Identification, expression analysis, and antibacterial activity of NK-lysin from common carp Cyprinus carpio

Fish and Shellfish Immunology 73 (2018) 11–21

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification, expression analysis, and antibacterial activity of NK-lysin from common carp Cyprinus carpio

T

Gai Ling Wanga, Ming Cheng Wanga, Ying Li Liub, Qian Zhangb, Chuan Feng Lia, Pan Ting Liua, En Zhong Lia, Pin Nieb,c, Hai Xia Xieb,c,∗ a

College of Biological and Food Engineering, Huanghuai University, Zhumadian 463000, Henan, China State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China c Key Laboratory of Aquaculture Disease Control, Ministry of Agriculture, Wuhan, Hubei Province, 430072, China b

A R T I C L E I N F O

A B S T R A C T

Keywords: NK-lysin Transcription analysis Protein purification Antibacterial activity Cyprinus carpio

Natural killer lysin (NK-lysin), produced by cytotoxic T lymphocytes and natural killer cells, is a cationic antimicrobial peptide that has a broad antimicrobial spectrum, including bacteria, viruses, and parasites. Nevertheless, the implication of NK-lysin in the protection against bacterial infection is not aware in common carp. In this study, six different NK-lysin genes (nkl1, nkl2, nkl3, nkl4, nkl5 and nkl6) were identified in the common carp genome. Each of the mature peptides of common carp NK-lysin has six well-conserved cysteine residues, and shares a Saposin B domain, characteristic of saposin-like protein (SALIP) family. The gene nkl1 contains 5 extrons and 4 introns, and nkl2, nkl3, nkl4 or nkl5 contains 4 extrons and 3 introns, however, the nkl6 has 3 extrons and 2 introns. By quantitative real-time PCR, nkl2 transcripts were predominantly expressed in spleen of healthy common carp, while elevated mainly in gill and spleen upon Aeromonas hydrophila infection. The recombinant NK-lysin-2 purified from Pichia pastoris shows antibacterial activity against Staphylococcus aureus (Gram-positive), and Escherichia coli M15, Aeromonas hydrophila, as well as Edwardsiella tarda (Gramnegative), the latter two are important pathogens of aquaculture. Our results indicate that NK-lysin in common carp might play an important role in fish immune response by enhancing antibacterial defense against bacterial pathogens.

1. Introduction As a diverse group of small cationic peptides, antimicrobial peptides (AMPs) are important components of the first line of host defense against infection. Three major groups of AMPs, namely cathelicidins, defensins and NK-lysin are present in vertebrates [1]. NK-lysin, produced by cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells [2,3], is a member of the saposin-like protein (SALIP) family, and is orthologous with human granulysin with an α-helical structure [1,4]. Different from classical antimicrobial peptides that are generally composed of 12–50 aa, NK-lysins are much larger with 78 amino acids [1,5]. The primary sequences of the NK-lysin genes are rich in positively charged amino acids and the disulfide bond-forming cysteines [5]. Six cysteines in NK-lysin help to form three intramolecular disulfide bridges (C1-C6, C2-C5, C3-C4) and five amphipathic α-helices fold into a single globular domain with a hydrophilic surface [6]. The cationic and hydrophobic composition of NK-lysin makes them potent killers of microbial targets with cytoplasmic membranes rich in anionic

∗

phospholipids, however, they are selectively safe to host cells with neutral charged membranes [7]. In detail, NK-lysin renders lipid bilayers of microbial targets permeable in a nonspecific manner by forming pores in the cell membrane through its helical structure. NK-lysin plays a critical role in innate immunity against not only bacteria, but also other infectious pathogens, such as parasites and virus through its selective membrane disruptive property [8–14]. The core αhelical region of NK-lysin is responsible for its biological activity. NK-2, the core region of mammalian NK-lysin (residues 39 to 65), displays lytic activity against parasites such as Trypanosoma cruzi and Eimeria spp [11,12]. NKLP27, the core region of NK-lysin from the fish, halfsmooth tongue sole (Cynoglossus semilaevis), can degrade bacterial DNA and inhibit bacterial and viral infection [13]. NK-18 is a truncated peptide derived from core region of mammalian NK-lysin, its targeting at both the bacterial membrane and the DNA in the cytoplasm, indicates its therapeutic application in defending against multidrug-resistant bacteria [14]. With the emergence of antibiotic-resistant bacteria, and the scarcity

Corresponding author. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China. E-mail address: [email protected] (H.X. Xie).

https://doi.org/10.1016/j.fsi.2017.11.030 Received 21 July 2017; Received in revised form 4 October 2017; Accepted 6 November 2017 Available online 21 November 2017 1050-4648/ © 2017 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Table 1 Oligonucleotides used in this study. Primer

Primer application

Primer sequence (5′–3′)

Nkl1

ORF confirmation

Nkl2

cDNA fragment of partial NK-lysin

Nkl3

ORF confirmation

Nkl4

ORF confirmation

Nkl5

ORF confirmation

Nkl6

ORF confirmation

Nkl2-5′RACE1 Nkl2-5′RACE2 Nkl2-3′RACE1 Nkl2-3′RACE2 gNkl2

5′ RACE first nested PCR 5′ RACE second nested PCR 3′ RACE first nested PCR 3′ RACE second nested PCR genomic amplification

ExNkl2

Expression in P. pastoris

RTNkl2

Real-time PCR

Cc40S

Internal control

UPM

5′ and 3′ RACE adaptor primers

NUP

5′ and 3′ RACE nested adaptor primer

ATGCTCCGCAATATCTTTCTTG TCAGAAATTGTCATGAGCTTGA TGTGCTGGGSKTGCAAGTG ATCKGTRGTGGARAGYTCYTC ATGCTGCAGAGTATCATCCTTAT TTAACTCCACACCCATTTCTTG ATGCTGTGGAAAATCATCCTG TCACTTGCAAATACCAATGT ATGCTGCGGAGTATCATCCT TTAACAAATACCAACATGAAC ATGGGAATGTCTCAGCACTTTG TTACTGTATAGTTTGCATGT CATCACAGACCATCCCCAGCTTCGTT TCCGGAGTGGCTCCATTGGAGAT ACAGATCTCCAATGGAGCCACTCCGG AAGCTGGGGATGGTCTGTGATGAGAT GATGCTGCGAAGAATCGTCCTGA ATAAGGTCATGAACTCCATGCCT TAGAATTCCACCACCACCACCACCACCTTCACTTGGAAATGCGC TCGCGGCCGCTTTCTTGCAAACACCAATGTTAG GTCCTGATCACCCTGCTGAT AGCACTTTCCAGGGAGTTGT CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CTAATACGACTCACTATAGGGCAAGCA GTGGTATCAACGCAGAGT (long) CTAATACGACTCACTATAGGGC (short) AAGCAGTGGTATCAACGCAGAGT

Table 2 NK-lysin genes used in this study. Scientific name

Common name

Gene name

GenBank ID of Protein

Genomic GenBank ID or reference

Sequence position in the contig

Cyprinus carpio Cyprinus carpio Cyprinus carpio Cyprinus carpio Cyprinus carpio Cyprinus carpio Danio rerio Danio rerio Danio rerio Danio rerio Larimichthys crocea Ictalurus punctatus Ictalurus punctatus Ictalurus punctatus Cynoglossus semilaevis Paralichthys olivaceus Salmo salar Homo sapiens Gallus gallus Caenorhabditis japonica Sus scrofa Equus caballus Bos taurus

Common carp Common carp Common carp Common carp Common carp Common carp Zebrafish Zebrafish Zebrafish Zebrafish Large yellow croaker Channel catfish Channel catfish Channel catfish Half-smooth tongue sole Japanese flounder Atlantic salmon Human Chicken Quail Porcine Equine Bovine

Nkl1 Nkl2 Nkl3 Nkl4 Nkl5 Nkl6 Nkla Nklb Nklc Nkld Nkl Nkl1 Nkl2 Nkl3 Nkl Nkl Nkl GNL NKL NKL NKL NKL NKL

XP_018976518 KX034213 XP_018926630 XP_018947975 XP_018947975 XP_018970060 KP100115 KP100116 KP100117 KP100118 KJ865299 AAY16122.1 ABC17994.1 ABC17995.1 AGM21637 AU260449 ACI68092 NP_006424 DQ186291 BAN78656 Q29075 AAN10122 AAP20032

LN590692.1 KY652928 LN590809.1 LN594313.1 LN590809.1 LN590710.1 BX323450.8 BX323450.8 BX323450.8 BX323450.8 NW_017609700.1 AY934593.1 DQ153189.1 DQ153190.1 [19] [17] Not analyzed M85276.1 Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed

6939986–6941009 91679–93218 541267–542965 258364–259605 525861–528538 15649622–15650145 173504–177119 165982–168789 149483–156136 123792–131862 224101–225487 Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed Not analyzed

[17], large yellow croaker (Larimichthys crocea) [18], and half-smooth tongue sole [19], 3 isotypes from channel catfish (Ictalurus punctatus) [20], 4 isotypes (nkla, nklb, nklc and nkld) from zebrafish (Danio rerio) [21]. Common carp (Cyprinus carpio L.) is an important food fish species in China and many other countries, however, its NK-lysin has not been studied so far. In this work, 6 isotypes of NK-lysin were identified (nkl1, nkl2, nkl3, nkl4, nkl5 and nkl6) from common carp genome. We focused our study on nkl2, which shares highest similarity with zebrafish nkld. We investigated the tissue distribution and expression pattern of common carp nkl2 upon bacteria (Aeromonas hydrophila) infection, and we purified the recombinant NK-lysin-2 from Pichia pastoris to analyze

of new classes of useful antibiotics in aquaculture, there is an increasing need to identify novel antimicrobial peptides from various species for the development of alternative therapeutants [15]. Unlike antibiotics, which could induce the development of resistance in microbes within a short application period and cause potential threats to public health [16], the electrostatic interaction between cationic NK-lysin and anionic target membranes reduces the development of resistance while preserving the efficacy of antimicrobial effects. Therefore, NK-lysins have been studied as alternatives to antibiotics in this study. NK-lysin has been reported in several fish species. One isotype of NK-lysin gene was reported in Japanese flounder (Paralichthys olivaceus) 12

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 1. Characterization of the common carp NK-lysin-2 gene (GenBank accession number: KX034213). A. The cDNA sequence of NK-lysin-2 and its deduced amino acid sequence. The signal peptide is shown by italic (1–17 aa). The six conserved cysteine residues are boxed. The ATTTA motifs and polyadenylation signal motif (AATAAA) are bold and underlined. Saposin B domain is shown by gray shadow. B. Alignment of NK-lysin amino acid sequences of the common carp and other teleosts. The signal peptide is shown by italic. The six highly conserved cysteines are boxed. C. Comparison of the NK-lysin gene structure in the common carp, zebrafish, channel catfish, Japanese flounder, half-smooth tongue sole, large yellow croaker and human. Exons are represented by boxes, and black areas represent the coding region of the gene. Introns are indicated by black lines connecting the boxes. Numbers above the boxes and the lines denote the length of each exon/intron in base pairs. The 5′ and 3′ UTR of zebrafish nkla, nklb, nklc, nkld and common carp nkl5 were not shown as they were not available from their GenBank sequences. D. Phylogenetic tree of NK-lysin amino acid sequences. Complete amino acid sequences were aligned by using CLUSTAL W and the tree was constructed with NJ method in MEGA 6.0. Numbers at the nodes represent the percentage of 10000 bootstrap replications.

The genomic DNA of the common carp was prepared from liver by the proteinase K method. Specific primers (gNkl2F and gNkl2R) were used to obtain the full-length genomic sequence. All primers used in this study are listed in Table 1. The PCR products purified were cloned into pMD19-T (TaKaRa) and subjected to automatic DNA sequencer (ABI Applied Biosystems Model 377). To obtain the other five NK-lysin genes, we used nkl2 nucleotide sequence as the template to search against common carp genome sequences. The open reading frames of these five NK-lysin genes were corroborated further by PCR using their specific primers, respectively (Table 1).

its in vitro antibacterial activity against common aquaculture bacterial pathogens. 2. Materials and methods 2.1. Obtaining 6 different NK-lysin genes from common carp Degenerate primers (Table 1), which were designed against a conserved region between zebrafish and Fugu EST sequences (GenBank database accession no. AY184216 and XM_003962706, respectively), were used to obtain a conserved cDNA fragment of nkl2 from the common carp. To recover the full-length cDNA sequence, RACE PCR was performed using the gene-specific (Nk2-5′ RACE1, Nk2-5′ RACE2, Nk2-3′ RACE1 and Nk2-3′ RACE2) and adaptor primers (UPM or NUP). 13

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 1. (continued)

2.3. Transcription analysis of nkl2 gene in healthy common carp

2.2. Sequence retrieval and characterization of common carp NK-lysin genes

Healthy common carp from Suya Lake (Zhumadian, Henan province, China) were kept in laboratory tanks at 25 °C ± 1 °C for at least two weeks before experimental manipulation. Prior to tissue dissection, the common carp were euthanized with tricaine methanesulfonate (MS 222, Sigma) at 100 mg/l. Brain, heart, liver, gills, head kidney, spleen, trunk kidney, intestine, skin and muscle were taken aseptically from three common carp and used for total RNA extraction with the TRIzol reagent (Invitrogen). 1.0 μg total RNA was used for cDNA synthesis with the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa). Quantitative real-time PCR was carried out in a Roche LightCycler 96 (Roche) using the SYBR Premix Ex Taq qRT-PCR Kit (TaKaRa). Melting curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The amplification scheme was: incubation for 30 s at 95 °C, followed by 40 cycles of 10 s at 95 °C, 10 s for annealing at 57 °C and 20 s at 72 °C. The expression level of common carp nkl2 was analyzed using comparative

Multiple sequence alignment between each pair of the amino acid was constructed using the ClustalW server (http://www.ebi.ac.uk/ Tools/msa/clustalo/). Sequence similarity and identity scores were calculated with software MatGat [22]. The presence of signal peptide was analyzed with the SignalP 4.1 Sever (http://www.cbs.dtu.dk/ services/SignalP/) and the presence of specific domain with SMART 4.0 (http://smart.embl-heidelberg.de/). Molecular weight and isoelectric points (pI) were predicted using the ProtParam tool on the ExPASy Proteomics Server (http://web.expasy.org/protparam/). Phylogenetic tree of NK-lysins of common carp and other species was constructed using the Neighbor-joining (N-J) method in the MEGA 6.0 software [23], with 10 000 bootstrap replicates. The intron/exon structures of NK-lyisn genes were determined by alignment of the fulllength cDNA to the genomic DNA sequence. The GenBank accession numbers of the sequences used in this section are listed in Table 2.

14

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 1. (continued)

threshold cycle method (2−ΔΔCT) with 40S ribosomal protein S11 (40S) as the control. All data shown are in terms of mRNA levels relative to that of 40S and expressed as means ± standard errors of the means (SEM).

was identified by sequencing with α-factor primer. The recombinant expression vector pPIC9K-Nkl2 was then linearized by SacI for insertion at AOX1 sites of GS115 through electroporation using a Gene Pluser Xcell™ Total System (Bio-Rad). Transformations were spread on MD plates containing 2 mg/ml G418 (Invitrogen). Three multi-copy integrants were inoculated in well-aerated flasks containing BMGY and induced with 0.5% methanol supplemented every 24 h. After 24 h and 48 h of induction, culture supernatant was collected and subjected to 15% SDS-PAGE gel to analyze the expression of recombinant NK-lysin-2 before purification with Ni-NTA affinity chromatography according to the manual of the ProBond™ Purification System (Invitrogen). The concentration of NK-lysin-2 purified was determined with the Bradford protein assay kit (Bio-Rad). To confirm the protein band purified is NK-lysin-2, protein samples purified were separated by electrophoresis using SDS-PAGE, protein bands were transferred onto PVDF membrane (Millipore, USA) and immunoblotted with mouse anti-His monoclonal antibody (1:500) and phosphatase-conjugated goat anti-rabbit IgG (Sigma, USA). The detection was performed using NBT/BCIP according to the manufacturer's instructions.

2.4. Transcription analysis of nkl2 gene upon bacterial infection A. hydrophila AH-1 grown static at 25 °C for 12 h in TSB medium were subcultured at 1:20, and 3 h later, the bacteria were harvested and washed 3 times with PBS. Each fish in the treatment group was injected intraperitoneally with 100 μl of A. hydrophila cell suspension at 5 × 108 CFU/ml or PBS (as control) into common carp (515 ± 7 g). The dose used was based on that in grass carp [24]. At 6, 12 and 24 h after post-bacterial injection, three fish in each group were euthanized before trunk kidney, spleen, head kidney, gill or intestine were sampled for total RNA isolation. Three fish injected with PBS were served as control, and they were sampled at 6 h post injection. 2.5. Expression and purification of the recombinant NK-lysin-2 in Pichia pastoris

2.6. Antibacterial activity assay of NK-lysin-2

The Pichia pastoris expression system was used for expression of recombinant NK-lysin-2 according to the manufacturer's instructions (Invitrogen). Briefly, NK-lysin-2 fragment of mature peptide was amplified with the specific primers of ExNkl2-F and ExNkl2-R and cloned into EcoR I/Not I sites of Pichia expression vector pPIC9K, in frame with the α-factor signal sequence and the 6×His tag-encoding sequence at the 5′ end. The resulting recombinant expression vector pPIC9K-Nkl2

Several Gram-negative bacteria strains, i.e. E. coli M15, A. hydrophila AH-1 and Edwardsiella tarda PPD130/91, and Gram-positive bacteria, such as Staphylococcus aureus CICC 10384 were selected to examine their tolerance to the NK-lysin-2 killing. E. coli M15 was cultured at 37 °C in Luria-Bertani broth (LB) medium. S. aureus was cultured at 15

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 1. (continued) Table 3 The similarity and identity of NK-lysin genes between common carp and other vertebrates. 1 1. C. carpio Nkl1 2. C. carpio Nkl2 3. C. carpio Nkl3 4. C. carpio Nkl4 5. C. carpio Nkl5 6. C. carpio Nkl6 7. D. rerio Nkla 8. D. rerio Nklb 9. D. rerio Nklc 10. D. rerio Nkld 11. P. olivaceus Nkl 12. C. semilaevis Nkl 13. S. salar Nkl 14. I. punctatus Nkl1 15. I. punctatus Nkl2 16. I. punctatus Nkl3 17. L. crocea Nkl 18. S. scrofa NKL 19. G. gallus NKL 20. E. caballus NKL 21. C. japonica NKL 22. B. taurus NKL 23. H. sapiens GNL

55.3 58.2 51.1 48.2 46.1 72.2 78.0 51.8 50.4 51.7 46.8 52.5 59.6 51.1 60.3 50.0 46.9 43.3 40.0 42.6 47.3 40.0

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

36.9

36.2 73.0

33.3 75.4 69.0

31.2 64.8 56.3 71.9

25.9 24.0 28.5 26.0 20.9

56.3 37.5 36.1 36.8 31.9 21.5

63.1 35.5 36.2 36.9 31.9 22.7 70.8

32.6 59.8 53.2 62.3 60.8 25.0 31.3 31.2

33.8 68.9 64.3 72.1 61.5 25.0 34.7 33.3 66.9

27.9 35.3 34.7 37.3 34.2 23.0 34.2 29.6 32.9 37.6

24.5 33.3 35.8 39.9 36.8 22.2 29.7 33.8 33.8 40.1 56.5

29.8 37.9 37.7 39.2 34.1 24.4 29.9 34.0 36.2 41.9 44.2 46.7

36.2 42.1 41.8 45.0 39.7 20.0 30.3 36.2 38.6 39.3 32.9 37.1 32.9

32.9 41.2 41.2 45.5 43.4 18.1 28.6 33.6 41.1 41.2 30.3 35.7 30.9 79.3

41.7 37.3 37.3 38.0 34.0 22.7 36.1 40.7 36.2 34.0 26.8 36.9 30.8 52.7 45.3

29.6 33.8 33.8 36.7 30.4 22.3 34.0 33.8 28.7 32.9 61.7 53.4 45.9 35.8 31.6 34.0

22.8 20.7 20.0 22.8 19.3 18.4 16.1 15.2 21.2 17.9 19.0 21.6 24.3 23.8 24.3 20.4 22.6

23.9 23.6 22.9 23.2 21.4 21.8 21.7 24.1 20.7 20.7 19.6 19.1 25.7 28.3 26.0 24.4 20.1 24.0

19.0 20.0 17.9 19.3 17.9 20.1 14.9 15.2 19.3 21.4 19.0 19.1 24.3 25.8 25.9 22.8 23.6 67.6 26.7

21.0 26.3 24.6 23.9 23.4 18.1 19.0 19.4 24.1 22.0 20.4 16.8 22.8 23.8 23.8 22.9 20.4 23.5 72.1 25.0

23.4 19.9 23.3 22.6 21.9 19.0 21.1 21.5 19.9 21.9 17.0 19.1 25.0 23.5 22.6 22.3 24.4 63.7 24.0 56.8 24.2

17.2 19 21.2 21.1 19.2 18.9 13.9 18.5 21.9 21.1 16.5 20.6 18 23 19.7 19.6 18.2 43.8 27.2 43.2 24.3 38.8

83.3 84.4 78.7 43.4 56.3 57.4 72.1 84.4 55.8 54.8 59.8 62.1 64.3 57.4 52.7 44.1 45.0 40.7 47.4 45.9 40.7

77.8 72.2 47.6 56.3 58.2 67.5 79.4 55.1 57.0 63.0 60.0 62.0 56.0 52.0 44.8 45.0 40.7 44.5 48.6 43.4

82.6 44.6 54.2 55.3 73.6 81.8 56.5 60.7 62.2 62.9 64.3 55.3 54.7 44.1 37.1 38.6 40.9 47.3 40.7

42.5 49.3 50.4 72.5 79.3 53.1 57.0 58.3 58.6 62.8 51.8 49.3 43.4 41.4 43.4 40.9 45.9 37.9

44.4 41.1 45.4 43.8 36.7 38.5 43.3 37.9 38.0 43.3 44.6 44.8 40.0 39.3 38.0 42.5 40.7

82.6 50.7 51.4 53.1 52.1 54.2 52.8 47.9 63.2 56.1 42.8 41.0 42.1 39.6 44.5 39.3

53.2 53.2 58.5 53.9 54.6 55.3 48.9 61.0 55.4 43.4 44.0 38.6 41.8 47.3 42.8

81.0 49.0 52.6 59.1 57.1 62.8 53.9 47.3 43.4 44.3 42.8 41.6 40.4 40.7

56.5 60.0 61.4 59.3 63.6 53.2 54.7 44.1 41.4 43.4 40.9 43.2 42.8

69.4 60.5 55.1 50.3 54.4 79.7 45.6 40.8 44.2 42.2 42.9 40.8

65.9 56.4 55.6 51.8 71.6 45.5 37.1 42.8 35.0 39.0 37.9

54.3 54.3 53.9 65.5 43.4 39.3 43.4 36.5 41.8 44.8

85.7 70.9 57.4 47.6 47.9 49.0 44.3 49.3 42.8

61.7 52.0 44.8 43.6 45.5 43.1 46.6 37.9

58.1 49.0 42.6 47.6 44.0 47.3 37.2

48.6 40.5 45.3 42.6 45.3 42.6

50.3 75.9 51.7 77.4 64.1

48.3 82.9 47.3 52.4

44.8 72.6 63.4

50.0 46.9

63.0

yeast (b), or 40 μl PBS as control (c). The plates were incubated about 12 h at 25 °C or 37 °C before stained with Coomassie brilliant blue R250. Antibacterial growth inhibition assay was performed using microplate assay as described previously [26]. Briefly, overnight cultures of E. coli M15, A. hydrophila, E. tarda and S. aureus were subcultured for an additional 2–3 h to a midlogarithmic phase. The cells were centrifuged, washed with PBS (pH 7.2) and suspended in fresh culture medium to 5 × 105 CFU/ml. NK-lysin-2 purified was diluted with bacteria suspension or PBS (as control) serially in two-fold in 96 well plates. Its final concentration was 150, 75, 37.5, 18.75, 9.38, 4.69 μg/ml. The

37 °C in medium contained 0.5% peptone, 0.3% beef extract, 0.5% NaCl. The fish pathogens A. hydrophila and E. tarda were grown at 25°C in tryptic soy broth (TSB) (BD Biosciences). Antibacterial analysis was evaluated using agar disc diffusion as reported by Lehrer et al. [25]. Briefly, the bacteria mentioned above were adjusting to 0.2 absorbance unit at 600 nm. A volume of 100 μl bacteria was supplemented to 10 ml warm medium with agar, respectively, to prepare a uniform layer in a 100 mm diameter petri dish. On each petri dish, 3 evenly spaced wells were made using gel punch with 6 mm diameter. The positive control well was filled with 40 μl of 0.25 mg/ml antibiotic (a), 40 μl of 300 μg/ml NK-lysin-2 purified from 16

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 2. Expression pattern of the common carp NK-lysin-2 gene. A. Relative levels of NK-lysin-2 mRNA in various tissues of healthy common carp. B. Relative levels of NK-lysin-2 mRNA in trunk kidney, spleen, head kidney, gill or intestine after stimulation with A.hydrophila at various time points compared with the control group. In each case, the expression level of the control fish was set as 1. Data are present as mean ± SEM (N = 3), with * indicating P < 0.05, ** indicating P < 0.01.

nkl2 is 1220 bp in length, consisting of four exons and three introns. It was deposited in GenBank with the accession number KY652928, and its tracking number on common carp genome is LN798284.1:c9167993218, on scaffold 000000351. The other five NK-lysin genes (nkl1, nkl3, nkl4, nkl5 and nkl6) were obtained through searching with nkl2 sequence against common carp chromosome sequences. Unlike the zebrafish NK-lysin genes, which are in tandom on the same chromosome, the common carp NK-lysin genes were found to be on different chromosomes. The cDNA sequences of the above 5 different NK-lysin genes were corroborated by PCR and sequencing, and they each consists of 426 (nkl1), 381 (nkl3), 366 (nkl4), 363 (nkl5), 339 (nkl6) nucleotides, respectively. Each of the NK-lyisn proteins has the saposin B (SapB) domain at its C-terminal (gray shadow), and a signal peptide at its N-terminal (Italic), except the nkl6 (Fig. S1).

plates were incubated static at 25 °C or 37 °C for 10 h, and growth inhibition was measured by recording the absorbance at 600 nm using an Epoch™ microplate reader (BioTek Instruments Inc, USA). 3. Results 3.1. Sequence analysis and gene organization of the common carp NK-lysins The full length cDNA sequence of common carp nkl2 was achieved through the RACE and submitted to NCBI under GenBank accession number KX034213. It consists of 1429 bp, containing a 61 bp 5′-UTR, an open reading frame (ORF) of 369 bp, and a 999 bp 3′-UTR (Fig. 1A). A polyadenylation signal sequence, AATAAA, is located 5 bp upstream of poly-A. The ORF encodes a protein of 122 amino acids, which possesses an N-terminal signal peptide sequence (residues 1–17) and a surfactant-associated protein B (Saposin B) domain (residues 46–120). The corresponding molecular weight and isoelectric points (pI) of mature protein were 11.9 kDa and 5.48, respectively. The common carp NK-lysin-2 has six cysteine residues (C48, C51, C79, C89, C114, and C120), and as consequence, three disulfide bonds were predicted to be formed. The genomic DNA sequence of ORF region of the common carp

3.2. Homology, gene structure and phylogenetic analysis on NK-lysin genes Six conserved cysteine residues were identified from each of common carp NK-lysins through multiple alignments with other vertebrate NK-lysins (Fig. 1B). With regard to the identity/similarity 17

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 3. Expression and purification of the recombinant common carp NK-lysin-2 from yeast. A. Expression assay and confirmation of common carp NK-lysin-2 expressed. SDS-PAGE and immunoblotting with anti-His monoclonal antibody on supernatants of P. pastoris (GS115) expressing common carp NK-lysin-2 inducing with methanol. B. Purified recombinant NK-lysin-2 from P. pastoris.

3.3. The transcription assay on nkl2 gene from common carp, healthy or challenged

matrix (Table 3), Nkl2 and Nkl4 showed the highest scores among the common carp NK-lysins (75.4%/84.4%), whereas Nkl2 and Nkl3, Nkl4 and Nkl5 reflected also high values (73.0%/83.3%, 69.0%/82.6%). Nkl6 showed the lowest scores with other common carp NK-lysins (identity: 20.9%–28.5%, similarity: 42.5%–47.6%). When the common carp proteins are compared with zebrafish NK-lysins, Nkl2–5 showed the higher scores with zebrafish Nklc and Nkld, in which, Nkl2 were found to be more homologous to zebrafish Nkld (68.9%/84.4%) and Nklc (59.8%/72.1%). Nkl1 was more related to Nklb (78.0%/63.1%) and Nkla (72.2%/56.3%). Moreover, Nkl1–5 also shares about 46.8%–64.3% similarities with other fish NK-lysins, for example, Japanese flounder, half-smooth tongue sole, Atlantic salmon, channel catfish, and large yellow croaker. A schematic gene structure of NK-lysins from six teleosts (common carp, zebrafish, Japanese flounder, channel catfish, half-smooth tongue sole and large yellow croaker) and human were shown in Fig. 1C. According to the gene structure, the NK-lysin genes could be divided into three groups, the first group of NK-lysin gene contains five exons and four introns, such as common carp nkl1, zebrafish nkla and nklb, Japanese flounder nkl, channel catfish nkl1–3, half-smooth tongue sole nkl, large yellow croaker nkl, and human NKG5; the second group of NK-lysin gene contains four exons and three introns, including common carp nkl2–5 and zebrafish nklc and nkld; the third group of NK-lysin gene contains three exons and two introns, only common carp nkl6 belongs to this group (Fig. 1D). The lengths of introns in all NK-lyisns varied considerably among fish and human. Phylogenetic tree based on full-length amino acid sequences revealed that the common carp NK-lysins cluster with other fish NK-lysins, and separate from the other vertebrates, such as mammals or birds. Concerning to common carp NK-lysins, Nkl2–5 grouped together with Danio rerio Nklc and Nkld, Nkl1 grouped with Danio rerio Nkla and Nklb and the other fish NK-lysins analyzed in this study, however, Nkl6 formed a separated cluster (Fig. 1D).

Tissues of healthy common carp were examined for nkl2 expression by RT-PCR. nkl2 mRNA was mainly detected in spleen, head kidney, gill, heart, slightly detected in trunk kidney, brain, and intestine, and was almost not detected in skin, liver, or muscle (Fig. 2A). To learn whether nkl2 transcription level changes in common carp with bacterial infection, RT-PCR was conducted on RNA isolated from trunk kidney, spleen, head kidney, gill or intestine of common carp at 6 h, 12 h, and 24 h post A. hydrophila infection. The results were normalized with control group injected with PBS. We found out that the mRNA of nkl2 in common carp was up-regulated significantly in gill or spleen upon infection. At 6 h post infection, the nkl2 transcription was slightly upregulated in gill (1.7-fold) or spleen (1.6-fold), and reached the maximum at 12 h post infection. At 24 h post infection, the nkl2 transcription decreased in spleen, whereas maintained in gill (3.6-fold). In trunk kidney and intestine, the nkl2 expression showed a down-regulation at 6 h while moderately up-regulated at 12 h and 24 h. However, the transcription of nkl2 in head kidney was not induced upon infection.

3.4. Purification of the recombinant NK-lysin-2 of common carp from yeast The codon-optimized NK-lysin-2 sequence without signal peptide was cloned into the yeast P. pastoris expression vector pPIC9K. The six His tag was fused at the N-terminus of NK-lysin-2 gene. The recombinant NK-lysin-2 protein with a molecular weight of ∼21 kDa was detected by SDS-PAGE gel and immunoblotting against His tag at 24 h or 48 h post induction with methanol (Fig. 3A). This size is larger than the predicted molecular weight ∼13 kDa (mature NK-lysin-2 of common carp [105 aa] plus 6 His tag). This is probably due to glycosylation modification on NK-lysin at 4 sites of Asn in yeast, which results in the increase of molecular weight by 4–8 kDa. The ProteinPure Ni-NTA resin was used to capture the soluble NK-lysin-2 through the 18

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

Fig. 4. Antimicrobial activities of common carp recombinant NK-lysin-2 against Gram-negative bacteria, Escherichia coli M15, Aeromonas hydrophila and Edwardsiella tarda, and Gram-positive bacteria Staphylococcus aureus. A. Antimicrobial activities revealed by inhibitory zone evaluation. a. ampicillin for Staphylococcus aureus and Escherichia coli M15, kanamycin for Edwardsiella tarda, and norfloxacin for Aeromonas hydrophila; b. recombinant NK-lysin-2; c. PBS control. B. Antimicrobial activities revealed by bacteria viability when treated with different concentrations (μg/ml) of recombinant NK-lysin-2. Each bar represents the means ± SEM value (N = 4).

19

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

BL21 (DE3) or introducing pQE-nkl2 into E. coli M15. On some occasions, we observed that the recombinant NK-lysin-2 was in inclusion bodies, which are inactive in bacteria killing. On the other occasions, E. coli BL21 (DE3) or M15 suspension becomes clear upon induction on NK-lysin-2 expression (data not shown), it is probable that they were killed by the active recombinant NK-lysin-2. We therefore tried the P. pastoris system. The NK-lysin-2 purified exhibits strong antimicrobial activity against both Gram-negative and Gram-positive bacteria. The synthesized NK-lysin peptide of Japanese flounder, showed antimicrobial activity against E. coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Photobacterium damselae subsp. piscicida, but not A. hydrophila [17]. The recombinant NK-lysin-2 purified from yeast could effectively inhibit the propagation A. hydrophila, E. tarda, S. aureus, and E. coli strains, suggesting that the probable modification on NK-lysin-2 in yeast might enable its robust killing. More importantly, E. tarda and A. hydrophila are both common aquaculture pathogens, suggesting the therapeutic application of common carp NK-lysin-2 in aquaculture. This study has demonstrated that the common carp NK-lysin-2 is a new candidate to effectively resist the infection of various bacterial pathogens. It remains to investigate the function of nkl1 and nkl6, which are quite different from nkl2 in tandem of extron and intron. In zebrafish, nkla and nkld were significantly up-regulated after viral infection, indicating a functional diversification of the zebrafish NK-lysins [21]. We hence speculated that nkl1 or nkl6 might respond to different stimulation, this awaits further study in near future.

His tag (Fig. 3B). From the culture supernatants, NK-lysin-2 was purified at a final concentration of 300 μg/ml, with a purity of about 80%. 3.5. Antibacterial activity of recombinant NK-lysin-2 To examine the antibacterial property of recombinant NK-lysin-2, three Gram-negative and one Gram-positive bacteria strains were subjected to NK-lysin-2 treatment. As shown in Fig. 4A, the recombinant NK-lysin-2 exhibited inhibitory activity against each of A. hydrophila, S. aureus, E. coli M15 and E. tarda (b). PBS treatment was used as a negative control (c). Antibiotics (a) were included as positive control. Ampicillin was included to indicate the inhibitory on S. aureus and E. coli M15, kanamycin for E. tarda, and norfloxacin for A. hydrophila. These three antibiotics were selected according to their bacterial sensitivity. Next, the serially diluted recombinant NK-lysin-2 was incubated with A. hydrophila, E. tarda, E. coli M15 or S. aureus to valuate their inhibitory activity. Of the four strains examined, NK-lysin-2 is the most active against A. hydrophila, moderate active against E. tarda, S. aureus and E. coli M15 (Fig. 4B). However, no more than 22% bacteria survived in the presence of 150 μg/ml NK-lysin-2 for all strains tested. 4. Discussion NK-lysin is a member of the saposin-like protein family, and can bind membrane to alter the membrane integrity [27]. In the present study, 6 NK-lysin genes from common carp were identified. The nkl2 gene is predominantly expressed in spleen in healthy fish, while elevated mainly in gill and spleen upon A. hydrophila infection. Importantly, the recombinant NK-lysin-2 shows antibacterial activity against important pathogens in aquaculture. In healthy common carp, nkl2 was mainly detected in spleen, head kidney and gill (Fig. 2A). This is similar with the observation in Japanese flounder, channel catfish or large yellow croaker, whose NK-lysins were also primarily expressed in gill, head kidney and spleen [5,17,18]. The common carp nkl2 shares 72.1% similarity with zebrafish nklc, and both of them were mainly transcribed in spleen [21] (Please see Fig. 2A and Table 3). For porcine, NK-lysin transcription was also mainly found in spleen, bone marrow, colon, and small intestine [2,28], the tissues which harbor lymphocyte populations, consistent with its function in NK cells and cytotoxic T lymphocytes. Like human NK and T cells, which have direct bactericidal activities, fish B cells possess potent innate immune activities like macrophages and also possess potent direct bactericidal activities [29–31]. It is worth noting that B lymphocytes constitute 55% of all lymphocytes in spleen in trout [31]. This may very well explain the high transcription of NK-lysin in spleen in fish. Most antimicrobial peptides are constitutively expressed in various tissues, where their expression can also be induced during infection, with their expression activating more complex immune responses in addition to their direct antimicrobial activities [32]. The invasion of bacteria or virus upregulates NK-lysin in half-smooth tongue sole, and stimulates interleukin-1 and chemokines, which leads to enhanced antimicrobial defense [19]. The particularly high expression level of nkl2 in gill upon A. hydrophila infection is notable in common carp, as the gill is a primary site of pathogen entry in fish as well as the focus of powerful host defense [33]. IgT is the main immunoglobulin in gill involved in pathogen-specific immune responses following pathogen exposure [31], IgT + B cells proliferate and generate pathogen-specific IgT within the fish gill [29], thus explaining dramatically increased NKlysin transcription upon bacterial infection in gill. In gill, trunk kidney and spleen, the transcription of nkl2 is triggered upon bacterial infection, which is very similar with the case in large yellow croaker induced by Cryptocaryon irritans infection [18], indicating a non-specific response of NK-lysin against bacteria or parasite invasion. To investigate the antibacterial activity, the common carp NK-lysin2 was over-expressed in E. coli system by introducing pGEX-nkl2 into

Acknowledgment We are grateful to Bei Huang at the Jimei University for his help in searching for homolog of NK-lysin gene from the database of common carp genome. This study was financially supported by the National Natural Science Foundation of China (31402334 and 31572659), and Basic and Frontier Technology Research Program of Henan Province (142300410111). Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.fsi.2017.11.030. References [1] M.O. Lee, E.H. Kim, H.J. Jang, M.N. Park, H.J. Woo, J.Y. Han, J.E. Womack, Effects of a single nucleotide polymorphism in the chicken NK-lysin gene on antimicrobial activity and cytotoxicity of cancer cells, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 12087–12092. [2] M. Andersson, H. Gunne, B. Agerberth, A. Boman, T. Bergman, R. Sillard, H. Jörnvall, V. Mutt, B. Olsson, H. Wigzell, Å. Dagerlind, H.G. Boman, G.H. Gudmundsson, NK-lysin, a novel effector peptide of cytotoxic T and NK cells. Structure and cDNA cloning of the porcine form, induction by interleukin 2, antibacterial and antitumour activity, EMBO J. 14 (1995) 1615–1625. [3] M. Andersson, H. Gunne, B. Agerberth, A. Boman, T. Bergman, B. Olsson, A. Dagerlind, H. Wigzell, H.G. Boman, G.H. Gudmundsson, NK-lysin, structure and function of a novel effector molecule of porcine T and NK cells, Vet. Immunol. Immunopathol. 54 (1996) 123–126. [4] G. Zhang, C.R. Ross, F. Blecha, Porcine antimicrobial peptides: new prospects for ancient molecules of host defense, Vet. Res. 31 (2000) 277–296. [5] Q. Wang, B. Bao, Y. Wang, E. Peatman, Z. Liu, Characterization of a NK-lysin antimicrobial peptide gene from channel catfish, Fish. Shellfish Immunol. 20 (2006) 419–426. [6] E. Liepinsh, M. Andersson, J.M. Ruysschaer, G. Otting, Saposin fold revealed by the NMR structure of NK-lysin, Nat. Struct. Biol. 4 (1997) 793–795. [7] J. Banković, J. Andrä, N. Todorović, A. Podolski-Renić, Z. Milošević, D. Miljković, J. Krause, S. Ruždijić, N. Tanić, M. Pešić, The elimination of P-glycoprotein overexpressing cancer cells by antimicrobial cationic peptide NK-2: the unique way of multi-drug resistance modulation, Exp. Cell. Res. 319 (2013) 1013–1027. [8] C.M. Linde, S. Grundstrom, E. Nordling, E. Refai, P.J. Brennan, M. Andersson, Conserved structure and function in the granulysin and NK-lysin peptide family, Infect. Immun. 73 (10) (2005) 6332–6339. [9] M.O. Lee, H.J. Jang, D. Rengaraj, S.Y. Yang, J.Y. Han, S.J. Lamont, J.E. Womack, Tissue expression and antibacterial activity of host defense peptides in chicken, BMC Vet. Res. 12 (2016) 231. [10] J. Chen, J. Huddleston, R.M. Buckley, M. Malig, S.D. Lawhon, L.C. Skow, M.O. Lee,

20

Fish and Shellfish Immunology 73 (2018) 11–21

G.L. Wang et al.

[11]

[12] [13]

[14]

[15] [16] [17]

[18]

[19]

[20] [21]

[22]

E.E. Eichler, L. Andersson, J.E. Womack, Bovine NK-lysin: copy number variation and functional diversification, Proc. Natl. Acad. Sci. U. S. A. 112 (2015) E7223–E7229. T. Jacobs, H. Bruhn, I. Gaworski, B. Fleischer, M. Leippe, NK-lysin and its shortened analog NK-2 exhibit potent activities against Trypanosoma cruzi, Antimicrob. Agents Chemother. 47 (2003) 607–613. W.H. Kim, H.S. Lillehoj, W. Min, Evaluation of the immunomodulatory activity of the chicken NK-Lysin-derived peptide cNK-2, Sci. Rep. 7 (2017) 45099. M. Zhang, M.F. Li, L. Sun, NKLP27: a teleost NK-lysin peptide that modulates immune response, induces degradation of bacterial DNA, and inhibits bacterial and viral infection, PLoS One 9 (2014) e106543. J. Yan, K. Wang, W. Dang, R. Chen, J. Xie, B. Zhang, J. Song, R. Wang, Two hits are better than one: membrane-active and DNA binding-related double-action mechanism of NK-18, a novel antimicrobial peptide derived from mammalian NKlysin, Antimicrob. Agents Chemother. 57 (2013) 220–228. A. Patrzykat, S.E. Douglas, Gone gene fishing: how to catch novel marine antimicrobials, Trends Biotechnol. 21 (2003) 362–369. S.R. Norrby, C.E. Nord, R. Finch, Lack of development of new antimicrobial drugs: a potential serious threat to public health, Lancet Infect. Dis. 5 (2005) 115–119. I. Hirono, H. Kondo, T. Koyama, N.R. Arma, J.Y. Hwang, R. Nozaki, N. Midorikawa, T. Aoki, Characterization of Japanese flounder (Paralichthys olivaceus) NK-lysin, an antimicrobial peptide, Fish. Shellfish Immunol. 22 (2007) 567–575. Q.J. Zhou, J. Wang, M. Liu, Y. Qiao, W.S. Hong, Y.Q. Su, K.H. Han, Q.Z. Ke, W.Q. Zheng, Identification, expression and antibacterial activities of an antimicrobial peptide NK-lysin from a marine fish Larimichthys crocea, Fish. Shellfish Immunol. 55 (2016) 195–202. M. Zhang, H. Long, L. Sun, A NK-lysin from Cynoglossus semilaevis enhances antimicrobial defense against bacterial and viral pathogens, Fish. Shellfish Immunol. 40 (2013) 258–265. Q. Wang, Y.P. Wang, P. Xu, Z.J. Liu, NK-lysin of channel catfish: gene triplication, sequence variation, and expression analysis, Mol. Immunol. 43 (2006) 1676–1686. P. Pereiro, M. Varela, P. Diaz-Rosales, A. Romero, S. Dios, A. Figueras, B. Novoa, Zebrafish Nk-lysins: first insights about their cellular and functional diversification, Dev. Comp. Immunol. 51 (2015) 148–159. J.J. Campanella, L. Bitincka, J. Smalley, MatGat: an application that generates

[23] [24]

[25]

[26]

[27] [28]

[29]

[30]

[31]

[32] [33]

21

similarity/identity matrices using protein or DNA sequences, BMC Bioinforma. 4 (2003) 29. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725–2729. T.T. Wang, X.H. Song, G.M. Bao, L.X. Zhao, X. Yu, J. Zhao, Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus, Fish. Shellfish Immunol. 35 (2013) 1421–1432. R.I. Lehrer, M. Rosenman, S.S. Harwig, R. Jackson, P. Eisenhauer, Ultrasensitive assays for endogenous antimicrobial polypeptides, J. Immunol. Methods 137 (1991) 167–173. J.S. Bae, S.H. Shim, S.D. Hwang, M.A. Park, B.Y. Jee, C.M. An, J.O. Kim, J.W. Kim, C.I. Park, Expression analysis and biological activity of moronecidin from rock bream, Oplegnathus fasciatus, Fish. Shellfish Immunol. 40 (2014) 345–353. J.M. Ruysschaert, E. Goormaghtigh, F. Homblé, M. Andersson, E. Liepinsh, G. Otting, Lipid membrane binding of NK-lysin, FEBS Lett. 425 (1998) 341–344. V. Bonetto, M. Andersson, T. Bergman, R. Sillard, A. Norberg, V. Mutt, H. Jornvall, Spleen antibacterial peptides: high levels of PR-39 and presence of two forms of NKlysin, Cell. Mol. Life Sci. 56 (1999) 174–178. X.J. Zhang, P. Wang, N. Zhang, D.D. Chen, P. Nie, J.L. Li, Y.A. Zhang, B cell functions can be modulated by antimicrobial peptides in rainbow trout Oncorhynchus mykiss: novel insights into the innate nature of B cells in fish, Front. Immunol. 8 (2017) 388. J. Li, D.R. Barreda, Y.A. Zhang, H. Boshra, A.E. Gelman, S. Lapatra, L. Tort, J.O. Sunyer, B lymphocytes from early vertebrates have potent phagocytic and microbicidal abilities, Nat. Immunol. 7 (2006) 1116–1124. Y.A. Zhang, I. Salinas, J. Li, D. Parra, S. Bjork, Z. Xu, S.E. LaPatra, J. Bartholomew, J.O. Sunyer, IgT, a primitive immunoglobulin class specialized in mucosal immunity, Nat. Immunol. 11 (2010) 827–835. R.E. Hancock, E.F. Haney, E.E. Gill, The immunology of host defence peptides: beyond antimicrobial activity, Nat. Rev. Immunol. 16 (2016) 321–334. Z. Xu, F. Takizawa, D. Parra, D. Gómez, L. von Gersdorff Jørgensen, S.E. LaPatra, J.O. Sunyer, Mucosal immunoglobulins at respiratory surfaces mark an ancient association that predates the emergence of tetrapods, Nat. Commun. 7 (2016) 10728.