Ca exchanger isoforms in rat pancreatic B-cells

Ce//Ca/cium(1997)21(3), 18>193 0 Pearson Professional Ltd 1997

Research

Identification, expression pattern and potential activity of Na/Ca exchanger isoforms in rat pancreatic Blcells F. Van Eylenl, M. Svoboda2, A. Herchuelzl ‘Laboratory of Pharmacology Brussels, Belgium

and *Laboratory

of Biochemistry

and Nutrition,

Brussels

University

School

of Medicine,

Summary In the pancreatic B-cell, Na/Ca exchange displays a quite high capacity and participates in the control of cytosolic free Ca2+ concentration. The Na/Ca exchanger was recently cloned in various tissues. Two genes coding for two different exchangers (NCXl and NCX2) have been identified and evidence for several isoforms for NCXl shown. To characterize the isoform(s) expressed in pancreatic B-cells, a RT-PCR analysis was performed on mRNA from rat pancreatic islets, purified B-cells and insulinoma B-cells (RINm5F cells). PCR amplification did not yield the expected NCX2 DNA fragment but yielded 2 NCXl bands, corresponding to NaCa3 and NaCa7, in the three preparations. NaCa3 and NaCa7 were equally expressed in pancreatic islets and purified B-cells. In RINm5F cells, NaCa3 expression did not differ from that in islet and purified B-cells but NaCa7 was 3 times less expressed. This lower expression was accompanied by a 3 times lower Na/Ca exchange activity in RINm5F cells compared to islet cells. Our data indicate the existence of 2 NCXl isoforms but not of NCX2 in pancreatic B-cells. The difference in both the expression patterns of NCXl isoforms and the activity of Na/Ca exchange in islet cells and RINm5F cells is compatible with a difference in activity between NaCa3 and NaCa7.

In both excitable and non excitable cells, Ca2+ can be actively extruded by two different processes: the plasma membrane Ca2+-ATPase and the process of Na/Ca exchange [ l,Z]. While the Ca2+-ATPasehas a high affinity but low capacity for Ca *+, the Na/Ca exchanger has a low

Received 7 August 1996 Revised 20 November 1996 Accepted 4 December 1996 Correspondence to: Dr A. Herchuelz, Laboratoire de Pharmacodynamie de Therapeutique, Universite Libre de Bruxelles, Faculte de Medecine, Route de Lennik, 808.Bbtiment GE, E-1070 Bruxelles, Belgium Tel. +32 2 555 62 01: Fax. +32 2 555 63 70 E-mail [email protected]

affinity but high capacity for the divalent cation [ 11. The Na/Ca exchanger is an electrogenic transporter coupling Na+ and Ca*+ countertransport with a stoichiometry of 3 Na+ for 1 Ca2+ 131.In the heart, the exchanger appears to be the predominant mechanism for Ca2+extrusion, being able to restore and control basal Ca2+ level on a beat-tobeat basis 141.Alterations in the activity of the exchanger have been postulated to play a role in the determinism of physiopathological processes, such as myocardial ischemia and Alzheimer’s disease [5,6]. The Na/Ca exchanger was recently cloned in heart [i’], kidney 181, brain [9] and vascular smooth muscle [lo]. Two genes coding for two different exchangers (NCXl

et

Abbreviations reaction;

used: RT-PCR,

[Ca>+],, cytosolic

reverse-transcribed

polymerase

chain

free CaZ+ concentration

185

186

F Van Eylen, M Svoboda,

A Herchuelz

and NCX2) have been identified 1111. The coding sequences of these genes present 6 1% identity and the genes are located on human chromosomes 2 and 14, respectively [ 11,121. While NCXl appears to be widely distributed, NCX2 has been located only in the brain and the skeletal muscle [l 11. NCXl, initially cloned in the heart, has an open reading frame of 970 amino acids of which a 32-residue NH,-terminal segment corresponds to a cleaved signal peptide [713]. Hydropathy analysis suggests that the mature cardiac Na/Ca exchanger has 11 membrane-spanning segments, 5 to the left and 6 to the right of a large cytoplasmic loop [ 13,141. Several isoforms for NCXl, displaying high homology (> 90%) have been identified and called NaCal to NaCan [15,16]. The only structural diversity among the NCXl isoforms lies in a small region towards the end of the cytoplasmic loop, as a consequence of alternative splicing [ 15,161. Thus, sequence analysis of the intron-exon boundaries in this region revealed the presence of 2 ‘mutually exclusive’ exons (A and B) and four ‘cassette’ exons (C-F). In the heart, only one NCXl isoform appears to be present (NaCal), while in other tissues (e.g. kidney, brain, aorta, etc.) two or even three isoforms (eye) are expressed [16]. Up to now, the reason for the presence of two or more Na/Ca exchanger isoforms in one single tissue is unknown. Likewise, it is unknown whether the different isoforms may display differences in activity. Although the existence of a process of Na/Ca exchange in the pancreatic B-cell has been postulated for many years [ 17,181, the process was only recently characterized [19,20]. In the pancreatic B-cell, Na/Ca exchange displays a quite high capacity and participates in the control of the cytosolic free Ca2+ concentration ([Ca2+],) and hence of insulin release 119,211. However, the type(s) of Na/Ca exchanger(s) isoforms present in the B-cell remain(s) to be determined. Recently, we observed that the process of Na/Ca exchange was far less active in clonal insulin-producing RINm5F cells than in pancreatic B-cells. The aim of the present study was to identify the type of Na/Ca exchange isoforms present in RINm5F cells and pancreatic B-cells. It was also the aim of the study to see whether differences in the expression pattern of Na/Ca exchange isoforms corresponded to differences in Na/Ca exchange activities in the two cell types. Our data show that both cell types express the same two NCXl isoforms (NaCa3 and NaCa7) but in different proportions. Thus, while NaCa3 is equally expressed in the two cell preparations, the expression of NaCa7 is about 3 times lower in RINm5F cells than in islet cells. The difference in both the expression pattern of NCXl isoforms and the activity of Na/Ca exchange in islet cells and RINm5F cells is compatible with a difference in activity between NaCa3 and NaCaZ

Cell Calcium

(1997)

21(3),

185-193

MATERIALS

AND

METHODS

Cell preparations Pancreatic islets were isolated by the collagenase technique from the pancreas of fed albino rats 1221. The method used to isolate pancreatic islet cells has been described elsewhere [23]. Clonal insulin-producing RINm5F cells were grown in RPM1 medium (Gibco BRL) supplemented with 10% fetal calf serum (Gibco BRL), 2 mM L-glutamine (Gibco BRL), 100 U/ml penicillin and 100 ug/ml streptomycin (Gibco BRL). RINm5F cells were scraped and pelleted for direct RNA extraction. Purified B-cells were kindly donated by D. Pipeleers [24]. Design of polymerase chain reaction (PCR) primers For NCXl, primers were designed to anneal to conserved sequences flanking the putative splicing area. The sense primer 5’-TAAAACCATTGAAGGCACAGCCC-3’ and the antisense primer 5’-TITGCTGGTCAGTGGCTGCTTGTC-3’ correspond to nucleotides 1717-I 735 and 2044-2067, respectively, based on rat heart sequence (accession number X68191). For NCX2, the primers used were 5’CCATGAAGACTCTTCAGGTCAAG3’ (sense) and 5’AGACCACGGCGTTGACTGA-3’ (antisense), corresponding to nucleotides 1760-l 782 and 2344-2362, respectively, based on rat brain sequence (accession number UO8 14 1). The oligonucleotides were synthesized using the phosphoramidite method performed on an Applied Biosystems 394 synthesizer (Perkin Elmer). Polymerase chain reaction (PCR) Total RNA was isolated from rat pancreatic islets, RINm5F cells, purified B-cells and four other rat tissues (adipose tissue, lung, stomach and adrenal glands) using the ‘RNA nowTM’ method (Biogentex). RNA (1 ug) was reverse transcribed for 20 min at 42°C and 40 min at 37°C using the Superscript II kit (Gibco BRL), with 25 ug/ml of both oligo(dt) primer (Promega) and random primer (Promega), and triphosphate nucleosides (0.5 mM each) (Boehringer Mannheim), in the buffer supplied by the manufacturer, in a total volume of 20 ul. The medium was then diluted with 3 0 ul of 16 mM EDTA and the reaction was terminated by heating up to 99°C for 5 min. 1 ul of single strand cDNA was amplified by PCR in a volume of 20 ~1using the GoldStar DNA polymerase kit (Eurogentec) with dATP, dCTP, dGTP and dTTP (200 uM each) (Boehringer), 10 pmol of each primer and 0.5 unit of GoldStar DNA polymerase. The amplification was conducted in thermal cyclers (GeneAmp PCR system 480 and 2400; Perkin Elmer) under the following conditions : initial denaturation at 94°C for 3 min, followed by 32

0 Pearson

Professional

Lfd 1997

Na/Ca exchanger isoforms in rat pancreatic B-cells 187

cycles at 94”C, 6O”C, and 72°C (1 min each); and a final extension at 72°C for 5 min. Products were size fractionated by electrophoresis in a 1.2% agarose gel and visualized by ethidium bromide staining.

after reverse transcription. After amplification, the samples were analyzed on a 1.2% agarose gel stained with ethidium bromide and the cDNA bands were quantified by scanning densitometry. The quantitative analysis of the NCXl isoforms was realized using 1 ug of total RNA.

Cloning and sequencing of PCR products

PCR products were subcloned into the TA-cloning plasmid vector pCRI1 (Invitrogen Corp., CA, USA) according to the manufacturer’s protocol. Plasmid DNA was prepared from the recombinant colonies, identified by bluewhite color selection. DNA sequencing was performed using the dideoxy chain termination method [25] with the Sequenase version 2.0 kit (US Biochemical) and [a35S]-ATP(Amersham) on double-stranded DNA templates. Quantitative comparison of PCR products

To determine the expression of the two Na/Ca exchanger isoforms, the quantitative reverse-transcribed PCR (RTPCR) method was used. Total RNA was isolated from guanidine isothiocyanate solubilized rat cells by centrifugation on a cesium chloride gradient as described by Sambrook et al [26]. After serial dilution of RNA, the amplification products were analyzed by PCR performed

Size, b

‘%a2+ uptake

The media used to incubate the islet cells consisted in a Krebs-Ringer bicarbonate buffered solution @H 74, 37°C) with the following composition (in mM): NaCl 115, CaCl, 1, MgCl, 1, HEPES/NaOH 10. The media were gassed with ambient air. In some experiments, NaCl was iso-osmotically replaced by sucrose (241 mM, Merck, Darmstadt, Germany) and HEPES/NaOH by HEPEWKOH. The different media also contained glucose (2.8 mM, Merck) and nifedipine (5 PM, Calbiochem, La Jolla, CA, USA). The method used for the measurement of 45Ca2+ uptake in isolated pancreatic islet cells has been described previously [ 191. In brief, the islet cells were preincubated in 1 ml of a non-radioactive solution during 30 min and then incubated for 5 min in 1 ml of the same medium containing in addition 45CaZ+(10 pCi/ml). At the end of the incubation, the cells were separated from the incubation medium by using a combined lanthanum and

Size, bp

Fig. 1 Reverse-transcribed PCR amplification of NCXl in rat heart, brain, kidney, pancreatic islets, RINmSF cells and purified B-cells. (A) PCR amplification on cDNA from rat heart, brain, kidney, pancreatic islets and RINm5F cells. Specific primers designed to anneal to conserved sequences flanking the putative splicing area were used. (B) PCR amplification on cDNA from three insulin producing cell preparations including purified B-cells, using the same specific primers. The PCR products were separated by agarose gel electrophoresis and stained with ethidium bromide. Marker was 1 kb DNA ladder (sizes in bases).

0 Pearson

Professional

Ltd 7997

Cell Calcium

(1997)

21(3),

185-193

188

F Van Eylen, M Svoboda, A Herchuelz

Size, bp 4-

1018

+-

516/506

Fig. 2 Reverse-transcribed PCR amplification of NCXl in rat stomach, adipose tissue, adrenal gland and lung in comparison with purified B-cells. Same protocol as in Figure 1. The PCR products were separated by agarose gel electrophoresis and stained with ethidium bromide. Marker was 1 kb DNA ladder (sizes in bases).

oil technique [ 191. Na/Ca exchange was evaluated by measuring Na,+-dependent 45Ca uptake. After pre-incubation, the islet cells were eiposed to Na+-depleted media containing 45Ca2+. Statistics The results are expressed as means + SEM. The statistical significance of differences between data was assessed by using analysis of variance followed by a Tukey post test. RESULTS Identification of NaXa exchanger isoforms in insulin producing cells using primers designed to anneal to conserved sequences flanking the putative splicing area of NCXl, PCR amplification yielded two bands of 313 bp and 244 bp in pancreatic islets, RINm5F cells (Fig. lA,B) and purified B-cells (Fig. 1B). In brain and kidney, PCR amplification also yielded two bands while in heart only one band was found (Fig. IA). The identity of the PCR products from the insulin producing cells was determined by subcloning and sequencing at least two independent clones from distinct PCR amplifications. The same two PCR Cell Calcium

(1997)

21(3),

185-193

Fig. 3 Reverse-transcribed PCR amplification of NCX2. Specific NCX2 primers were used for the PCR amplification on cDNA from rat purified B-cells, pancreatic islets, RINmSF cells and brain. The PCR products were separated by agarose gel electrophoresis and stained with ethidium bromide. Marker was 1 kb DNA ladder (sizes in bases).

products were identified in the three preparations. Sequence comparison showed that the two sequences were identical, except for a small region of 69 nucleotides, and corresponded to two splicing variants of NCXl, namely NaCa7 and NaCa3, previously identified in kidney, aorta, intestine and thymus. The NCXl exchanger isoforms present in four other rat tissues was also examined. In each tissue, two PCR products were found (Fig. 2). Sequencing of subcloned DNA fragments demonstrated that they corresponded to NaCa7 and NaCa3 in the stomach and adrenal glands, to NaCa5 and NaCa3 in the adipose tissue and to NaCa5 and NaCa4 in the lung. To look for the existence of NCX2 exchanger in insulin producing cells, PCR amplification was performed using specific primers to brain NCX2 cDNA. NCX2 exchanger could not be found in any of the three insulin producing cell preparations (Fig. 3). In contrast, the expected band of 662 bp was found in brain, where NCX2 has been cloned and that was used as a positive control. 0 Pearson

Professional

Ltd 1997

Na/Ca exchanger isoforms in rat pancreatic B-cells 189

B-cells

A

Islet cells

B

3.0 .A, 24

26

28

30

32

34

24

26

Cycles

28

30

32

34

Cycles

RINmSF cells

3.0 A, 24

26

28

30

32

34

36

Cycles Fig. 4 Semi-logarithmic plots of the relative amplification of NaCa7 (filled circles) and NaCa3 (filled squares) isoforms at different cycles. PCR was performed on cDNA from purified B-cells (A) and pancreatic islets (B) for 25-32 cycles and from RINmSF cells (C) for 25-34 cycles. The cDNA values were determined from the fluorescence of each PCR fragment by densitometry (arbitrary units). Data are means of three determinations. SEM when not presented are smaller than symbols.

Quantitative analysis of the NCXl isoforms present in insulin producing cells

To determine the respective ratio of NaCa7 and NaCa3 isoforms in rat pancreatic islets, RINm5F cells and purified B-cells, the quantitative RT-PCR method was used. Several precautions must be taken to insure that the amount of the amplified fragment is quantitatively related to the amount of the template. Indeed, after a certain number of cycles, PCR reaches a plateau, depending on different individual factors. Therefore, the number of cycles corresponding to the exponential phase of the PCR amplification was first determined. PCR amplification was carried out using two specific primers flanking the putative splicing area of NCXl cDNA focusing on cycles 25 to 32 (or 25 to 34 in the case of the RINm5F cells). As shown in Figure 4, the linear part of the amplification process differed from one cellular type to another. The number of cycles chosen for further work was 28 for rat pancreatic islets and purified B-cells, and 29 for RINm5F cells. 0 Pearson

Professional

Ltd 1997

To verify the accuracy and the reliability of the RT-PCR method, total RNA was serially diluted as previously proposed by Golde et al [27]. Each RNA dilution from 0.2 pg to 1 pg was reverse-transcribed and amplified by PCR for the specified number of cycles. Because the amount of RNA obtained from purified B-cells was very limited, the total RNA was reverse-transcribed in the corresponding cDNA which was then serially diluted. In the case of islets and purified B-cells, the data were also expressed in proportion to the amount of B-actin mRNA present in the respective preparations. Figure 5 shows that there was an excellent and linear correlation between the amount of RNA used and the amount of corresponding cDNA obtained at the specified number of cycles (r 2 0.99). Table 1 summarizes the relative proportion of the two isoforms found in the three insulin producing cell preparations. In pancreatic islets and purified B-cells, the two isoforms were equally expressed while in RINm5F cells, NaCa3 (62%) clearly predominated over NaCa7 (38%). Finally, to compare the amount of each of the two isoforms in islet cells and RINm5F cells, the amount of Cell Calcium

(1997)

21(3),

185-

193

190

F Van Eylen, M Svoboda, A Herchuelz

B-cells

A

25000 ,

15000

.s 20000 -2

15000

0 .s

10000

% gcz

5000

Islet cells

B

1

.g 10000 se 8 .b fj

5000

I = 0.999

I/

/

0,

r = 0.998

0,

0.0

.2

.4

.6

.8

1.0 1.2

0.0

.2

Total DNA (arbitrary

.4

.6

.8

1.0 1.2

Total RNA (pg)

units)

RINmSF ceils

C

z‘Z 30000 s5. 20000 1

f

0.0

.2

.4

6

.8

1.0

1.2

Total RN A (pg) Fig. 5 Correlation plots between serial dilutions of total RNA and corresponding cDNA amplification products using RT-PCR. Total RNA from purified B-cells (A), pancreatic islets (B) and RINm5F cells (C) was serially diluted and each RNA dilution was reverse-transcribed. The NaCa7 (filled circles) and NaCa3 (filled squares) isoforms were amplified by PCR using NCXl specific primers. This figure shows the correlation (r) between the different RNA amounts and the corresponding cDNA values obtained after 28 PCR cycles in purified B-cells and islets, and 29 cycles in RINm5F cells. The cDNA values were determined from the fluorescence of each PCR fragment by densitometry (arbitrary units). Data are means of 4 or 3 determinations (purified B-cells). cDNA obtained after a 28 cycle PCR amplification was quantified. While similar amounts of NaCa3 products were observed in the two preparations (P > 0.05), the amount of NaCa7 product found in RINm5F cells only averaged 37% of that observed in islet cells (P < 0.0 1).

while basal 45Ca2+uptake measured in the presence of 139 mM Na+ did not differ between the two preparations (P> 0.05), the increase in 45CaZ+ uptake due to extracellular Na+ removal was about 3-4 times larger in islets than in RINm5F cells (P < 0.000 1).

Na/Ca exchange activity in islet and RINm5F cells

DISCUSSION

Na/Ca exchange activity was measured as intracellular Na+-dependent 45Ca2+uptake. Figure 6 shows that extracellular Na+ removal induced a far greater increase of 45Ca2+uptake in islet cells than in RINm5F cells. Thus,

The first aim of this study was to identify the Na/Ca exchanger isoforms present in insulin producing cells. Using the very sensitive PCR method, NCX2 could not be found in any of the three preparations. Because the

Table

1 Quantitative

RT-PCR Cycles

Cell types Purified B-cells Pancreatic islets RINm5F cells The proportions cells).

Cell Calcium

analysis number

21(3),

and NaCa3

185-193

isoforms NaCa7

28 28 29

of NaCa7

(1997)

of the NCXl

present

(%)

47.4 + 1.2 51.5* 1.1 37.7 f 0.9 are expressed

in percentages

in insulin NaCa3 52.6 48.5 62.3

producing

cells

(%)

NaCa7/P-actin 0.33 0.30

+ 1.2 k 1 .l t 0.9

and are given

as means

(k SEM)

NaCa3@-actin

f 0.01 f 0.02

0.38 0.33

+ 0.01 f 0.01

of 4 or 3 determinations

0 Pearson

Professional

(purified

B-

Ltd 1997

Na/Ca exchanger isoforms in rat pancreatic B-cells 191

= ‘c .E P,? Y-J ‘yl

1000

-

800

-

600

-

89

400

-

j

200

55 G?J

-

0

1

RINmSF cells

Islet cells

Fig. 6 %a2+ uptake by reverse Na/Ca exchange in islet cells and RINmSF cells. Na/Ca exchange was measured as intracellular Na+dependent %a*+ uptake. Mean SEM refers to 9 and 7 individual experiments, comprising 6 replicates in each case, for islets and RINm5F cells, respectively.

method allowed the detection of NCXZ in the brain, where the exchanger has been cloned 1111, our data strongly suggest that NCXZ is not expressed in insulin producing cells. This is in keeping with the notion of the limited tissue distribution of NCXZ, the exchanger having been detected in the brain and the skeletal muscle, only [ 111. In agreement with the wider tissue distribution of NCXl [ 10,161, two NCXl isoforms (NaCa3 and NaCa7) were detected in each of the three insulin producing cell preparations. The islet of Langerhans of the endocrine pancreas is an heterogeneous tissue containing different cellular types of which the insulin producing B-cells only represent 60-70% of the total population. The finding of the same isoforms in both the insulinoma tumoral RINm5F cell line and a 95% pure B-cell preparation [24] strongly argues for the presence of NaCa3 and NaCa7 in pancreatic B-cells. Tissue-specific expression of Na/Ca exchange isoforms has been evidenced and the predominant forms present in some tissues determined [7,9,10,15,16,28]. In agreement with previous observations, the present work shows the presence of one transcript in the heart, presumably NaCal, and two transcripts in both brain and kidney, presumably NaCa4 and NaCa5 in the brain and NaCa3 and NaCa7 in the kidney. Our work provides additional information concerning the isofonns predominantly expressed 0 Pearson

Professional

Ltd 1997

in four other rat tissues in which the presence of NCXI transcripts has not yet been examined. Interestingly, each tissue expressed two transcripts: NaCa3 and NaCa7 in the stomach and the adrenal gland, NaCa3 and NaCa5 in the adipose tissue, and NaCa4 and NaCa5 in the lung. The use of degenerate oligonucleotides encompassing highly conserved regions of the exchanger has allowed the determination of the expression pattern of NCXI among some tissues [8,10,16,29,30]. However, the comparative expression pattern of different Na/Ca exchanger isoforms in single tissues has not yet been examined. Here, we provide the first quantification of the expression pattern of different isoforms in single tissues. NaCa3 was equally expressed in the three insulin producing cell preparations, while the level of NaCa7 expression which was equal to that of NaCa3 in pancreatic islet cells and purified B-cells was about 3 times lower in RINm5F cells. It is unknown whether the structural differences between NCXl isoforms are translated into functional differences. Indeed, the region of alternative splicing lies in a small zone towards the end of the cytoplasmic loop, and deletion mutagenesis has shown that this cytoplasmic domain, although not essential for ion transport, is implied in the regulation of the exchanger. Indeed, mutants of the cloned dog heart exchanger with aminoacid residues (562-658) deleted in the splicing region did not display secondary regulation by cytosolic Ca*+ [31]. In addition, a chimera made from renal (NaCa2) and cardiac (NaCal) exchangers displayed the same biophysical characteristics as the wild type exchanger with respect to Na+,-inactivation, [Ca*+], regulation and inhibition by the exchanger inhibitory peptide (XIP) [31]. This indicates that replacement of exon A by exon B with concomitant suppression of exons E and F does not affect the activity of the exchanger, at least when expressed in Xenopus kaevis oocytes. NaCal and, to a lesser extent, NaCa2, NaCa4 and NaCa5 have been expressed in various host cells like Xenopus Levis oocytes [7,14,30,32-351, Cos-7 cells [36], CHO cells [37], HEK 293 cells 1381,insect cells [28,34,39] and shown to be active in these systems. However, the use of different expression systems and expression protocols precludes the comparison of the results obtained. The present study shows a 3-fold lower Na/Ca exchanger activity in RINm5F cells compared to islet cells. Because this lower activity is attended by a 3-fold lower expression of NaCa7, our data could point to the greater importance of NaCa7 for Na/Ca exchange activity, in other words, to a higher activity of NaCa7 compared to NaCa3 in insulin producing cells. Of course, Na/Ca exchange activity does not depend only on the level of protein expression but also on regulatory factors like the level of intracellular Ca2+,pH or ATP [40] or interaction with proteins of the cytoskeleton or other proteins that may be different in RINm5F cells and p-cells [41], so Cell Calcium

(1997)

21(3),

185-193

192

F Van Eylen, M Svoboda, A Herchuelz

that the difference in activity cannot be attributed to protein expression with certainty. Nevertheless, the comparative difference in both activity and expression is striking and further work is warranted to substantiate possible functional differences between exchanger isoforms. In summary, we have identified the presence of the same 2 NCXl isoforms (NaCa3 and NaCa7) in 3 insulin releasing cell preparations. We also provide the first quantitative estimation of the expression pattern of NCXl isoforms in single tissues. While NaCa3 is equally expressed in the 3 preparations, NaCa7 is 3 times less expressed in RINm5F cells than in islet and B-cells. This lower expression being paralleled by a 3-fold lower activity of Na/Ca exchange in RINm5F cells than in islet cells, our data are compatible with a difference in activity between NCXl isoforms. Further studies examining the activity of expressed spliced variants should shed additional light on this issue. ACKNOWLEDGEMENT

This work was supported by the Belgian Fund for Scientific Research (FRSM 3.454791F and LN 9.4584.90) of which FVE is a Research Assistant.

1.

Carafoli E. Membrane transport of calcium: an overview. Enzymoll988; 157: 3-l 1. Blaustein M.P. Sodium-calcium exchange and the control of contractility in cardiac muscle and vascular smooth muscle. J Cardiovasc l%armacol1988; 12 (suppL 5): S56-S68. Elsner D.A., Lederer W.J. Na-Ca exchange: stoichiometry and electrogenicity. Am JPhysiol 1985; 248: C189-C202. Bers D.M. Species differences and the role of sodium-calcium exchange in cardiac muscle relaxation. Ann NY Acad Sci 199 1; 639: 375-385. Haigney M.C.P., Miyata H., Lakatta E.G., Stem M.D., Silverman H.S. Dependence of hypoxic cellular calcium loading on Nat-Ca2+ exchange. Circ Res 1992; 71: 547-557 Colvin R.A., Davis N., Wu A., Murphy C.A., Levengood J. Studies of the mechanism underlying increased Na+-Caz+ exchange activity in Alzheimer’s disease brain. Brain Res 1994; 65: Methods

2. 3. 4. 5. 6.

192-200.

z Nicoll D.A., Longoni S., Philipson K.D. Molecular cloning and functional expression of the cardiac sarcolemmal Na+-Ca2+ exchanger. Science 1990; 250: 562-565. 8. Reilly R.F., Shugrue CA. cDNA cloning of a renal Na+-Caz+ exchanger. AmJF’hysiollPP2; 262: F1105-F1109. 9. Furman I., Cook O., Kasir J., Rahamimoff H. Cloning of two isoforms of the rat brain Nat-Ca*+ exchanger gene and their functional expression in HeLa cells. FEBS Lett 1993; 319: 105-109. 10. Nakasaki Y., Iwamoto T., Hanada H., Imagawa T., Shigekawa M. Cloning of the rat aortic smooth muscle Nat-Ca*+ exchanger and tissue-specific expression of isoforms. J Biochem 1993; 114: 528-534.

Cell Calcium

(1997)

21(3),

185-193

11. Li Z., Matsuoka S.,Hryshko L.V. et al. Cloning of the NCX2 isoform of the plasma membrane Na+-Ca2+ exchanger. / Biol Chem 1994; 269: 17434-l 7439. 12. McDaniel L.D., Lederer W.J., Kofuji P., Schulze D.H., Kieval R., Schultz R.A. Mapping of the human cardiac Na+-Ca*+ exchanger gene (NCXl) by fluorescent in situ hybridization to chromosome region 2p22+p23. Cytogenet Cell Genet 1993; 63: 192-193. 13. Durkin J.T., Ahrens D.C., Pan Y-C., Reeves J.P.Purification and amino-terminal sequence of the bovine cardiac sodiumcalcium exchanger: evidence for the presence of a signal sequence. Arch Biochem Biophys 1991; 290: 369-375. 14. Hryshko L.V., Nicoll D.A., Weiss J.N., Philipson K.D. Biosynthesis and initial processing of the cardiac sarcolemmal Na+-Caz+ exchanger. Biochim Biophys Actu 1993; 1151: 35-42. 15. Kofuji P., Lederer W.J., Schulze D.H. Mutually exclusive and cassette exons underlie alternatively spliced isoforms of the Na/Ca exchanger. J Biol Chem 1994; 269: 5 145-5 149. 16. Lee S-L., Yu A.S.L., Lytton J. Tissue-specific expression of Na+-Ca*+ exchanger isoforms. J Biol Chem 1994; 269: 14849-14852. 17 Hellman B., Andersson T., Berggren P-O., Rorsman P. Calcium and pancreatic B cell function. XI. Modification of %a fluxes by Na+ removal. Biochem Med 1980; 24: 143-152. 18. Herchuelz A., Sener A., Malaisse W.J. Regulation of calcium fluxes in rat pancreatic islets: calcium extrusion by sodiumcalcium countertransport. J Membr Biol 1980; 57: l-l 2. 19. Plasman P-O., Lebrun P., Herchuelz A. Characterization of the process of sodium-calcium exchange in pancreatic islet cells. Am JPhysiol 1990; 259: E844-E850. 20. Plasman P-O., Herchuelz A. Regulation of Na+-Caz+ exchange in the rat pancreatic B-cell. Biochem J 1992; 285: 123- 127 21. Van Eylen F., Antoine M-H., Lebrun P., Herchuelz A. Inhibition of Na/Ca exchange stimulates insulin release from isolated rat pancreatic islets. Fundam Clin Pharmacoll994; 8: 425-429. 22. Lacy P.E.,Kostianovsky M. Method for the isolation of intact islets of Langerhans from the rat pancreas. Diabetes 1967; 16: 35-39. 23. Gobbe P., Herchuelz A. Does glucose decrease cytosolic free calcium in normal pancreatic islet cells? Res Commun Chem Pathol Pharmacoll989; 63: 23 l-247 24. Pipeleers D.G., in’t Veld P.A., Van De Winkel M., Maes E., Schuit F.C., Gepts W. A new in vitro model for the study of pancreatic A and B cells. Endocrinology 1985; 117: 806-816. 25. Sanger F., Nicklen S., Coulson A. DNA sequencing with chainterminating inhibitors. Proc Nat1 Acad Sci USA 1977; 74: 5463-5467 26. Sambrook J., Fritsch E.F.,Maniatis T. Molecular Cloning: A Laboratoy Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. 2% Golde T.E., Estus S.,Usiak M., You&in L.H., Your&in S.G. Expression of B-amyloid protein precursor mRNAs: recognition of a novel alternatively spliced form and quantitation in Alzheimer’s disease using PCR. Neuron 1990; 4: 253-267 28. Loo T.W., Clarke D.M. Functional expression of human renal Na+/Caz+ exchanger in insect cells. Am J Physiol 1994; 267: F70-F74. 29. Yu A.S.L., Hebert SC., Lee S-L., Brenner B.M., Lytton J. Identification and localization of renal Na+-Ca2+ exchanger by polymerase chain reaction. Am J Physiol 1992; 263: F680-F685. 30. Komuro I., Wenmnger K.E., Philipson K.D., Izumo S. Molecular cloning and characterization of the human cardiac Na+/Caz+ exchanger cDNA. Proc Nat1 Acad Sci USA 1992; 89: 4769-4773. 3 1. Matsuoka S., Nicoll D.A., Reilly R.F., Hilgemamr D.W., Philipson

0 Pearson

Professional

Ltd 7997

Na/Ca exchanger isoforms in rat pancreatic B-cells 193

32. 33. 34.

35.

36.

K.D. Initial localization of regulatory regions of the cardiac sarcolemmal Na+-Ca2+ exchanger. Proc Nut2 AC& Sti USA 1993; 90: 3870-3874. Aceto J.F.,Condrescu M., Kroupis C. et al. Cloning and expression of the bovine cardiac sodium-calcium exchanger. Arch Biochem Biophys 1992; 298: 553-560. Matsuoka S.,Nicoll D.A., Hryshko L.V., Levitsky D.O., Weiss J.N., Philipson K.D. Regulation of the cardiac Na+-Ca2+ exchanger by Caz+.J Gen Physiol1995; 105: 403-420. Sahin-Toth M., Nicoll D.A., Frank J.S.,Philipson K.D., Friedlander M. The cleaved N-terminal signal sequence of the cardiac Na+-Caz+ exchanger is not required for functional membrane integration. Biochem Biophys Res Commun 1995; 212: 968-974. Tsuruya Y., Bersohn M.M., Li Z., Nicoll D.A., Philipson K.D. Molecular cloning and functional expression of the guinea pig cardiac Na+-Ca2+ exchanger. Biochim Biophys Acta 1994; 1196: 97-99. Kofuji P., Hadley R.W., Kieval R.S., Lederer WJ., Schulze D.M.

0 Pearson

Professional

Ltd

7997

37 38. 39.

40. 4 1.

Expression of the Na-Ca exchanger in diverse tissues: a study using the cloned human cardiac Na-Ca exchanger. Am J Physiol 1992; 263: C1241-C1249. Pijuan V., Zhuang Y., Smith L. et al. Stable expression of the cardiac sodium-calcium exchanger in CHO cells. Am J Physiol 1993; 264: C1066-C1074. Loo T.W., Ho C., Clarke D.M. Expression of a functionally active human renal sodium-calcium exchanger lacking a signal sequence. JBiol Chem 1995; 270: 19345-19350. Li Z., Smith C.D., Smalley J.R., Bridge J.H.B., Frank J.S.,Philipson K.D. Expression of the cardiac Na+-Caz+ exchanger in insect cells using a baculovirus vector. / Biol Chem 1992; 267: 7828-7833. Philipson K.D., Nicoll D.A. Molecular and kinetic aspects of sodium-calcium exchange. IntRw CytoZl993; 137C: 199-227 Reeves J.P., Condrescu M., Chernaya G., Gardner J.P.Na+/Ca*+ antiport in the mammalian heart. J Exp BioZ1994; 196: 375-388.

Cell Calcium

(1997)

21(3),

185-193