rockford, IL). Fractions containing recombinant IspD protein were estimated to be at least 95% pure by Coomassie staining. They were pooled, desalted on a PD-10 column (GE), ultrafiltrated in a 10 kDa cutoff Millipore Centricon (Billerica, MA) device, and stored at 80 1C in 50 ml aliquots. Protein concentrations were estimated using the BCA protein assay kit (Pierce, Rockford, IL). 2.6. Activity and steady-state kinetic analysis of IspD The IspD activity assay was a modification of the protocol reported by Bernal et al. (2005). Briefly, IspD activity was monitored by measuring PPi release using a BMG FLUOstar Omega (BMG Labtech, UK) microplate reader. Reaction mixtures contained 50 mM Tris–HCl (pH 7.9), 20 mM sodium fluoride, 10 mM MgCl2, 1 mM dithiothreitol, 0.1 mg of purified IspD enzyme, and MEP and CTP at 500 mM, forming a final volume of 100 ml. Incubations were performed at 37 1C for 40 min. Reactions were terminated by the addition of 10 ml of b-mercaptoethanol, and the reaction mixtures were then added to 40 ml of coloration reagent prepared with 2.5% ammonium molybdate in 2.5 M H2SO4. The effect of concentration of MEP on IspD activity was measured using a constant concentration of CTP (1 mM) and varying concentrations of MEP from 1 mM to 15.63 mM through serial, two-fold dilutions. The effect of CTP was determined as for MEP. In all assays, the concentration of one of the substrates was kept constant and the other substrate was varied. The Km values were obtained by plotting the rate as a function of the concentration of the varied substrate at the same enzyme concentration. The Km and Vmax of the enzyme for different substrates was calculated by nonlinear regression analysis (Sigmaplot, San Rafael, CA). For IC50 and screening experiments, the CTP and MEP concentrations were 500 mM and 250 mM, respectively, and the DMB concentrations were 0, 6.25, 12.5, 25, 50, 100, 200, and 400 mg/ml. The Ki experiments used CTP or MEP at concentrations of 1000, 500, 250, 125, and 62.5 mg/ml, and DMB concentrations of 0, 25, 50, 100, and 200 mg/ml. Substrate curves were run in triplicate for each inhibitor concentration. 2.7. High-throughput screening model The activity of M. tuberculosis IspD was measured spectrophotometrically with a chromogenic reaction. This method was used to screen compounds in a 96-well format. The rate of CTP utilization was quantified by measuring the absorbance of blue ammonium phosphomolybdate produced, allowing for an internal control to detect interference from compounds that absorb at 590 nm. Reagents were stable in solution at 4 1C for at least 4 h. 2.8. High-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) The enzyme reaction mixture included 100 mg/ml DMB in a volume of 300 ml, with other components similar to those of the enzyme assay. A TSK-Gel Amide-80 column (250 mm 4.6 mm,
47
5 mm) was used for analyzing the mixture. The Shimadzu HPLC system (Shimadzu Corp., Kyoto, Japan) consisting of a LC-20AD pump combined with a model SIL-20AC automatic injector and a diode array detector (model SPDM20A) was used. The system was controlled with the LC Solution software from Shimadzu. The mobile phase buffer consisted of 20 mM CH3COONH4:CH3 CN¼33:67, and the flow rate for all analyses was set at 1 ml/ min at 30 1C. HPLC-MS/MS experiments were conducted on an Agilent 1200 system (Agilent Technologies, Inc., Santa Clara, CA) coupled to a QStar elite HPLC-MS/MS spectrometer with scan style negative TOF MS mode. The HPLC system was outfitted with a binary pump, an auto-sampler, and an in-line mobile phase vacuum degasser. The HPLC elution conditions were as described above. The flow rate was set to 1 ml/min at 30 1C. The retention time was 7.035 min for CDP-ME (4-diphosphocytidyl-2-C-methyl-D-erythritol) and 20.36 min for CTP. The MS/MS operating parameters for the analyte and IS were obtained and optimized using the negative ion mode. The transitions for multiple reaction monitoring were m/z 520.4-322.3 for CDP-ME and m/z 482.3-384.3 for CTP. The operational parameters of the mass spectrometer were as follows: Curtain gas (CUR)¼ 30 psi, Gas1¼50 psi, Gas2¼ 50 psi, TurboIonspray voltage (IS)¼ 4500 V, TEM¼450 1C, Collision energy (CE)¼ 25 eV, Declustering potential (DP)¼ 60 V, DP2¼ 15 V for analyte. 2.9. Determination of minimal inhibitory concentration (MIC) of DMB MIC was defined as the lowest drug concentration that prevented the growth of 99% of bacteria. Depending on the setting and requirement, MICs for DMB were determined using the 7H9 broth dilution method from 25 mg/ml to 20 ng/ml in the 96 wellplate format. M. smegmatis was grown until OD600 ¼2 and then diluted to 0.002. The strains were cultured at 42 1C for 2 days. 2.10. Sample preparation for mycolic acid analysis For thin-layer chromatography (TLC), mycolic acids were prepared with acid methanolysate in a similar manner to the assays performed by Minnikin et al. (1975). Analytical two-dimensional TLC was also performed as previously described (Minnikin et al., 1984). The results were not significantly different, and the free and bound mycolic acids were therefore separated according to the method previously described by Gande et al. (2004) and Alderwick et al. (2005). The sample for the MIDI Sherlock system was prepared as previously described (Cage, 1992). 2.11. Antitubercular activity assay The MICs of various compounds on the mycobacterial H37Rv were determined. Compound concentrations were diluted from 128.0 mg/ ml to 0.0625 mg/ml. Isoniazid (INH) and rifampin (RFP) were used as controls. Bacteria cultured without any drugs were also set. Cells were inoculated into 48-well plates with 4 10 3 mg per well. Cell count and morphology were examined one week later.
3. Results 3.1. Expression, purification, and kinetic characterization of IspD IspD in M. tuberculosis, encoded by the Rv3582c gene, is a polypeptide of 234 amino acids with a molecular mass of 26 kDa and an isoelectric point of 4.71 (Dhiman et al., 2005). The Rv3582c gene was amplified and successfully cloned into the pET28a ( þ)
48
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
vector for expression in the E. coli strain BL21(DE3) pLysS. Immobilized metal affinity chromatography with Ni2 þ -NTA agarose was used to isolate and purify His6-tagged IspD. Expression of the purified IspD protein, containing an N-terminal hexahistidine tag, was confirmed by SDS-PAGE and western blotting using an anti-His antibody (Fig. 1). The activity of IspD was tested by measuring PPi release upon addition of the substrate. The enzyme reaction finished within 30 min, at an IspD level of 38.5 pmol. The effects of the MEP and CTP concentrations on reaction rates were determined by varying the concentration of one substrate while keeping the other fixed (Fig. 2A and B). Similarly, the apparent KMEP and KCTP were m m calculated to be 92.4278.17 mM and 126.42718.25 mM, respectively. Calculated Kcat (catalytic constant) and Kcat/Km (specificity constant) values were 23 min 1 and 2.50 105 M 1 min 1 for MEP and 25 min 1 and 1.99 105 M 1 min 1 for CTP, respectively. The Enzyme Kinetics Module in SigmaPlot was used to rank various modes of enzyme inhibition. Calculated Ki values were 6.64 mM for CTP and 21.93 mM for MEP, respectively (Table 1). 3.2. Identification of an IspD inhibitor by high throughput screening Enzyme concentrations, substrate concentrations, and optimal reaction rates were determined in 100 ml reaction volumes in 96well plates, with the enzyme concentration being adjusted to provide a linear reaction rate for 40 min at 590 nm. The Z0 factor (Zhang et al., 1999) was employed to assess the suitability of the IspD enzyme reaction for a high-throughput format, and it was analyzed at the optimal enzyme (1 U), MEP (250 mM), and CTP (500 mM) concentrations. The Z0 value (Zhang et al., 1999) obtained for the IspD high-throughput screen assay was approximately 0.8, indicating an extremely robust assay. To validate the assay and to set the hit threshold, a small proprietary library of 3200 compounds was screened at a concentration of 10 mg/ml. Internal controls consisting of Z0 factor analysis, reagents for a full reaction, and reagents for a background reaction were included in each plate of the assay. The hit threshold was set at Z20% inhibition. Four compounds were
Fig. 1. Purification of recombinant M. tuberculosis IspD. Expression of the His6IspD recombinant protein purified from E. coli BL21(DE3) pLysS by Ni2 þ ionaffinity chromatography was confirmed by SDS-PAGE followed by (a) Coomassie staining of the gel and (b) western blotting with an anti-His antibody. Lane M1, molecular weight marker: 80, 60, 40, 30, 20, and 12 KDa; lane M2, molecular weight marker: 94, 62, 47, 30, 24, and 16 KDa; lane 1 and lane 2.
identified with activity against IspD that reached the hit threshold. Among these 4 compounds, DMB had at least three replicates with a percentage of inhibition Z30%. 3.3. Validation of the inhibition of IspD by DMB Recombinant IspD was sensitive to DMB, as observed through an IspD activity assay. The 50% inhibitory concentration (IC50) was calculated to be 33.0673.59 mg/ml from the data shown in Fig. 3A. In order to verify the specific inhibition of IspD, the reaction was evaluated by HPLC. The peak of CDP-ME dramatically decreased upon treatment with 100 mg/ml of DMB, concomitant with an increase in CTP (Fig. 3B). The products of the enzymatic reaction were identified by HPLC-MS (Fig. S1). The relative molecular masses of CDP-ME and CTP are 521.31 Da and 483.16 Da, respectively. The m/z values of 520.3874 [M-H] and 482.2739 [M-H] correspond to the peak retention times of approximately 7 min and 20 min, respectively. Therefore, DMB can effectively block the catalytic reaction of IspD in vitro. 3.4. Effects of DMB on the growth of M. smegmatis To investigate whether DMB has an effect on the growth of bacteria and if that effect is correlated with expression levels of IspD, M. smegmatis strains were engineered with sense or antisense expression of ispD to overexpress or knockdown IspD expression. Furthermore, the expression of IspD by real-time PCR demonstrated that mRNA of IspD in overexpression in M. smegmatis was 1.53 70.11 fold greater than that of wild-type M. smegmatis. The minimal inhibitory concentration (MIC) of DMB in the ispD-overexpressing M. smegmatis [pMV261::ispD] was 1.56 mg/ml, compared to 0.31 mg/ml in the control strain M. smegmatis [pMV261] (Fig. 4A). On the other hand, the pMind::ispD plasmid was engineered for antisense knockdown of ispD, which is a tetracycline-regulated system for manipulation of ispD gene expression according to previous reports (Blokpoel et al., 2005). In this system, the levels of ispD gene expression knockdown are tetracycline dose-dependent. The effect of DBM (0.5 mg/ ml) treatment on the growth of M. smegmatis was similar to that of IspD knockdown (Fig. 4B). However, the combination of DMB treatment with ispD knockdown (M. smegmatis [pMind::ispD] induced with the high dose of tetracycline and treated with DMB) resulted in complete inhibition of M. smegmatis growth (Fig. 4B). This synergetic effect suggests the ispD gene as a potential target for anti-tuberculosis therapy targeting M. tuberculosis. As depicted in Table 2, although DMB showed a higher MIC than that of INH or RFP in M. tuberculosis H37Rv, this newly identified compound displayed approximately the same MICs in clinical isolates of drug-resistant M. tuberculosis (MDR-TB and XDR-TB), which are resistant to both INH and RFP. These results suggest that DMB may enhance the drug sensitivity of drugresistant M. tuberculosis. The MEP pathway plays crucial roles in cell wall biosynthesis and energy production (Saito and Ogura, 1981; Sharma et al., 1996; Wolucka et al., 1994). Therefore, it is conceivable that DMB could alter the structure of the cell wall in M. smegmatis. This hypothesis was confirmed by cell wall mycolic acid TLC (Minnikin et al., 1984) and HPLC analysis (Fig. 5A). Although preliminary results showed that the whole-cell mycolic acid of M. smegmatis was not significantly altered by treatment with DMB, by separating the free and bound mycolic acid the bound mycolic acid was found to significantly decrease after treated with DMB (Fig. 5A). Whole-cell mycolic acids were analyzed with a MIDI Sherlock system HPLC experiment. The different components were identified using a calibration standard mix containing from nC40 to nC97
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
49
Fig. 2. IspD activity according to substrate concentration. (A) The relationship between enzyme activity of IspD and time of reaction. An IspD activity assay was performed to study (A) the effect of MEP concentration on IspD activity. CTP was held at 1 mM and the concentration of MEP was varied. (B) The effect of CTP concentration on IspD activity. MEP was held at 1 mM and concentrations of CTP were varied. Results are presented as means7 S.D. of three independent experiments.
Table 1 Calculated kinetic parameters for M. tuberculosis IspDa. Substrate
Km (mM)
Vmax (nmol/min)
Kcat (min 1)
Kcat/Km (M 1 min 1)
Ki (mM)
MEP CTP
92.42 78.17 126.427 18.25
0.89 7 0.08 0.97 7 0.14
23.11 7 2.04 25.28 7 3.65
2.50 105 1.99 105
Uncompetitive 21.92 7 1.94 Competitive 6.64 7 0.96
a Each reaction mix contained 0.1 mg ( 38.5 pmol) of M. tuberculosis IspD. The Km and Vmax values were calculated from data averaged from three independent experiments, using nonlinear regression analysis.
Fig. 3. Inhibition of IspD by DMB. (A) The IC50 value of DMB was determined by varying the DMB concentration from 0 to 400 mg/ml. Enzyme and substrate concentrations were as described in the Materials and Methods section. Results are presented as means7 S.D. of three independent experiments. (B) Evaluation of the enzymatic reaction by HPLC. a: the control with full reaction; b: the sample with 100 mg/ml DMB.
saturated fatty acids. The difference was primarily at mycolic acid equivalent carbon chain lengths from 64 to 89. The fraction of C81, C84, and C89 increased, and the other three decreased. These results were evaluated using the integral area of the chromatographic peak (Fig. 5B).
4. Discussion The current study details an optimized method for a highthroughput analysis system for the validation of potential IspD inhibitors and uses this system to verify DMB as a valuable
potential antituberculosis lead compound. Because the biosynthesis of IPP and DMAPP is crucial for bacterial metabolism, the MEP pathway has become a significant target for the development of new antibiotics and antimetabolites that cannot be fully exploited through currently available methods (Kuzuyama, 2002). Previous assays required special conditions or large time investments per sample. The method proposed in the current study relies on PPi released during the reaction catalyzed by IspD, providing a relatively inexpensive and rapid method for high-throughput screening that may be simply automated. High-throughput screening has only recently been employed in targeting the IspD receptor. Previous methods for assessment of
50
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Fig. 4. Effects of DMB on the growth of M. smegmatis. (A) Determination of the MICs of DMB in M. smegmatis expressing endogenous or overexpressed levels of ispD. Results are presented as means 7S.D. of three independent experiments. (B) The growth curve of M. smegmatis expressing or not expressing the antisense for ispD and treated or not treated with 0.5 mg/ml DMB. Sample I: Msmeg [pMind::ispD] treated with DMB and induced with 10 ng/ml tetracycline; Sample II: Msmeg [pMind::ispD] treated with DMB and induced with 50 ng/ml tetracycline; Control I: Msmeg [pMind] treated with DMB and induced with 10 ng/ml tetracycline; Control II: Msmeg [pMind] treated with DMB and induced with 50 ng/ml tetracycline; Control III: Msmeg [pMind::ispD] without DMB and induced with 50 ng/ml tetracycline. Results are presented as means7 S.D. of three independent experiments.
Table 2 Anti-tuberculosis activity of DMB. Bacterial strain
H37Rv MDR-TB (330) XDR-TB (926)
MIC (mg/ml) DMB
INH
RFP
8 8 16
0.032 8 16
0.125 16 32
enzymatic activity of IspD orthologs were conducted using 32Pradioactive labeled NTP (Testa et al., 2006) or thin-layer chromatography-based assays (Richard et al., 2004). Time-consuming structure-based approaches to drug design have been used to develop novel inhibitors for the IspD receptor. One such study explored the binding affinity and hydrogen bond interaction between the active site and ligand through docking studies and applied synthetic accessibility filters to screen designed molecules, producing only 15 potential molecules (Varikoti et al., 2012). Another study examined novel pyrazoline derivatives bearing benzimidazole for treatment of tuberculosis, in which a primary challenge was synthesis and verification of the newly synthesized compounds by thin layer chromatographic and elemental analysis, producing only 10 viable molecules for further in vitro testing (Shahar Yar et al., 2009). Thus, structure-based methods often require synthesis of specific molecules that necessitate expensive synthesis and characterization procedures, often producing few viable results. High-throughput assays provide increased efficiency and are more likely to result in the isolation of viable compounds. The inhibitory effect of DMB on IspD was confirmed by both the newly-established high-throughput screening system and traditional enzyme kinetic assays. Furthermore, decreasing CDPME was confirmed by HPLC-MS. In the IspD-overexpressing M. smegmatis strain, high levels of IspD overcame the growthinhibitory effects caused by DMB, consistent with DMB repression of IspD function. Moreover, the mycolic acid fraction in M.
smegmatis was altered by DMB treatment, suggesting that IPP and DMAPP impact cell wall functionality. In addition, DMB displayed a similar inhibitory activity towards M. tuberculosis H37Rv and clinical isolates of drug-resistant M. tuberculosis, including MDR-TB (330) and XDR-TB (926). Cumulatively, these findings demonstrate a novel function of DMB as an IspD inhibitor, though further study will be required to fully characterize the mechanism of DMB action. Notably, no ortholog of M. tuberculosis IspD exists in humans (Eoh et al., 2007), which suggests than minimal toxicity can be achieve in vivo through the development of therapeutics that target functions the function critical to bacillus survival that is absent in the host. Furthermore, crystallographic analysis of the enzyme’s receptor site has shown that the active site of IspD is highly conserved, suggesting that virtually any new inhibitor may potentially exhibit broadspectrum activity against tuberculosis-causing agents, such as M. tuberculosis (Bj¨orkelid et al., 2011). As drug-resistance to common treatments, such as isoniazid or rifampin, becomes an increasing issue in tuberculosis treatment, novel inhibitors of IspD, including DMB, may become important first-line treatments due to their ability to inhibit the growth of M. tuberculosis by a mechanism distinct from those observed in isoniazid and rifampin. DMB plays a novel role in inhibiting M. tuberculosis IspD and growth. DMB likely suppresses the growth of M. tuberculosis through repression of IspD activity, subsequently affecting CDP-ME levels and mycolic acid accumulation. Alternatively, DMB may suppress growth in an IspD-independent manner, indicated in the present study by complete growth inhibition of the ispD knockdown strain upon treatment with DMB. DMB is a valuable target for further development due to its role as an inhibitor of M. tuberculosis IspD, displaying an IC50 at the micromolar level; its demonstrated ability to inhibit M. tuberculosis and MDR-TB growth in vitro; and its bacillus-specific mechanism of action. Furthermore, the hypersensitivity of M. smegmatis ispD knock-downs indicates potential efficacy in resistant strains. Though further studies of the metabolic and transcript profiles are required. DMB is a promising antituberculosis lead compound. This, and other lead compounds, can be identified using the novel high-throughput method described in the current study.
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
51
Fig. 5. M. smegmatis mycolic acid analyses by TLC and HPLC. (A) Chromatogram showing: 1: free mycolic acids from untreated M. smegmatis; 2: free mycolic acids from M. smegmatis treated with 0.25 mg/ml DMB for 24 h; 3: cell wall bound mycolic acids from untreated M. smegmatis; 4: cell wall bound mycolic acids from M. smegmatis treated with 0.25 mg/ml DMB for 24 h. (B) Graph showing the mycolic acid equivalent carbon length and the areas of the corresponding peaks. Control: untreated M. smegmatis; Sample: M. smegmatis treated with 0.25 mg/ml DMB for 24 h. Data are expressed as means 7S.D. of three independent experiments.
Acknowledgments We are very grateful to Brain D. Robertson from the Imperial College London, South Kensington campus, for donation of the pMind plasmid. We would also like to thank Professors Jiandong Jiang and Bin Hong for their guiding suggestions and Professor Yuqin Zhang for assistance with mycolic acid analyses. This work was supported by funds from the Important National Science and Technology Special Projects of China during the 11th Five-Year Plan (No. 2008ZX10003006) and the National Natural Science Foundation of China (Nos. 30873186NST and 81072674NST).
Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2012.08.012.
References Alderwick, L.J., Radmacher, E., Seidel, M., Gande, R., Hitchen, P.G., Morris, H.R., Dell, A., Sahm, H., Eggeling, L., Besra, G.S., 2005. Deletion of Cg-emb in corynebacterianeae leads to a novel truncated cell wall arabinogalactan, whereas inactivation of Cg-ubiA results in an arabinan-deficient mutant with a cell wall galactan core. J. Biol. Chem. 280, 32362–32371. Allen, B.W., 1998. Mycobacteria. General culture methodology and safety considerations. Methods Mol. Biol. 101, 15–30. Bernal, C., Palacin, C., Boronat, A., Imperial, S., 2005. A colorimetric assay for the determination of 4-diphosphocytidyl-2-C-methyl-D-erythritol 4-phosphate synthase activity. Anal. Biochem. 337, 55–61. ¨ Bjorkelid, C., Bergfors, T., Henriksson, L.M., Stern, A.L., Unge, T., Mowbray, S.L., Jones, T.A., 2011. Structural and functional studies of mycobacterial IspD enzymes. Acta Crystallogr. D Biol. Crystallogr. 67 (Pt 5), 403–414. Blokpoel, M.C., Murphy, H.N., O’Toole, R., Wiles, S., Runn, E.S., Stewart, G.R., Young, D.B., Robertson, B.D., 2005. Tetracycline-inducible gene regulation in mycobacteria. Nucleic Acids Res., e22. Brennan, P.J., Crick, D.C., 2007. The cell-wall core of Mycobacterium tuberculosis in the context of drug discovery. Curr. Top. Med. Chem. 7, 475–488. Cage, G.D., 1992. High-performance liquid chromatography patterns of Mycobacterium gordonae mycolic acids. J. Clin. Microbiol. 30, 2402–2407. Das, P., Horton, R., 2010. Tuberculosis—time to accelerate progress. Lancet 375, 1755–1757. Dhiman, R.K., Schaeffer, M.L., Bailey, A.M., Testa, C.A., Scherman, H., Crick, D.C., 2005. 1-Deoxy-D-xylulose 5-phosphate reductoisomerase (IspC) from Mycobacterium tuberculosis: towards understanding mycobacterial resistance to fosmidomycin. J. Bacteriol. 187, 8395–8402. Eoh, H., Brennan, P.J., Crick, D.C., 2009. The Mycobacterium tuberculosis MEP (2Cmethyl-D-erythritol 4-phosphate) pathway as a new drug target. Tuberculosis (Edinburgh) 89, 1–11. Eoh, H., Brown, A.C., Buetow, L., Hunter, W.N., Parish, T., Kaur, D., Brennan, P.J., Crick, D.C., 2007. Characterization of the Mycobacterium tuberculosis
4-diphosphocytidyl-2-C-methyl-D-erythritol synthase: potential for drug development. J. Bacteriol. 189, 8922–8927. Gande, R., Gibson, K.J., Brown, A.K., Krumbach, K., Dover, L.G., Sahm, H., Shioyama, S., Oikawa, T., Besra, G.S., Eggeling, L., 2004. Acyl-CoA carboxylases (accD2 and accD3), together with a unique polyketide synthase (Cg-pks), are key to mycolic acid biosynthesis in Corynebacterianeae such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J. Biol. Chem. 279, 44847–44857. Gandhi, N.R., Nunn, P., Dheda, K., Schaaf, H.S., Zignol, M., van Soolingen, D., Jensen, P., Bayona, J., 2010. Multidrug-resistant and extensively drug-resistant tuberculosis: a threat to global control of tuberculosis. Lancet 375, 1830–1843. Geist, J.G., Lauw, S., Illarionova, V., Illarionov, B., Fischer, M., Grawert, T., Rohdich, F., Eisenreich, W., Kaiser, J., Groll, M., Scheurer, C., Wittlin, S., Alonso-Gomez, J.L., Schweizer, W.B., Bacher, A., Diederich, F., 2010. Thiazolopyrimidine inhibitors of 2-methylerythritol 2,4-cyclodiphosphate synthase (IspF) from Mycobacterium tuberculosis and Plasmodium falciparum. ChemMedChem. Hiratsuka, T., Furihata, K., Ishikawa, J., Yamashita, H., Itoh, N., Seto, H., Dairi, T., 2008. An alternative menaquinone biosynthetic pathway operating in microorganisms. Science 321, 1670–1673. Hirsch, A.K., Lauw, S., Gersbach, P., Schweizer, W.B., Rohdich, F., Eisenreich, W., Bacher, A., Diederich, F., 2007. Nonphosphate inhibitors of IspE protein, a kinase in the non-mevalonate pathway for isoprenoid biosynthesis and a potential target for antimalarial therapy. ChemMedChem 2, 806–810. Holsclaw, C.M., Sogi, K.M., Gilmore, S.A., Schelle, M.W., Leavell, M.D., Bertozzi, C.R., Leary, J.A., 2008. Structural characterization of a novel sulfated menaquinone produced by stf3 from Mycobacterium tuberculosis. ACS Chem. Biol. 3, 619–624. Illarionova, V., Kaiser, J., Ostrozhenkova, E., Bacher, A., Fischer, M., Eisenreich, W., Rohdich, F., 2006. Nonmevalonate terpene biosynthesis enzymes as antiinfective drug targets: substrate synthesis and high-throughput screening methods. J. Org. Chem. 71, 8824–8834. Jomaa, H., Wiesner, J., Sanderbrand, S., Altincicek, B., Weidemeyer, C., Hintz, M., Turbachova, I., Eberl, M., Zeidler, J., Lichtenthaler, H.K., Soldati, D., Beck, E., 1999. Inhibitors of the nonmevalonate pathway of isoprenoid biosynthesis as antimalarial drugs. Science 285, 1573–1576. Kuzuyama, T., 2002. Mevalonate and nonmevalonate pathways for the biosynthesis of isoprene units. Biosci. Biotechnol. Biochem. 66, 1619–1627. Minnikin, D.E., Alshamaony, L., Goodfellow, M., 1975. Differentiation of Mycobacterium, Nocardia, and related taxa by thin-layer chromatographic analysis of whole-organism methanolysates. J. Gen. Microbiol. 88, 200–204. Minnikin, D.E., Minnikin, S.M., Hutchinson, I.G., Goodfellow, M., Grange, J.M., 1984. Mycolic acid patterns of representative strains of Mycobacterium fortuitum, ‘Myobacterium peregrinum’ and Mycobacterium smegmatis. J. Gen. Microbiol. 130, 363–367. Mustafa, G., Migita, C.T., Ishikawa, Y., Kobayashi, K., Tagawa, S., Yamada, M., 2008. Menaquinone as well as ubiquinone as a bound quinone crucial for catalytic activity and intramolecular electron transfer in Escherichia coli membranebound glucose dehydrogenase. J. Biol. Chem. 283, 28169–28175. Parish, T., Stoker, N.G., 1998. Mycobacteria. Bugs and bugbears. Methods Mol Biol. 101, 1–13. Richard, S.B., Lillo, A.M., Tetzlaff, C.N., Bowman, M.E., Noel, J.P., Cane, D.E., 2004. Kinetic analysis of Escherichia coli 2-C-methyl-D-erythritol-4-phosphate cytidyltransferase, wild type and mutants, reveals roles of active site amino acids. Biochemistry 43, 12189–12197. Rohmer, M., 1999. The discovery of a mevalonate-independent pathway for isoprenoid biosynthesis in bacteria, algae and higher plants. Nat. Prod. Rep. 16, 565–574. Rysavy, M., Pavelka, T., Khayarin, M., Dzupa, V., 2010. Iliosacral screw fixation of the unstable pelvic ring injuries. Acta Chir. Orthop. Traumatol. Cech. 77, 209–214.
52
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Saito, Y., Ogura, K., 1981. Biosynthesis of menaquinones. Enzymatic prenylation of 1,4-dihydroxy-2-naphthoate by Micrococcus luteus membrane fractions. J. Biochem. 89, 1445–1452. Yar, M.S., Abdullah, M.M., Majeed, J., 2009. In vitro anti-tubercular screening of newly synthesized benzimidazole derivatives. World Acad. Sci. Eng. Technol. 55, 593–599. Sharma, V., Hudspeth, M.E., Meganathan, R., 1996. Menaquinone (vitamin K2) biosynthesis: localization and characterization of the menE gene from Escherichia coli. Gene 168, 43–48. Shi, W., Feng, J., Zhang, M., Lai, X., Xu, S., Zhang, X., Wang, H., 2007. Biosynthesis of isoprenoids: characterization of a functionally active recombinant 2-Cmethyl-D-erythritol 4-phosphate cytidyltransferase (IspD) from Mycobacterium tuberculosis H37Rv. J. Biochem. Mol. Biol. 40, 911–920. Testa, C.A., Lherbet, C., Pojer, F., Noel, J.P., Poulter, C.D., 2006. Cloning and expression of IspDF from Mesorhizobium loti. Characterization of a
bifunctional protein that catalyzes non-consecutive steps in the methylerythritol phosphate pathway. Biochim. Biophys. Acta 1764, 85–96. Varikoti, R.A., Gangwal, R., Dhoke, G., Ramaswamy, V.K., Sangamwar, A., 2012. Structure based de novo design of IspD inhibitors as anti-tubercular agents. Available from Nature Precedings http://dx.doi.org/10.1038/npre. 2012.7088.1. Wolucka, B.A., McNeil, M.R., de Hoffmann, E., Chojnacki, T., Brennan, P.J., 1994. Recognition of the lipid intermediate for arabinogalactan/arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. J. Biol. Chem. 269, 23328–23335. Zhang, J.H., Chung, T.D., Oldenburg, K.R., 1999. A Simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, 67–73.
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Molecular and cellular pharmacology
Identification and validation of a novel lead compound targeting 4-diphosphocytidyl-2-C-methylerythritol synthetase (IspD) of mycobacteria Peng Gao a, Yanhui Yang b, Chunling Xiao b,n, Yishuang Liu b, Maoluo Gan b, Yan Guan b, Xueqin Hao b, Jianzhou Meng b, Shuang Zhou b, Xiaojuan Chen b, Jiafei Cui b a b
Department of Microbiology, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong, China Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China
a r t i c l e i n f o
abstract
Article history: Received 17 January 2012 Received in revised form 21 August 2012 Accepted 27 August 2012 Available online 5 September 2012
Tuberculosis is a serious threat to world-wide public health usually caused in humans by Mycobacterium tuberculosis (M. tuberculosis). It exclusively utilizes the methylerythritol phosphate (MEP) pathway for biosynthesis of isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP), the precursors of all isoprenoid compounds. The 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase (IspD; EC 2.7.7.60) is the key enzyme of the MEP pathway. It is also of interest as a new chemotherapeutic target, as the enzyme is absent in mammals and ispD is an essential gene for growth. A high-throughput screening method was therefore developed to identify compounds that inhibit IspD. This process was applied to identify a lead compound, domiphen bromide (DMB), that may effectively inhibit IspD. The inhibitory action of DMB was confirmed by over-expressing or downregulating IspD in Mycobacterium smegmatis (M. smegmatis), demonstrating that DMB inhibit M. smegmatis growth additionally through an IspD-independent pathway. This also led to higher levels of growth inhibition when combined with IspD knockdown. This novel IspD inhibitor was also reported to exhibit antimycobacterial activity in vitro, an effect that likely occurs as a result of perturbation of cell wall biosynthesis. & 2012 Elsevier B.V. All rights reserved.
Keywords: 4-diphosphocytidyl-2-C-methyl-Derythritol synthase (CDP-MEP synthase, IspD) Inhibitor DMB (Domiphen bromide) Antituberculosis activity Target
1. Introduction The World Health Organization (WHO) recently reported that in 2010 there were an estimated 8.5–9.2 million new tuberculosis cases and 1.2–1.5 million deaths from tuberculosis, including those among HIV-positive populations (Rysavy et al., 2010). Although the global incidence of tuberculosis remains stable or in decline, the total number of tuberculosis cases is still gradually rising. In fact, there are more contemporary tuberculosis cases than at any other single time in history (Das and Horton, 2010). Each year, approximately 3.2% of new cases correspond to multidrug-resistant tuberculosis (MDR-TB), a form of tuberculosis that exhibits resistance to both rifampin and isoniazid (Gandhi et al., 2010). Thus, tuberculosis is one of the most prevalent infectious diseases worldwide. Since the 1960s, however, no new anti-tuberculosis drugs have been introduced. In this context, novel anti-tuberculosis drugs and strategies are urgently needed to combat the global threat posed by Mycobacterium tuberculosis (M. tuberculosis), the primary causative agent of tuberculosis in humans.
n
Corresponding author. Tel./fax: þ 86 10 63020226. E-mail address: [email protected] (C. Xiao).
0014-2999/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ejphar.2012.08.012
Isoprenoids, a ubiquitous class of organic molecules synthesized from the five-carbon starter unit isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP), play many essential roles in M. tuberculosis metabolism. For instance, in peptidoglycan biosynthesis, the polyprenyl phosphate molecule is transferred to the key ‘‘linker unit’’ of mycobacterial arabinogalactan, lipid I, and lipid II (Eoh et al., 2007). It can also carry the activated sugars necessary for the biosynthesis of arabinogalactan, arabinomannan, and lipoarabinomannan (Wolucka et al., 1994). In addition, the side chain of menaquinone, the only lipoquinone in the electron transport chain of M. tuberculosis, is made up of polyprenyl diphosphate (Hiratsuka et al., 2008; Holsclaw et al., 2008; Mustafa et al., 2008). All evidence suggests that IPP and DMAPP may be potential targets for antimycobacterial drugs. There are two different biosynthetic pathways that produce IPP and DMAPP, the universal precursors of isoprenoids. The mevalonate pathway is found in animals, whereas the methylerythritol phosphate (MEP) pathway is found in many bacteria, parasites, some protozoa, and plants (Rohmer, 1999). Since the MEP pathway is the only source of IPP and DMAPP in M. tuberculosis and it is absent in mammalian cells (Brennan and Crick, 2007), blocking or impairing this pathway is considered to be a promising strategy for the development of antimicrobials,
46
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
antimalarials, and herbicidal agents (Rohmer, 1999). Therefore, identification of lead compounds targeting the MEP pathway by high throughput screening is direct approach to the search for new antituberculosis therapeutics. In M. tuberculosis, the MEP pathway begins with the condensation of pyruvic acid and glyceraldehyde-3-phosphate (Eoh et al., 2007), resulting in the final products IPP and its isomer, DMAPP (Eoh et al., 2007; Illarionova et al., 2006; Richard et al., 2004; Shi et al., 2007; Testa et al., 2006). This pathway is catalyzed by the eight enzymes 1deoxy-D-xylulose 5-phosphate synthase (DXS), 1-deoxy-D-xylulose-5phosphate reductoisomerase (IspC), 4-diphosphocytidyl-2-C-methylD-erythritol synthase (IspD), 4-diphosphocytidyl-2-C-methyl-D-erythritol-2-phosphate synthase (IspE), 2-C-methyl-D-erythritol 2,4cyclodiphosphate synthase (IspF), 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase (IspG), 1-hydroxy-2-methyl-2-(E)-butenyl-4diphosphate reductase (IspH), and isopentenyl diphosphate isomerase (Idi) (Eoh et al., 2009, 2007). It is reasonable to propose that the enzymes involved in MEP biosynthesis may provide novel and effective drug targets. The inhibitors of IspC, fosmidomycin and its derivatives, can effectively cure malaria (Jomaa et al., 1999). Trifluoroethanesulfonamide, a 5-iodocytosine derivative (Hirsch et al., 2007) and thiazolopyrimidine (Geist et al., 2010) have also been identified as inhibitors of IspE or IspF, respectively. IspD, another key enzyme in the MEP pathway, is capable of catalyzing the formation of 4diphosphocytidyl-2-C-methyl-D-erythritol in the presence of MEP and CTP (cytidine triphosphate) (Eoh et al., 2007). Furthermore, it has been shown that the IspD encoding gene, ispD, is essential for M. tuberculosis growth (Bernal et al., 2005). Therefore, identifying inhibitors of IspD would be an alternative and effective strategy for the development of novel antitubercular agents. In this study, a novel high-throughput screening model was successfully established. An inhibitor of IspD, domiphen bromide (DMB), was identified by this model and the inhibition was further confirmed by a high-performance liquid chromatography (HPLC)based in vitro IspD assay. Moreover, DMB was found to enhance drug sensitivity in M. smegmatis strain MC2155 by down-regulating IspD. Furthermore, drug resistance was increased by up-regulating IspD. Finally, DMB was demonstrated to provide significant antituberculosis activity in vitro for the treatment of drug-resistant M. tuberculosis.
2. Materials and methods 2.1. Bacterial strains, media, and growth conditions All chemicals used were of at least analytical grade and, unless otherwise stated, were obtained from Merck & Company, Germany. All E. coli strains were grown in LB broth or on LB-agar plates. M. smegmatis MC2155 was grown at 37 1C in 7H9 broth supplemented with 0.05% Tween-80 and ADC (5% BSA, 2% dextrose, 0.85% NaCl) or on 7H10 agar solid media supplemented with 0.05% Tween-80 and OADC (ADCþ0.003% oleic acid), as described previously (Allen, 1998). Kanamycin was always added at a concentration of 50 mg/ml for E. coli and 25 mg/ml for M. smegmatis MC2155. Growth curves were performed using quadruple cultures grown in static culture in an incubator at 37 1C in 7H9 broth containing 0.05% Tween-80 and supplemented with ADC. Tetracycline was used as an inducer. 2.2. Plasmid construction M. tuberculosis (H37Rv) genomic DNA was provided by the Beijing Research Institute for Tuberculosis Control. All PCR reagents and cloning materials, unless otherwise stated, were purchased from Takara (TaKaRa, Dalian City, Japan). The M. tuberculosis ispD gene was amplified using oligonucleotide primers designed from
sequences available in PubMed (http://www.ncbi.nlm.nih.gov). The primers used were 50 –TTCATCCATATGGTCAGGGAAGCGGGCGAAGTAGTTGCG–30 and 50 –GTCTTATCTCGAGCCCGCGCACTATAGCTTGGGC CAGC–30 , containing NdeI and XhoI restriction enzyme sites, respectively. The PCR product was cloned into the NdeI and XhoI sites of the pET28a(þ) vector and subsequently purified. Ligation mixtures were used to transform E. coli DH5a cells, creating DH5a [pET28a (þ)::MtbispD], in which the target pET28a(þ)::MtbispD plasmid was propagated. The plasmid was isolated using Omega Plasmid Miniprep kits (Omega Bio-Tek, Inc., Norcross, USA) and sequenced by Sangon Biotech Co. Ltd. (Shanghai). 2.3. Inducible ispD antisense knockdown in M. smegmatis Genomic DNA from M. smegmatis was isolated using the method of Parish and Stoker (1998). The M. smegmatis ispD gene (MSMEG_6076) was amplified using the primers 50 –GGACTAGTATGGCGACGGTTGCCGTCGT-30 and 50 –CGGGATCCTCATGCGCCG CGCGCCAGGA–30 , containing SpeI and BamHI restriction enzyme sites, respectively. In accordance with the method described by Blokpoel et al. (2005), the PCR product was cloned into the SpeI and BamHI sites of the pMind vector, generating the tetracyclineinducible pMind::MsispD antisense plasmid, which was then sequenced and electroporated into M. smegmatis MC2155. 2.4. Inducible ispD overexpression in M. smegmatis and real-time PCR The method used was similar to that used for pMind::MsispD. The H37Rv ispD gene was amplified from the pET28a(þ)::MtbispD plasmid using the primers 50 –TGCGGATCCAGTGGTCAGGGAAGCGGG CGA–30 and 50 –GATAAGCTTTCACCCGCGCACTATAGCTTG–30 , containing BamHI and HindIII restriction enzyme sites, respectively. The PCR product was cloned into the BamHI and HindIII sites of the pMV261 vector, generating the thermal-inducible pMV261::ispD plasmid, which was then sequenced and electroporated into M. smegmatis MC2155. Real-time PCR was used to detect IspD expression. Briefly, single-stranded cDNA was synthesized using a reverse transcription system kit (Promega Corporation, Madison, WI, USA,), according to the protocol supplied by the manufacturer. Real-time PCR was performed using a Corbett RG-6000 real-time (quantitative) PCR machine. The housekeeping gene 16s was used as an inner control. The forward primer of M. smegmatis IspD is 50 –AGATCCAGC GGTGTGGTGAT–30 and the reverse primer is 50 –GTGGGAGGC GTCGTTGTT–30 . The forward primer of 16s is 50 –TGGAGGGAGCCGTCGAA–30 and reverse primer is 50 –TTCCGGTACGGCTACCTTGTT–30 . The following PCR reaction mixture in a total volume of 20 ml was used: 10 ml 2 mix; 1 ng of template cDNA in 2 ml; 0.4 ml of forward primer and 0.4 ml of reverse primer; and 7.2 ml of ddH2O. Real-time PCR was performed with an initial denaturation of 3 min at 95 1C, followed by 40 cycles of 3 s at 95 1C, 20 s at 60 1C, and melting from 65 1C to 95 1C. Fluorescence detection was performed at the annealing phase and during the subsequent dissociation curve analysis to confirm the amplification of a single product. 2.5. Expression and purification of recombinant IspD Recombinant ispD was expressed and purified as previously described (Eoh et al., 2007). Briefly, transformation of E. coli BL21(DE3) pLysS (Novagen, San Diego, CA) with pET28a(þ)::MtbispD resulted in the recombinant strain BL21(DE3) pLysS [pET28a(þ):: ispD]. Protein expression was induced with 1 mM isopropyl-b-Dthiogalactopyranoside (IPTG) at 20 1C. The recombinant protein, carrying an N-terminal hexahistidine tag, was purified by Ni2þ ionaffinity chromatography using a linear gradient of 20–500 mM imidazole in washing buffer (50 mM Tris–HCl pH 7.9, 300 mM NaCl). Eluted fractions were analyzed by SDS-PAGE and visualized with
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Coomassie Brilliant Blue R-250 gel staining or by western blotting with an anti-His antibody (Abmart, Shanghai, China). Briefly, proteins were transferred electrically from the gel onto the PVDF membrane (Millipore, Bedford, MA). The blots were blocked for 1 h with 5% low fat milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) at room temperature and incubated with anti-His antibody overnight at 4 1C. The blots were washed three times in TBST and incubated with HRP-conjugated anti-mouse IgG antibody at room temperature for 2 h. After rinsing with TBST, blots were developed using a chemiluminescence assay kit (Pierce, Rockford, IL). Fractions containing recombinant IspD protein were estimated to be at least 95% pure by Coomassie staining. They were pooled, desalted on a PD-10 column (GE), ultrafiltrated in a 10 kDa cutoff Millipore Centricon (Billerica, MA) device, and stored at 80 1C in 50 ml aliquots. Protein concentrations were estimated using the BCA protein assay kit (Pierce, Rockford, IL). 2.6. Activity and steady-state kinetic analysis of IspD The IspD activity assay was a modification of the protocol reported by Bernal et al. (2005). Briefly, IspD activity was monitored by measuring PPi release using a BMG FLUOstar Omega (BMG Labtech, UK) microplate reader. Reaction mixtures contained 50 mM Tris–HCl (pH 7.9), 20 mM sodium fluoride, 10 mM MgCl2, 1 mM dithiothreitol, 0.1 mg of purified IspD enzyme, and MEP and CTP at 500 mM, forming a final volume of 100 ml. Incubations were performed at 37 1C for 40 min. Reactions were terminated by the addition of 10 ml of b-mercaptoethanol, and the reaction mixtures were then added to 40 ml of coloration reagent prepared with 2.5% ammonium molybdate in 2.5 M H2SO4. The effect of concentration of MEP on IspD activity was measured using a constant concentration of CTP (1 mM) and varying concentrations of MEP from 1 mM to 15.63 mM through serial, two-fold dilutions. The effect of CTP was determined as for MEP. In all assays, the concentration of one of the substrates was kept constant and the other substrate was varied. The Km values were obtained by plotting the rate as a function of the concentration of the varied substrate at the same enzyme concentration. The Km and Vmax of the enzyme for different substrates was calculated by nonlinear regression analysis (Sigmaplot, San Rafael, CA). For IC50 and screening experiments, the CTP and MEP concentrations were 500 mM and 250 mM, respectively, and the DMB concentrations were 0, 6.25, 12.5, 25, 50, 100, 200, and 400 mg/ml. The Ki experiments used CTP or MEP at concentrations of 1000, 500, 250, 125, and 62.5 mg/ml, and DMB concentrations of 0, 25, 50, 100, and 200 mg/ml. Substrate curves were run in triplicate for each inhibitor concentration. 2.7. High-throughput screening model The activity of M. tuberculosis IspD was measured spectrophotometrically with a chromogenic reaction. This method was used to screen compounds in a 96-well format. The rate of CTP utilization was quantified by measuring the absorbance of blue ammonium phosphomolybdate produced, allowing for an internal control to detect interference from compounds that absorb at 590 nm. Reagents were stable in solution at 4 1C for at least 4 h. 2.8. High-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) The enzyme reaction mixture included 100 mg/ml DMB in a volume of 300 ml, with other components similar to those of the enzyme assay. A TSK-Gel Amide-80 column (250 mm 4.6 mm,
47
5 mm) was used for analyzing the mixture. The Shimadzu HPLC system (Shimadzu Corp., Kyoto, Japan) consisting of a LC-20AD pump combined with a model SIL-20AC automatic injector and a diode array detector (model SPDM20A) was used. The system was controlled with the LC Solution software from Shimadzu. The mobile phase buffer consisted of 20 mM CH3COONH4:CH3 CN¼33:67, and the flow rate for all analyses was set at 1 ml/ min at 30 1C. HPLC-MS/MS experiments were conducted on an Agilent 1200 system (Agilent Technologies, Inc., Santa Clara, CA) coupled to a QStar elite HPLC-MS/MS spectrometer with scan style negative TOF MS mode. The HPLC system was outfitted with a binary pump, an auto-sampler, and an in-line mobile phase vacuum degasser. The HPLC elution conditions were as described above. The flow rate was set to 1 ml/min at 30 1C. The retention time was 7.035 min for CDP-ME (4-diphosphocytidyl-2-C-methyl-D-erythritol) and 20.36 min for CTP. The MS/MS operating parameters for the analyte and IS were obtained and optimized using the negative ion mode. The transitions for multiple reaction monitoring were m/z 520.4-322.3 for CDP-ME and m/z 482.3-384.3 for CTP. The operational parameters of the mass spectrometer were as follows: Curtain gas (CUR)¼ 30 psi, Gas1¼50 psi, Gas2¼ 50 psi, TurboIonspray voltage (IS)¼ 4500 V, TEM¼450 1C, Collision energy (CE)¼ 25 eV, Declustering potential (DP)¼ 60 V, DP2¼ 15 V for analyte. 2.9. Determination of minimal inhibitory concentration (MIC) of DMB MIC was defined as the lowest drug concentration that prevented the growth of 99% of bacteria. Depending on the setting and requirement, MICs for DMB were determined using the 7H9 broth dilution method from 25 mg/ml to 20 ng/ml in the 96 wellplate format. M. smegmatis was grown until OD600 ¼2 and then diluted to 0.002. The strains were cultured at 42 1C for 2 days. 2.10. Sample preparation for mycolic acid analysis For thin-layer chromatography (TLC), mycolic acids were prepared with acid methanolysate in a similar manner to the assays performed by Minnikin et al. (1975). Analytical two-dimensional TLC was also performed as previously described (Minnikin et al., 1984). The results were not significantly different, and the free and bound mycolic acids were therefore separated according to the method previously described by Gande et al. (2004) and Alderwick et al. (2005). The sample for the MIDI Sherlock system was prepared as previously described (Cage, 1992). 2.11. Antitubercular activity assay The MICs of various compounds on the mycobacterial H37Rv were determined. Compound concentrations were diluted from 128.0 mg/ ml to 0.0625 mg/ml. Isoniazid (INH) and rifampin (RFP) were used as controls. Bacteria cultured without any drugs were also set. Cells were inoculated into 48-well plates with 4 10 3 mg per well. Cell count and morphology were examined one week later.
3. Results 3.1. Expression, purification, and kinetic characterization of IspD IspD in M. tuberculosis, encoded by the Rv3582c gene, is a polypeptide of 234 amino acids with a molecular mass of 26 kDa and an isoelectric point of 4.71 (Dhiman et al., 2005). The Rv3582c gene was amplified and successfully cloned into the pET28a ( þ)
48
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
vector for expression in the E. coli strain BL21(DE3) pLysS. Immobilized metal affinity chromatography with Ni2 þ -NTA agarose was used to isolate and purify His6-tagged IspD. Expression of the purified IspD protein, containing an N-terminal hexahistidine tag, was confirmed by SDS-PAGE and western blotting using an anti-His antibody (Fig. 1). The activity of IspD was tested by measuring PPi release upon addition of the substrate. The enzyme reaction finished within 30 min, at an IspD level of 38.5 pmol. The effects of the MEP and CTP concentrations on reaction rates were determined by varying the concentration of one substrate while keeping the other fixed (Fig. 2A and B). Similarly, the apparent KMEP and KCTP were m m calculated to be 92.4278.17 mM and 126.42718.25 mM, respectively. Calculated Kcat (catalytic constant) and Kcat/Km (specificity constant) values were 23 min 1 and 2.50 105 M 1 min 1 for MEP and 25 min 1 and 1.99 105 M 1 min 1 for CTP, respectively. The Enzyme Kinetics Module in SigmaPlot was used to rank various modes of enzyme inhibition. Calculated Ki values were 6.64 mM for CTP and 21.93 mM for MEP, respectively (Table 1). 3.2. Identification of an IspD inhibitor by high throughput screening Enzyme concentrations, substrate concentrations, and optimal reaction rates were determined in 100 ml reaction volumes in 96well plates, with the enzyme concentration being adjusted to provide a linear reaction rate for 40 min at 590 nm. The Z0 factor (Zhang et al., 1999) was employed to assess the suitability of the IspD enzyme reaction for a high-throughput format, and it was analyzed at the optimal enzyme (1 U), MEP (250 mM), and CTP (500 mM) concentrations. The Z0 value (Zhang et al., 1999) obtained for the IspD high-throughput screen assay was approximately 0.8, indicating an extremely robust assay. To validate the assay and to set the hit threshold, a small proprietary library of 3200 compounds was screened at a concentration of 10 mg/ml. Internal controls consisting of Z0 factor analysis, reagents for a full reaction, and reagents for a background reaction were included in each plate of the assay. The hit threshold was set at Z20% inhibition. Four compounds were
Fig. 1. Purification of recombinant M. tuberculosis IspD. Expression of the His6IspD recombinant protein purified from E. coli BL21(DE3) pLysS by Ni2 þ ionaffinity chromatography was confirmed by SDS-PAGE followed by (a) Coomassie staining of the gel and (b) western blotting with an anti-His antibody. Lane M1, molecular weight marker: 80, 60, 40, 30, 20, and 12 KDa; lane M2, molecular weight marker: 94, 62, 47, 30, 24, and 16 KDa; lane 1 and lane 2.
identified with activity against IspD that reached the hit threshold. Among these 4 compounds, DMB had at least three replicates with a percentage of inhibition Z30%. 3.3. Validation of the inhibition of IspD by DMB Recombinant IspD was sensitive to DMB, as observed through an IspD activity assay. The 50% inhibitory concentration (IC50) was calculated to be 33.0673.59 mg/ml from the data shown in Fig. 3A. In order to verify the specific inhibition of IspD, the reaction was evaluated by HPLC. The peak of CDP-ME dramatically decreased upon treatment with 100 mg/ml of DMB, concomitant with an increase in CTP (Fig. 3B). The products of the enzymatic reaction were identified by HPLC-MS (Fig. S1). The relative molecular masses of CDP-ME and CTP are 521.31 Da and 483.16 Da, respectively. The m/z values of 520.3874 [M-H] and 482.2739 [M-H] correspond to the peak retention times of approximately 7 min and 20 min, respectively. Therefore, DMB can effectively block the catalytic reaction of IspD in vitro. 3.4. Effects of DMB on the growth of M. smegmatis To investigate whether DMB has an effect on the growth of bacteria and if that effect is correlated with expression levels of IspD, M. smegmatis strains were engineered with sense or antisense expression of ispD to overexpress or knockdown IspD expression. Furthermore, the expression of IspD by real-time PCR demonstrated that mRNA of IspD in overexpression in M. smegmatis was 1.53 70.11 fold greater than that of wild-type M. smegmatis. The minimal inhibitory concentration (MIC) of DMB in the ispD-overexpressing M. smegmatis [pMV261::ispD] was 1.56 mg/ml, compared to 0.31 mg/ml in the control strain M. smegmatis [pMV261] (Fig. 4A). On the other hand, the pMind::ispD plasmid was engineered for antisense knockdown of ispD, which is a tetracycline-regulated system for manipulation of ispD gene expression according to previous reports (Blokpoel et al., 2005). In this system, the levels of ispD gene expression knockdown are tetracycline dose-dependent. The effect of DBM (0.5 mg/ ml) treatment on the growth of M. smegmatis was similar to that of IspD knockdown (Fig. 4B). However, the combination of DMB treatment with ispD knockdown (M. smegmatis [pMind::ispD] induced with the high dose of tetracycline and treated with DMB) resulted in complete inhibition of M. smegmatis growth (Fig. 4B). This synergetic effect suggests the ispD gene as a potential target for anti-tuberculosis therapy targeting M. tuberculosis. As depicted in Table 2, although DMB showed a higher MIC than that of INH or RFP in M. tuberculosis H37Rv, this newly identified compound displayed approximately the same MICs in clinical isolates of drug-resistant M. tuberculosis (MDR-TB and XDR-TB), which are resistant to both INH and RFP. These results suggest that DMB may enhance the drug sensitivity of drugresistant M. tuberculosis. The MEP pathway plays crucial roles in cell wall biosynthesis and energy production (Saito and Ogura, 1981; Sharma et al., 1996; Wolucka et al., 1994). Therefore, it is conceivable that DMB could alter the structure of the cell wall in M. smegmatis. This hypothesis was confirmed by cell wall mycolic acid TLC (Minnikin et al., 1984) and HPLC analysis (Fig. 5A). Although preliminary results showed that the whole-cell mycolic acid of M. smegmatis was not significantly altered by treatment with DMB, by separating the free and bound mycolic acid the bound mycolic acid was found to significantly decrease after treated with DMB (Fig. 5A). Whole-cell mycolic acids were analyzed with a MIDI Sherlock system HPLC experiment. The different components were identified using a calibration standard mix containing from nC40 to nC97
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
49
Fig. 2. IspD activity according to substrate concentration. (A) The relationship between enzyme activity of IspD and time of reaction. An IspD activity assay was performed to study (A) the effect of MEP concentration on IspD activity. CTP was held at 1 mM and the concentration of MEP was varied. (B) The effect of CTP concentration on IspD activity. MEP was held at 1 mM and concentrations of CTP were varied. Results are presented as means7 S.D. of three independent experiments.
Table 1 Calculated kinetic parameters for M. tuberculosis IspDa. Substrate
Km (mM)
Vmax (nmol/min)
Kcat (min 1)
Kcat/Km (M 1 min 1)
Ki (mM)
MEP CTP
92.42 78.17 126.427 18.25
0.89 7 0.08 0.97 7 0.14
23.11 7 2.04 25.28 7 3.65
2.50 105 1.99 105
Uncompetitive 21.92 7 1.94 Competitive 6.64 7 0.96
a Each reaction mix contained 0.1 mg ( 38.5 pmol) of M. tuberculosis IspD. The Km and Vmax values were calculated from data averaged from three independent experiments, using nonlinear regression analysis.
Fig. 3. Inhibition of IspD by DMB. (A) The IC50 value of DMB was determined by varying the DMB concentration from 0 to 400 mg/ml. Enzyme and substrate concentrations were as described in the Materials and Methods section. Results are presented as means7 S.D. of three independent experiments. (B) Evaluation of the enzymatic reaction by HPLC. a: the control with full reaction; b: the sample with 100 mg/ml DMB.
saturated fatty acids. The difference was primarily at mycolic acid equivalent carbon chain lengths from 64 to 89. The fraction of C81, C84, and C89 increased, and the other three decreased. These results were evaluated using the integral area of the chromatographic peak (Fig. 5B).
4. Discussion The current study details an optimized method for a highthroughput analysis system for the validation of potential IspD inhibitors and uses this system to verify DMB as a valuable
potential antituberculosis lead compound. Because the biosynthesis of IPP and DMAPP is crucial for bacterial metabolism, the MEP pathway has become a significant target for the development of new antibiotics and antimetabolites that cannot be fully exploited through currently available methods (Kuzuyama, 2002). Previous assays required special conditions or large time investments per sample. The method proposed in the current study relies on PPi released during the reaction catalyzed by IspD, providing a relatively inexpensive and rapid method for high-throughput screening that may be simply automated. High-throughput screening has only recently been employed in targeting the IspD receptor. Previous methods for assessment of
50
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Fig. 4. Effects of DMB on the growth of M. smegmatis. (A) Determination of the MICs of DMB in M. smegmatis expressing endogenous or overexpressed levels of ispD. Results are presented as means 7S.D. of three independent experiments. (B) The growth curve of M. smegmatis expressing or not expressing the antisense for ispD and treated or not treated with 0.5 mg/ml DMB. Sample I: Msmeg [pMind::ispD] treated with DMB and induced with 10 ng/ml tetracycline; Sample II: Msmeg [pMind::ispD] treated with DMB and induced with 50 ng/ml tetracycline; Control I: Msmeg [pMind] treated with DMB and induced with 10 ng/ml tetracycline; Control II: Msmeg [pMind] treated with DMB and induced with 50 ng/ml tetracycline; Control III: Msmeg [pMind::ispD] without DMB and induced with 50 ng/ml tetracycline. Results are presented as means7 S.D. of three independent experiments.
Table 2 Anti-tuberculosis activity of DMB. Bacterial strain
H37Rv MDR-TB (330) XDR-TB (926)
MIC (mg/ml) DMB
INH
RFP
8 8 16
0.032 8 16
0.125 16 32
enzymatic activity of IspD orthologs were conducted using 32Pradioactive labeled NTP (Testa et al., 2006) or thin-layer chromatography-based assays (Richard et al., 2004). Time-consuming structure-based approaches to drug design have been used to develop novel inhibitors for the IspD receptor. One such study explored the binding affinity and hydrogen bond interaction between the active site and ligand through docking studies and applied synthetic accessibility filters to screen designed molecules, producing only 15 potential molecules (Varikoti et al., 2012). Another study examined novel pyrazoline derivatives bearing benzimidazole for treatment of tuberculosis, in which a primary challenge was synthesis and verification of the newly synthesized compounds by thin layer chromatographic and elemental analysis, producing only 10 viable molecules for further in vitro testing (Shahar Yar et al., 2009). Thus, structure-based methods often require synthesis of specific molecules that necessitate expensive synthesis and characterization procedures, often producing few viable results. High-throughput assays provide increased efficiency and are more likely to result in the isolation of viable compounds. The inhibitory effect of DMB on IspD was confirmed by both the newly-established high-throughput screening system and traditional enzyme kinetic assays. Furthermore, decreasing CDPME was confirmed by HPLC-MS. In the IspD-overexpressing M. smegmatis strain, high levels of IspD overcame the growthinhibitory effects caused by DMB, consistent with DMB repression of IspD function. Moreover, the mycolic acid fraction in M.
smegmatis was altered by DMB treatment, suggesting that IPP and DMAPP impact cell wall functionality. In addition, DMB displayed a similar inhibitory activity towards M. tuberculosis H37Rv and clinical isolates of drug-resistant M. tuberculosis, including MDR-TB (330) and XDR-TB (926). Cumulatively, these findings demonstrate a novel function of DMB as an IspD inhibitor, though further study will be required to fully characterize the mechanism of DMB action. Notably, no ortholog of M. tuberculosis IspD exists in humans (Eoh et al., 2007), which suggests than minimal toxicity can be achieve in vivo through the development of therapeutics that target functions the function critical to bacillus survival that is absent in the host. Furthermore, crystallographic analysis of the enzyme’s receptor site has shown that the active site of IspD is highly conserved, suggesting that virtually any new inhibitor may potentially exhibit broadspectrum activity against tuberculosis-causing agents, such as M. tuberculosis (Bj¨orkelid et al., 2011). As drug-resistance to common treatments, such as isoniazid or rifampin, becomes an increasing issue in tuberculosis treatment, novel inhibitors of IspD, including DMB, may become important first-line treatments due to their ability to inhibit the growth of M. tuberculosis by a mechanism distinct from those observed in isoniazid and rifampin. DMB plays a novel role in inhibiting M. tuberculosis IspD and growth. DMB likely suppresses the growth of M. tuberculosis through repression of IspD activity, subsequently affecting CDP-ME levels and mycolic acid accumulation. Alternatively, DMB may suppress growth in an IspD-independent manner, indicated in the present study by complete growth inhibition of the ispD knockdown strain upon treatment with DMB. DMB is a valuable target for further development due to its role as an inhibitor of M. tuberculosis IspD, displaying an IC50 at the micromolar level; its demonstrated ability to inhibit M. tuberculosis and MDR-TB growth in vitro; and its bacillus-specific mechanism of action. Furthermore, the hypersensitivity of M. smegmatis ispD knock-downs indicates potential efficacy in resistant strains. Though further studies of the metabolic and transcript profiles are required. DMB is a promising antituberculosis lead compound. This, and other lead compounds, can be identified using the novel high-throughput method described in the current study.
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
51
Fig. 5. M. smegmatis mycolic acid analyses by TLC and HPLC. (A) Chromatogram showing: 1: free mycolic acids from untreated M. smegmatis; 2: free mycolic acids from M. smegmatis treated with 0.25 mg/ml DMB for 24 h; 3: cell wall bound mycolic acids from untreated M. smegmatis; 4: cell wall bound mycolic acids from M. smegmatis treated with 0.25 mg/ml DMB for 24 h. (B) Graph showing the mycolic acid equivalent carbon length and the areas of the corresponding peaks. Control: untreated M. smegmatis; Sample: M. smegmatis treated with 0.25 mg/ml DMB for 24 h. Data are expressed as means 7S.D. of three independent experiments.
Acknowledgments We are very grateful to Brain D. Robertson from the Imperial College London, South Kensington campus, for donation of the pMind plasmid. We would also like to thank Professors Jiandong Jiang and Bin Hong for their guiding suggestions and Professor Yuqin Zhang for assistance with mycolic acid analyses. This work was supported by funds from the Important National Science and Technology Special Projects of China during the 11th Five-Year Plan (No. 2008ZX10003006) and the National Natural Science Foundation of China (Nos. 30873186NST and 81072674NST).
Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2012.08.012.
References Alderwick, L.J., Radmacher, E., Seidel, M., Gande, R., Hitchen, P.G., Morris, H.R., Dell, A., Sahm, H., Eggeling, L., Besra, G.S., 2005. Deletion of Cg-emb in corynebacterianeae leads to a novel truncated cell wall arabinogalactan, whereas inactivation of Cg-ubiA results in an arabinan-deficient mutant with a cell wall galactan core. J. Biol. Chem. 280, 32362–32371. Allen, B.W., 1998. Mycobacteria. General culture methodology and safety considerations. Methods Mol. Biol. 101, 15–30. Bernal, C., Palacin, C., Boronat, A., Imperial, S., 2005. A colorimetric assay for the determination of 4-diphosphocytidyl-2-C-methyl-D-erythritol 4-phosphate synthase activity. Anal. Biochem. 337, 55–61. ¨ Bjorkelid, C., Bergfors, T., Henriksson, L.M., Stern, A.L., Unge, T., Mowbray, S.L., Jones, T.A., 2011. Structural and functional studies of mycobacterial IspD enzymes. Acta Crystallogr. D Biol. Crystallogr. 67 (Pt 5), 403–414. Blokpoel, M.C., Murphy, H.N., O’Toole, R., Wiles, S., Runn, E.S., Stewart, G.R., Young, D.B., Robertson, B.D., 2005. Tetracycline-inducible gene regulation in mycobacteria. Nucleic Acids Res., e22. Brennan, P.J., Crick, D.C., 2007. The cell-wall core of Mycobacterium tuberculosis in the context of drug discovery. Curr. Top. Med. Chem. 7, 475–488. Cage, G.D., 1992. High-performance liquid chromatography patterns of Mycobacterium gordonae mycolic acids. J. Clin. Microbiol. 30, 2402–2407. Das, P., Horton, R., 2010. Tuberculosis—time to accelerate progress. Lancet 375, 1755–1757. Dhiman, R.K., Schaeffer, M.L., Bailey, A.M., Testa, C.A., Scherman, H., Crick, D.C., 2005. 1-Deoxy-D-xylulose 5-phosphate reductoisomerase (IspC) from Mycobacterium tuberculosis: towards understanding mycobacterial resistance to fosmidomycin. J. Bacteriol. 187, 8395–8402. Eoh, H., Brennan, P.J., Crick, D.C., 2009. The Mycobacterium tuberculosis MEP (2Cmethyl-D-erythritol 4-phosphate) pathway as a new drug target. Tuberculosis (Edinburgh) 89, 1–11. Eoh, H., Brown, A.C., Buetow, L., Hunter, W.N., Parish, T., Kaur, D., Brennan, P.J., Crick, D.C., 2007. Characterization of the Mycobacterium tuberculosis
4-diphosphocytidyl-2-C-methyl-D-erythritol synthase: potential for drug development. J. Bacteriol. 189, 8922–8927. Gande, R., Gibson, K.J., Brown, A.K., Krumbach, K., Dover, L.G., Sahm, H., Shioyama, S., Oikawa, T., Besra, G.S., Eggeling, L., 2004. Acyl-CoA carboxylases (accD2 and accD3), together with a unique polyketide synthase (Cg-pks), are key to mycolic acid biosynthesis in Corynebacterianeae such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J. Biol. Chem. 279, 44847–44857. Gandhi, N.R., Nunn, P., Dheda, K., Schaaf, H.S., Zignol, M., van Soolingen, D., Jensen, P., Bayona, J., 2010. Multidrug-resistant and extensively drug-resistant tuberculosis: a threat to global control of tuberculosis. Lancet 375, 1830–1843. Geist, J.G., Lauw, S., Illarionova, V., Illarionov, B., Fischer, M., Grawert, T., Rohdich, F., Eisenreich, W., Kaiser, J., Groll, M., Scheurer, C., Wittlin, S., Alonso-Gomez, J.L., Schweizer, W.B., Bacher, A., Diederich, F., 2010. Thiazolopyrimidine inhibitors of 2-methylerythritol 2,4-cyclodiphosphate synthase (IspF) from Mycobacterium tuberculosis and Plasmodium falciparum. ChemMedChem. Hiratsuka, T., Furihata, K., Ishikawa, J., Yamashita, H., Itoh, N., Seto, H., Dairi, T., 2008. An alternative menaquinone biosynthetic pathway operating in microorganisms. Science 321, 1670–1673. Hirsch, A.K., Lauw, S., Gersbach, P., Schweizer, W.B., Rohdich, F., Eisenreich, W., Bacher, A., Diederich, F., 2007. Nonphosphate inhibitors of IspE protein, a kinase in the non-mevalonate pathway for isoprenoid biosynthesis and a potential target for antimalarial therapy. ChemMedChem 2, 806–810. Holsclaw, C.M., Sogi, K.M., Gilmore, S.A., Schelle, M.W., Leavell, M.D., Bertozzi, C.R., Leary, J.A., 2008. Structural characterization of a novel sulfated menaquinone produced by stf3 from Mycobacterium tuberculosis. ACS Chem. Biol. 3, 619–624. Illarionova, V., Kaiser, J., Ostrozhenkova, E., Bacher, A., Fischer, M., Eisenreich, W., Rohdich, F., 2006. Nonmevalonate terpene biosynthesis enzymes as antiinfective drug targets: substrate synthesis and high-throughput screening methods. J. Org. Chem. 71, 8824–8834. Jomaa, H., Wiesner, J., Sanderbrand, S., Altincicek, B., Weidemeyer, C., Hintz, M., Turbachova, I., Eberl, M., Zeidler, J., Lichtenthaler, H.K., Soldati, D., Beck, E., 1999. Inhibitors of the nonmevalonate pathway of isoprenoid biosynthesis as antimalarial drugs. Science 285, 1573–1576. Kuzuyama, T., 2002. Mevalonate and nonmevalonate pathways for the biosynthesis of isoprene units. Biosci. Biotechnol. Biochem. 66, 1619–1627. Minnikin, D.E., Alshamaony, L., Goodfellow, M., 1975. Differentiation of Mycobacterium, Nocardia, and related taxa by thin-layer chromatographic analysis of whole-organism methanolysates. J. Gen. Microbiol. 88, 200–204. Minnikin, D.E., Minnikin, S.M., Hutchinson, I.G., Goodfellow, M., Grange, J.M., 1984. Mycolic acid patterns of representative strains of Mycobacterium fortuitum, ‘Myobacterium peregrinum’ and Mycobacterium smegmatis. J. Gen. Microbiol. 130, 363–367. Mustafa, G., Migita, C.T., Ishikawa, Y., Kobayashi, K., Tagawa, S., Yamada, M., 2008. Menaquinone as well as ubiquinone as a bound quinone crucial for catalytic activity and intramolecular electron transfer in Escherichia coli membranebound glucose dehydrogenase. J. Biol. Chem. 283, 28169–28175. Parish, T., Stoker, N.G., 1998. Mycobacteria. Bugs and bugbears. Methods Mol Biol. 101, 1–13. Richard, S.B., Lillo, A.M., Tetzlaff, C.N., Bowman, M.E., Noel, J.P., Cane, D.E., 2004. Kinetic analysis of Escherichia coli 2-C-methyl-D-erythritol-4-phosphate cytidyltransferase, wild type and mutants, reveals roles of active site amino acids. Biochemistry 43, 12189–12197. Rohmer, M., 1999. The discovery of a mevalonate-independent pathway for isoprenoid biosynthesis in bacteria, algae and higher plants. Nat. Prod. Rep. 16, 565–574. Rysavy, M., Pavelka, T., Khayarin, M., Dzupa, V., 2010. Iliosacral screw fixation of the unstable pelvic ring injuries. Acta Chir. Orthop. Traumatol. Cech. 77, 209–214.
52
P. Gao et al. / European Journal of Pharmacology 694 (2012) 45–52
Saito, Y., Ogura, K., 1981. Biosynthesis of menaquinones. Enzymatic prenylation of 1,4-dihydroxy-2-naphthoate by Micrococcus luteus membrane fractions. J. Biochem. 89, 1445–1452. Yar, M.S., Abdullah, M.M., Majeed, J., 2009. In vitro anti-tubercular screening of newly synthesized benzimidazole derivatives. World Acad. Sci. Eng. Technol. 55, 593–599. Sharma, V., Hudspeth, M.E., Meganathan, R., 1996. Menaquinone (vitamin K2) biosynthesis: localization and characterization of the menE gene from Escherichia coli. Gene 168, 43–48. Shi, W., Feng, J., Zhang, M., Lai, X., Xu, S., Zhang, X., Wang, H., 2007. Biosynthesis of isoprenoids: characterization of a functionally active recombinant 2-Cmethyl-D-erythritol 4-phosphate cytidyltransferase (IspD) from Mycobacterium tuberculosis H37Rv. J. Biochem. Mol. Biol. 40, 911–920. Testa, C.A., Lherbet, C., Pojer, F., Noel, J.P., Poulter, C.D., 2006. Cloning and expression of IspDF from Mesorhizobium loti. Characterization of a
bifunctional protein that catalyzes non-consecutive steps in the methylerythritol phosphate pathway. Biochim. Biophys. Acta 1764, 85–96. Varikoti, R.A., Gangwal, R., Dhoke, G., Ramaswamy, V.K., Sangamwar, A., 2012. Structure based de novo design of IspD inhibitors as anti-tubercular agents. Available from Nature Precedings http://dx.doi.org/10.1038/npre. 2012.7088.1. Wolucka, B.A., McNeil, M.R., de Hoffmann, E., Chojnacki, T., Brennan, P.J., 1994. Recognition of the lipid intermediate for arabinogalactan/arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. J. Biol. Chem. 269, 23328–23335. Zhang, J.H., Chung, T.D., Oldenburg, K.R., 1999. A Simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, 67–73.