Identification of a cDNA encoding channel catfish interferon

Developmental and Comparative Immunology 28 (2004) 97–111 www.elsevier.com/locate/devcompimm

Identification of a cDNA encoding channel catfish interferon Scott Long, Melanie Wilson, Eva Bengten, Locke Bryan, L.W. Clem, N.W. Miller, V.G. Chinchar* Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216, USA Received 8 April 2003; revised 30 May 2003; accepted 2 June 2003

Abstract Despite considerable advances in our understanding of teleost immunity, relatively few cytokine genes, including those for interferon (IFN), have been identified at the molecular level. In contrast, numerous studies have shown that following virus infection or exposure to double-stranded RNA, fish or fish cells produce a soluble factor that is functionally similar to mammalian IFN. A putative catfish (CF) IFN cDNA was identified by BLASTX screening of a catfish EST library generated from a mixed lymphocyte culture enriched for NK-like cells. Consistent with its designation as a putative cytokine cDNA, the 30 non-translated region contained multiple copies of an RNA instability motif. Analysis of the deduced amino acid sequence of CF IFN showed low levels of identity/similarity to a panel of mammalian and avian IFN proteins, and markedly higher similarity to a recently identified zebrafish IFN. To determine if the identified cDNA encoded CF IFN, expression was monitored following infection of channel catfish ovary (CCO) cells with UV-inactivated catfish reovirus or exposure to doublestranded RNA, treatments which induce IFN or IFN-like activity in catfish and other species. In both cases, upregulation of putative CF IFN mRNA was detected. Moreover, upregulation of CF IFN mRNA was accompanied by the appearance of an antiviral factor in the culture medium. To confirm these results, recombinant CF IFN was synthesized in COS-7 cells and shown to have antiviral activity in CCO cells. Collectively, these results argue strongly that the identified catfish cDNA is an IFN homolog. q 2003 Elsevier Ltd. All rights reserved. Keywords: Channel catfish; Ictalurus punctatus; Interferon; Innate immunity; Cytokine gene

1. Introduction Interferons have been identified at the functional and molecular levels in a wide variety of mammalian and avian species [1 –3]. In contrast, despite numerous reports of interferon-like activity in ectothermic * Corresponding author. Tel.: þ1-601-984-1743; fax: þ 1-601984-1708. E-mail address: [email protected] (V.G. Chinchar).

organisms [4 –13], IFN homologs have only recently been identified in fish [14,15], and have not yet been cloned in amphibians and reptiles. Given the importance of IFN in antiviral immunity in mammals [16,17], it is important to identify IFN genes and cDNAs in lower vertebrates and to determine if IFN plays a significant role in protection against virus-mediated disease in ectothermic animals. Although originally identified by virtue of their antiviral effects, mammalian IFNs play multiple roles in cellular growth and differentiation, tumor

0145-305X/04/$ - see front matter q 2003 Elsevier Ltd. All rights reserved. doi:10.1016/S0145-305X(03)00122-8

98

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

suppression, apoptosis, and immune modulation [1 – 3,18]. IFN induces the synthesis of , 100 genes including an RNA-specific adenosine deaminase (ADAR1), Mx proteins, an eIF-2a specific protein kinase (PKR), 20 50 oligoadenylate synthetase (20 50 OAS), and RNase L [2,18 –20]. The latter three gene products, following activation by double-stranded RNA, block viral replication by inhibiting protein synthesis and degrading mRNA in virus-infected cells [18]. In addition to directly inhibiting viral replication, IFN also enhances the cytotoxicity of mammalian NK cells and upregulates MHC class I and class II molecules on the surface of both target and antigen presenting cells [2,20]. The end result of these actions is to limit viral replication early after infection and permit antigen-specific humoral and cell mediated immunity to develop and ultimately resolve the infection. Although mammals possess multiple IFN classes (see below), antibody ablation and gene knockout experiments indicate that type I and II IFNs are functionally non-redundant and essential for antiviral defense [16,18,21,22]. Moreover, the importance of IFNs in controlling viral replication is underscored by the observation that many different viruses encode proteins designed to block IFN action [2,18,21– 24]. The myriad effects of mammalian IFN are mediated by three main classes of IFN molecules, a, b, and g, that are similar in size (, 20,000 mol wt), but differ markedly in amino acid sequence and cellular origin [1 – 3]. IFN a and b, designated type I IFNs, are synthesized by all cell types and utilize the same receptor, whereas IFN g (termed type II or immune IFN) is produced only by activated T lymphocytes and NK cells and interacts with cells via a different receptor. Multiple loci encode IFN a products, whereas IFN b and IFN g are each encoded by single loci. For example, in humans, there are 13 functional IFN a genes and 12 IFN a pseudogenes [1]. Furthermore, both IFN a and b genes lack introns, whereas IFN g, like most eukaryotic genes, contains introns. Finally, although functionally similar, IFN b shares only 20– 30% amino acid sequence identity with any particular IFN a, while IFN g genes are even more distantly related to both IFN a and IFN b [21]. Following virus infection or exposure to dsRNA, an IFN-like antiviral activity was observed in

numerous fish and fish cell lines [4 – 13]. For example, infection of channel catfish ovary (CCO) cells with UV-inactivated catfish reovirus (CRV), a dsRNAcontaining virus, results in the appearance in the cell culture medium of a factor that blocks the cytopathic effect induced by channel catfish herpesvirus (CCV) [25]. Moreover, in addition to UV CRV-infected CCO cells, actively proliferating catfish T cell and macrophage lines constitutively produce an antiviral factor and are generally more resistant to CCV infection than non-producing catfish B cell lines [25]. As part of a long-term study of catfish immunity, EST libraries were constructed from cDNA obtained from various catfish lymphoid cell lines (LCL) or cultures. BLAST analysis of an EST library derived from a week old mixed leukocyte culture enriched for NK-like cells identified a single cDNA clone with homology to mammalian IFN a. As described herein, subsequent analysis of the complete cDNA strongly argues that the identified gene is the catfish homolog of IFN.

2. Materials and methods 2.1. Cell lines and viruses The following channel catfish (Ictalurus punctatus) long-term LCL were used in this study: G14D, a T cell line derived from a family of MHC-matched gynogenetic catfish [26]; TS 32.17, an alloantigendependent cytotoxic T cell line [27]; 3B11 and 1G8, B cell lines derived from two different outbred catfish [28,29]; and 42TA, a macrophage-like cell line derived from an outbred catfish [28]. In addition, two adherent cell lines, CCO (channel catfish ovary) [30] and BB (brown bullhead, ATCC No. CCL 59) cells, were also used. Catfish LCL were cultured in AL-5 medium, a medium composed of AIM V media, L-15 media, and de-ionized water (in the ratio 45:45:10) containing 50 mM 2-mercaptoethanol and 5% heat-inactivated catfish serum [28]. CCO and BB cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal calf serum (FCS). COS-7 cells, a fibroblast-like cell line derived from the African green monkey, were maintained in DMEM medium supplemented with 10% FCS [31]. Cell cultures were incubated at 26 8C (catfish LCL) or 37 8C (COS-7) in a humidified

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

incubator in 5% CO2/95% air. Peripheral blood lymphocytes (PBL) were obtained from catfish by venipuncture of the caudal sinus and isolated following centrifugation onto a cushion of Lymphoprep [28]. CCV, obtained from the American Type Tissue Culture Collection (Auburn 1, clone A, ATCC VR655), and channel catfish reovirus (CRV), obtained from R. Hedrick (University of California, Davis), were propagated in CCO cells at 26 8C. 2.2. Sequencing of catfish IFN The plasmid Icpu JX 13_9_G01_23 encoding putative catfish interferon (CF IFN) was obtained from a library constructed as part of our ongoing analysis of channel catfish expressed sequence tags (University of Mississippi Medical Center, Department of Microbiology, website: http://morag. umsmed.edu). The JX13 library was generated from a week-old mixed leukocyte culture, MLC52-1, that was enriched in NK-like cells [32]. Full-length cDNAs making up this library were cloned into pSPORT1 (Invitrogen), and analyzed by BLASTX analysis [33] after single pass sequencing. Plasmid JX 13_9_G01_23 was transformed into E. coli Top10 competent cells (Invitrogen) and plasmid DNA isolated using a Qiagen mini-prep kit. Nucleotide sequencing was initially performed using the universal sequencing primers M13F (50 CGTTGTAAAACGACGGCCAG 30 ) and M13R (50 ACACAGGAAACAGCTATGAC 30 ). Contigs were assembled using the SEQMAN program within DNASTAR (Madison, WI). Based on the overlapping contigs, sequencing primers 02-03F (50 CCGGCA GTTAACAGAGCTTAC 30 ), 02-04R (50 CCACATT CCTGATTCGCTCCA 30 ), and 02-09F (50 GGAGC GAATCAGGAATGTGGT 30 ) were designed and used to determine the complete sequence of both strands.

99

amino acid sequence was constructed using the Neighbor-Joining (NJ) algorithm within MEGA version 2.1 (www.megasoftware.net) [34]. Pair-wise protein sequence divergence was corrected for multiple hits by using the Poisson correction. The degree of confidence for each branch point was calculated by the bootstrap method (1000 replications). Signal peptide prediction was performed using the SignalP program, version 2.0.b2 [35]. The Prosite database was searched to identify motifs within the deduced amino acid sequence [36]. Isoelectric points (pI) were determined by the EditSeq program within DNASTAR. 2.4. Southern blot analysis Genomic DNA was extracted from catfish LCL and catfish erythrocytes using DNAzol (Molecular Research Center) and digested at 37 8C for 3 h with 1 unit Bam HI, Eco RI, or Hind III (GibcoBRL) per mg DNA. DNA (10 mg/lane) was electrophoresed on 0.8% agarose gels and transferred to nylon membranes (MSI) by upward capillary transfer [37]. Transferred DNA was hybridized with a 408 bp probe generated by PCR using primers 02-08F (50 GCCAGTACAGAGCGAAGAACA 30 ) and 02-04R (50 CCACATTCCTGATTCGCTCCA 30 ) which span nucleotides 151 – 558 of the CF IFN sequence. Plasmid JX 13_9_G01_23 containing the CF IFN insert was used as template for the above PCR reaction. PCR probes were random prime labeled with [32P]dCTP using the Megaprime DNA Labeling System (Amersham). Following overnight hybridization at 42 8C, blots were washed twice with 2 £ SSC, 0.1% SDS at 42 8C and twice with 0.2 £ SSC, 0.1% SDS at 55 8C, exposed to Kodak Biomax-MR X-ray film at 2 80 8C, and the hybridized bands visualized by autoradiography. 2.5. CF IFN expression studies: RT-PCR

2.3. CF IFN sequence analysis A multiple alignment of the deduced amino acid sequence of CF IFN with representative interferons was generated using the CLUSTAL program within MEGALIGN (DNASTAR) and the percent similarity between CF IFN and other known interferons was determined. A phylogenetic tree based on the deduced

RNA was extracted from representative catfish LCL, CCO, BB, and PBL using RNAwiz (Ambion), treated with RNase-free DNase, and used as template in RT-PCR (reverse transcription polymerase chain reaction) assays. Total RNA (2.5 mg) was reverse transcribed with an oligo[dT] primer and Superscript II RNase H-minus reverse transcriptase (Invitrogen)

100

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

according to the manufacturer’s instructions. One ml of the resulting cDNA was used as template in a PCR using the CF IFN-specific primers 02-08F and 0204R. PCR reactions (50 ml total reaction volume) contained 50 mM KCl, 10 mM Tris –HCl, pH 8.3, 1 mM MgCl2, 200 mM each dATP, dCTP, dGTP, dTTP, 500 ng forward and reverse primers, and 2.5 U AmpliTaq Gold DNA polymerase (Perkin –Elmer). Cycling conditions were 1 cycle of 94 8C for 3 min; 30 cycles of 94 8C for 30 s, 55 8C for 45 s, and 72 8C for 1 min; 1 cycle of 72 8C for 5 min. Products were purified using the Wizard PCR Prep DNA Purification System (Promega) and visualized by electrophoresis on 1% agarose gels containing ethidium bromide (150 ng/ml). As a control for RNA integrity, RT-PCR analysis was also performed using primers specific for actin mRNA and catfish 18 S rRNA. Both actin and 18 S rRNA were amplified using the same cycling conditions listed above and the following primer pairs: actin, 01-10F (5 0 ACTACCTGATGAAGACCCTG 30 ) and 01-10R (50 GGCTGATCCACATCTGTTG 3 0 ); 18 S rRNA, 03-16F (5 0 CCCGCCCAACTCGCCTGAATACCT 30 ) and 0317R (50 GGCCATGCACCACCACCCACAGAA 30 ). 2.6. Induction of CF IFN by UV-CRV and poly[I:C] CRV was inactivated by exposure to 150 mJ UV irradiation using a BioRad GS GeneLinker, and induction of an antiviral, IFN-like factor was carried out as described previously [25]. Briefly, confluent CCO cultures were infected with UV-CRV at a multiplicity of infection , 1 TCID50/cell. Virus was allowed to attach for 1 h, after which the inoculum was removed and the cultures incubated in DMEM supplemented with 5% FCS. At the indicated times post-infection, the culture medium was harvested and RNA extracted from the infected cells. Culture medium was clarified by low speed centrifugation, and frozen at 2 20 8C until use. Supernatants were assayed for antiviral activity in a challenge assay (see below), whereas RNA (2.5 mg) was used to detect CF IFN by RT-PCR assay as described above. In addition to UV-CRV, CF IFN was induced by polyinosinic – polycytidylic acid (poly[I:C], Sigma Chemical). CCO cells were incubated in media containing 50 mg/ml poly[I:C] for 1 h after which the media was removed, the cells washed once, and incubation continued in

fresh media at 26 8C. At the indicated times, treated cells were assayed for CF IFN expression by RT-PCR, and spent culture medium assayed for antiviral activity by challenge assay [7,25]. 2.7. Generation of recombinant catfish IFN PCR products encoding the entire open reading frame of CF IFN (excluding the stop codon) were cloned in frame into the expression vector pcDNA3.1/V5-His-TOPO according to the manufacturer’s instructions (Invitrogen). Briefly, primers 0210F (50 TGCAACTGGATGATCAGC 30 ) and 02-12R (50 GTTGGTCCTTTTCAATAGTTT 30 ) were used to amplify the open reading frame of CF IFN from plasmid JX 13_9_G01_23 using the PCR conditions described above. PCR products were electrophoresed on 1% agarose gels and visualized by staining with ethidium bromide. The 495 bp band corresponding to CF IFN was excised from the gel and isolated by passage through a 0.2 mm syringe filter (Nalgene). One sixth (i.e. 2 ml) of the purified product was ligated into pcDNA3.1/V5-His-TOPO, and one third (i.e. 2 ml) of the ligation reaction was transformed into E. coli Top10 competent cells (Invitrogen). Clones containing a full-size insert were identified following digestion with Kpn I and Apa I, and proper insert orientation was determined by sequencing. The resulting construct, designated pcDNA3.1/V5-HisTopo/I-08-4.10, encoded CF IFN with a C-terminal V5 epitope and histidine tag and was transfected into COS-7 cells using the GenePorter2 Transfection Reagent (Gene Therapy Systems) according to the manufacturer’s instructions. Stable cell lines were obtained by culturing transfected cells in DMEM containing 10% FCS and 0.5 mg/ml geneticin. Additionally, the plasmid pcDNA3.1/V5-His-TOPO/lacZ containing the gene for b-galactosidase was transfected into COS-7 cells and used to both monitor transfection efficiency and serve as a negative control in challenge assays. Expression of recombinant CF IFN mRNA in COS-7 cells was demonstrated by RTPCR using the CF IFN-specific reverse primer 02-12R followed by PCR using CF IFN primers 02-10F and 02-12R as described above. b-galactosidase expression was monitored by staining the cells for activity using a b-gal staining kit according to the manufacturer’s instructions (Invitrogen). Expression

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

of recombinant CF IFN protein was monitored in lysates of stably-transfected cells by Western blot analysis using a commercially available antibody directed against the C-terminal His-Tag (Invitrogen) followed by detection using the ECL system (Amersham). 2.8. Challenge assays Challenge assays [7,25] were performed to determine if culture medium harvested from UV-CRV infected CCO cells or poly[I:C]-treated cultures possessed antiviral activity and to identify the presence and activity of recombinant CF IFN. Briefly, approximately 105 CCO cells in 100 ml of growth medium were seeded into 96 well plates containing an equal volume of undiluted test medium or increasing twofold dilutions of culture medium. Following overnight incubation, the cultures were challenged with 50 ml DMEM/5% FCS containing approximately 1000 plaque forming units CCV. After an additional 48 h incubation at 26 8C, the medium was removed and the cultures stained for 5 min with 1% crystal violet in 70% ethanol. The dye was removed and the plates washed with water until no residual dye remained. The antiviral titer is the reciprocal of the last dilution that provided . 50% protection of the monolayer.

3. Results 3.1. Identification of catfish IFN: sequence analysis BLASTX analysis of an EST library constructed using cDNA obtained from a mixed lymphocyte culture enriched for NK-like cells identified a single clone (JX_13_G01_23) with sequence homology to rat and mouse IFN a. Although the BLASTX match score was relatively low, the catfish sequence showed 28% identity/41% similarity to rat IFN a (over a region of 140 amino acids) and 30% identity/52% similarity to mouse IFN a (over a region of 66 amino acids). Plasmid DNA encoding the putative CF IFN cDNA was isolated and restriction digests revealed an insert of approximately 1100 bp, sufficient in size, by analogy to mammalian IFN, to encode the entire transcript. Automated sequencing using M13 forward

101

and reverse primers yielded sequences of 1061 and 676 bp, respectively. When aligned, these contigs generated an overlap of approximately 580 bp. Primers 02-03F, 02-04R, and 02-09F were designed based on the sequence data within this overlap and used to complete the sequencing of both strands. The assembled contigs identified a 1065 bp insert that was sequenced at a 3 – 5 fold level of redundancy. The complete CF IFN cDNA sequence (Fig. 1) contains a 143 bp 50 untranslated region (UTR), a 489 bp open reading frame encoding a 162 amino acid protein (18,977 mol wt), and a 433 bp 30 UTR. Within the 30 UTR, seven mRNA instability motifs (ATTTA), hallmarks of mammalian cytokine genes [38], and a poly[A] tail were identified. The sequence AATTAA, differing from the consensus (AATAAA) by an A ! T transversion at position 4, may signal the site of mRNA cleavage and poly[A] addition and is seen 21 nt upstream from the start of the poly[A] tail [39]. In contrast to mammalian IFNs, analysis with the SignalP program failed to detect a classical signal peptide within the first 70 amino acids of the CF IFN amino terminus [35]. It is not known if the absence of a signal sequence is a distinguishing feature of CF IFN, or if the cloned cDNA represents an expressed pseudogene. Moreover, unlike mammalian IFN a, CF IFN is a basic protein with a predicted pI of 9.78 (Table 1). A potential N-linked glycosylation site was detected at amino acid positions 27– 30, a characteristic more commonly associated with IFN b than with IFN a [3]. Consistent with the BLASTX results, the Prosite database predicted amino acid positions 1 – 157 of CF IFN to consist of a typical IFN a/b domain. In contrast to human IFN a molecules, which are characterized by two intrachain disulfide bonds linking cysteine residues 1 – 98 and 29 –138 of the mature peptide, CF IFN possesses only three cysteine residues (at positions 12, 32, and 95) and likely forms only a single intrachain disulfide bond. In terms of the number of cysteine residues and the potential to form disulfide bonds, CF IFN is more similar to human IFN b and the recently identified zebrafish (ZF) IFN, where two cysteine residues are present in the mature peptide, than to mammalian IFN a [3,15]. To determine the relatedness of the putative CF IFN cDNA with known IFN sequences, a multiple alignment was performed using the deduced amino acid sequences (Fig. 2). Pair-wise comparisons of CF

102

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

Fig. 1. Catfish IFN cDNA and deduced amino acid sequence. The translation start and stop codons are indicated in bold type. Seven mRNA instability motifs (ATTTA) within the 30 UTR are underlined, a possible poly[A] addition signal (AATTAA) is double underlined, and a potential glycosylation site is indicated with a dashed line.

IFN with other IFNs indicated that CF IFN is slightly more similar to mammalian IFN a than to mammalian IFN b and -g, and avian IFN a and -b (Table 1). However, CF IFN is markedly more similar to the recently described ZF IFN [15]. Without considering mismatches and alignment gaps that lower the calculated similarity value shown in Table 1, overall pair-wise comparison indicates that CF IFN and ZF IFN genes are 39% identical and 55% similar.

Moreover, between positions 121– 201 of the consensus sequence, CF and ZF IFN possess two 6-amino acid blocks that are completely identical, and show 47% amino acid identity and 64% amino acid similarity (Fig. 2). Using the alignment shown in Fig. 2, a phylogenetic tree was generated using the NJ algorithm within MEGA version 2.1 [34]. The NJ method was chosen because it is known to be more reliable than other

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111 Table 1 Percent similarities between CF IFN and representative IFNs from different species IFN (species and type)

Percent similaritya

pIb

Human IFN a1 Human IFN a13 Human IFN a6 Mouse IFN a Rat IFN a Chicken IFN a Turkey IFN a Human IFN b Mouse IFN b Rat IFN b Chicken IFN b Human IFN g Mouse IFN g Catfish IFN Zebrafish IFN

15.4 15.4 17.3 17.3 19.1 12.3 12.3 13.6 14.2 14.2 13.0 12.3 13.5 100 35.3

5.25 5.25 7.22 7.94 7.90 8.74 8.75 8.73 9.71 9.75 10.30 9.49 8.47 9.78 9.74

a

Percent similarities to CF IFN were determined by the MEGALIGN program within DNASTAR. Percent similarity ¼ 100 £ ðmatches=matches þ mismatches þ gapsÞ: Protein alignment scores are affected by partial matches derived from the PAM250 residue weight table. b Isoelectric points (pI) were determined using algorithms within the EditSeq program of DNASTAR.

methods in cases where branches in the tree differ with respect to the rate of evolution, and because it was used previously to examine the phylogeny of mammalian IFN genes [40]. Although amino acid sequence divergence is high, the tree depicted in Fig. 3 indicates that four well-supported clusters (bootstrap values . 95%) are present (i.e. mammalian a and b IFNs, teleost IFNs, avian IFNs, and mammalian IFN g). While the data do not allow tracing the lineage of avian, mammalian, and teleost IFNs, they are consistent with the presence of a distant, but common, ancestor. This inability to trace the evolution of IFNs genes may reflect their long history of separation, i.e. 450 million years since the divergence of the Actinopterygii from the tetrapod line [41], coupled with their adaption to the challenges of unique infectious agents. 3.2. Genomic organization of CF IFN To determine if CF IFN exists as a single or multicopy gene, DNA obtained from the outbred catfish B cell line, 1G8, was digested with Bam HI, Eco RI, and

103

Hind III and subjected to Southern analysis using a 408 bp probe which contained no restriction sites for these enzymes. When DNA was digested with either Bam HI or Eco RI, two strongly hybridizing bands were detected, whereas DNA digested with Hind III showed three bands (Fig. 4). To confirm this finding, cleavage of a more extensive collection of catfish DNA isolated from the macrophage cell line 42TA, the T cell line G14D, and erythrocytes from one outbred and two gynogenetic catfish showed only two bands after digestion with Dra I, Pst I, and Hind III (data not shown). Taken together, these data suggest that two, or at most three, copies of the CF IFN gene are present in channel catfish. 3.3. Expression of CF IFN CF IFN expression was examined by RT-PCR analysis of PBLs as well as a panel of long-term catfish cell lines including T cells (G14D, TS 32.17), B cells (3B11, 1G8), macrophages (42TA), and fibroblasts (CCO, BB). As illustrated in Fig. 5, a 408 bp band was readily observed in G14D, TS 32.17, 1G8, 42TA, and PBL. A band of similar size was detected in the B cell line 3B11 at greatly reduced levels, whereas a distinct band in this size range was not detected in uninduced BB or CCO cells. Subsequent RT-PCR analysis using an increasing number (i.e. 15– 35) of amplification cycles indicated that the seemingly negative fibroblast lines constitutively synthesized low levels of CF IFN mRNA, and confirmed that T cells synthesized markedly higher levels of CF IFN message (data not shown). To determine if CF IFN could be upregulated in catfish fibroblasts, CCO cells were infected with a dsRNA virus or exposed to poly[I:C], treatments known to induce IFN in other systems [4,5,11,15,25]. CCO cells were infected with UV-inactivated CRV and, at the indicated times after infection, culture medium was collected and total RNA was extracted from infected cultures. Subsequently, culture medium was assayed for the presence of antiviral activity by challenge assay, while total cellular RNA was assayed for the presence of CF IFN mRNA by RT-PCR. As shown in Fig. 6(A), antiviral activity was detected as early as 2 h after infection and increased throughout the 24 h assay period. Consistent with the induction of antiviral activity, CF IFN mRNA was also detected at

104

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

105

Fig. 3. Phylogenetic tree of CF IFN. Based on the multiple alignment shown in Fig. 2, a phylogenetic tree was constructed using the Neighbor-Joining algorithm within MEGA version 2.1 [34]. The tree was constructed using the Poisson correction and was validated by 1000 bootstrap repetitions. Branch lengths are drawn to scale and a scale bar is shown.

2 h after infection and persisted throughout the 24 h assay. In other experiments, CF IFN mRNA levels declined by 48 h post infection, a result consistent with the transient nature of IFN induction in mammalian cells and the instability of IFN mRNA (data not shown). To strengthen the suggestion that induction of the putative CF IFN gene was responsible for the appearance of the antiviral activity, a second induction protocol was employed. In this experiment, CCO cells were treated with poly[I:C] and, at various times after treatment, assayed for IFN mRNA synthesis by RT-PCR, and for antiviral activity by challenge assay. As shown in Fig. 6 (panel B), treatment with poly[I:C] markedly, but transiently, induced expression of CF IFN mRNA. In keeping with the reported instability of IFN transcripts, CF IFN message levels peaked at 2 h post treatment and declined thereafter. In contrast to the decline in IFN mRNA levels, antiviral activity as

Fig. 4. Catfish IFN is present in only a few copies per genome: Southern blot analysis. Catfish DNA was prepared from 1G8 cells, a B cell line derived from an outbred catfish. DNA was digested with the indicated restriction enzymes, separated by electrophoresis on 0.8% agarose gels, transferred to nylon membranes, and hybridized to a 32P-labeled probe corresponding to nucleotides 151–558 of CF IFN. Hybridized bands were detected by autoradiography. Size markers (in kb) are shown to the left of the figure.

measured in a challenge assay remained high throughout the 24 h assay period. Taken together these results support the contention that the gene designated CF IFN is a bona fide fish cytokine and is responsible for the antiviral activity detected in the culture medium.

Fig. 2. Multiple alignment of CF IFN and select a, b, and g-IFNs. The inferred amino acid sequence of CF IFN was aligned with the indicated IFN sequences using the CLUSTAL program within MEGALIGN (DNASTAR). Residues that match the CF IFN sequence are shaded. Numbering is based on the consensus sequence. The species of origin of each IFN is indicated as follows: Hu, human; Mu, mouse; Rn, rat; Gg, chicken; TK, turkey; CF, channel catfish; and ZF, zebrafish. The accession numbers for the aligned sequences are: Hu IFN alpha 1 (NM_024013); Hu IFN alpha 6 (NP_066282); Hu IFN alpha 13 (NP_008831); Hu IFN beta (NM_002176); Hu IFN gamma (J00219); Mu IFN alpha (D00460); Mu IFN beta (NM_010510); Mu IFN gamma (XM_125899); Rn IFN alpha (P05011); Rn IFN beta (NP_062000); Gg IFN alpha (AB021154); Gg IFN beta (Q90873); TK IFN alpha (P51527); CF IFN alpha (AY267538); and ZF IFN (AY135716).

106

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

Fig. 5. Expression of catfish IFN in various cell lines: RT-PCR. RNA was isolated from the indicated catfish cell lines and used as templates in RT-PCR assays. PCR products were detected by electrophoresis on 1% agarose gels containing ethidium bromide. Analysis of actin mRNA was included as a positive control.

3.4. Synthesis of recombinant CF IFN Although the kinetics of antiviral activity and CF IFN mRNA expression roughly paralleled one another, it is possible that the two events were merely coincidental, i.e. infection with UV-CRV may induce two different genes, one designated CF IFN and another, as yet unidentified, gene which is responsible for the antiviral activity. In order to establish that the gene product identified as CF IFN was the factor responsible for antiviral activity, recombinant CF IFN was generated and assayed for antiviral activity by the challenge protocol. A vector expressing recombinant CF IFN was transfected into COS-7 cells and stable cell lines were obtained by selection in DMEM containing 10% FCS and 0.5 mg/ml geneticin. PCR assay confirmed that stable transfectants retained

the IFN gene (data not shown). In addition, RT-PCR demonstrated that recombinant CF IFN mRNA was expressed only in transfected cells (Fig. 7(A)), and western blot analysis identified an , 25 kDa protein in lysates of cells transfected with the CF IFN-containing vector (Fig. 7(B)). The size of this polypeptide is consistent with the existence of a protein composed of the complete amino acid sequence of CF IFN along with additional N- and C-terminal amino acids contributed by the multiple cloning site, the V5 epitope, and the 6 £ His tag. Culture medium from confluent COS-7 cells and from a COS-7 culture stably-transfected with a plasmid containing CF IFN (designated 4.10) were collected and assayed for antiviral activity in a challenge assay. Growth medium (DMEM with 10% FCS, D10) did not protect CCO cells from CCV infection, and culture media from confluent, non-transfected COS-7 cells, or from cells transfected with a plasmid bearing the lacZ gene, resulted in only low levels of protection against CCV (Fig. 7(C), lanes 2 – 4, and data not shown). In contrast, culture medium from COS-7 cells expressing recombinant CF IFN (4.10) showed markedly higher titers of antiviral activity (Fig. 7(C), lanes 5 and 6). Collectively, these findings strongly support the hypothesis that the antiviral activity observed following infection with UV-CRV resulted from the synthesis of CF IFN, and argue that the gene designated CF IFN is the catfish homolog of mammalian IFN.

Fig. 6. Induction of CF IFN by UV-CRV and poly[I:C]. (Panel A) Total RNA was isolated from mock- and UV-CRV-infected CCO cells at the indicated times post-infection and assayed for CF IFN message expression by RT-PCR. Catfish 18S ribosomal RNA was included as a positive control. At each time point, culture medium was analyzed for antiviral activity by challenge assay and the titer is shown. (Panel B) RNA was isolated from CCO cells at the indicated times following a 1 h exposure to 50 mg/ml poly[I:C] and used as template in an RT-PCR assay. In addition, culture medium from poly[I:C] treated cultures was analyzed for antiviral activity and the titer determined.

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

107

Fig. 7. Recombinant CF IFN possesses antiviral activity. (Panel A, RT-PCR analysis) RNA isolated from COS-7 cells, or from COS-7 cells transfected with a plasmid expressing recombinant CF IFN (COS-7 4.10), was reverse transcribed with an oligo [dT] primer or a CF IFNspecific reverse primer. cDNA was subsequently amplified with actin- or CF IFN-specific primers and the resulting products analyzed by gel electrophoresis. (Panel B, Western blot assay) Lysates from control COS-7 cells (COS-7) and from COS-7 cells transfected with a vector containing the coding region of CF-IFN (4.10) were analyzed by western blotting. In lysates from transfected cells, a single protein of ,25 kDa was detected by Western blotting using an antibody directed against the C-terminal His-Tag (lane designated 4.10). (Panel C, antiviral activity) Medium alone (D10), culture medium from COS-7 cells (COS-7), or culture medium from COS-7 cells stably transfected with an expression vector containing CF IFN (4.10) were monitored for antiviral activity by challenge assay. Media dilutions are shown to the left of the figure, while the presence or absence of challenge virus, the calculated antiviral titer, and the lane numbers are shown at the bottom of the figure.

4. Discussion This is the first report identifying interferon cDNA in channel catfish. In view of the marked sequence diversity between mammalian and teleost IFN, it is clear why earlier attempts at identifying fish IFN by

utilizing degenerate PCR primers and cross-reactive DNA:RNA hybridization were unsuccessful. Although amino acid similarities with mammalian and avian IFN genes were low, the sequence designated CF IFN is likely authentic IFN for the following reasons: (a) identity/similarity to recently

108

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

described ZF IFN was marked; (b) recombinant CF IFN protected CCO cells from CCV challenge; and (3) CF IFN mRNA was induced in CCO cells following treatments (i.e. infection with UV-CRV or exposure to poly[I:C]) that induce IFN in mammals and birds. However, although the genetic and functional assays described herein support the hypothesis that catfish contain IFN genes that are responsible, at least partially, for antiviral immunity, the type of IFN present in catfish is unclear. Although, overall amino acid similarity between CF IFN and IFN a genes is slightly higher than between CF IFN and IFN b or g genes (Table 1), several other observations suggest that catfish IFN is more b-like than a-like. Firstly, unlike many mammalian IFNs which are not glycosylated [43], CF IFN, like mammalian IFN b, contains a potential glycosylation site. Secondly, CF IFN contains three rather than the four or more cysteine residues present within mature mammalian and avian IFN a (Figs. 1 and 2). Thus, like human IFN b, CF IFN is able to form only a single intrachain disulfide bond, whereas mammalian and avian IFNs contain two disulfide bonds. Interestingly, the putative glycosylation site within CF IFN is found at a location similar to that seen in mouse IFN b, and, as suggested by Morehead et al. [42] may, in the absence of disulfide bond formation, represent an alternative mode of protein stabilization. Thirdly, Southern blot analysis indicates that two, or at most three, copies of the CF IFN gene are present within catfish DNA (Fig. 4). Since in mammals IFN a is present at multiple loci, and IFN b is present at only a single locus, the small number of bands observed in the Southern blot might indicate that CF IFN is an IFN a gene that has undergone only limited expansion, or that it is an IFN b gene that has undergone one or two rounds of duplication. Finally, the highly conserved CAWE sequence motif (equivalent to positions 181– 184 in the alignment shown in Fig. 2) found within all (or most) IFN a genes is notably absent from CF IFN [43]. In view of the above uncertainties, it is not possible to determine if CF IFN is a homolog of mammalian IFN a or IFN b, or if it is derived from a primordial gene that predated the divergence of the teleost and tetrapod lineages. To resolve these issues, future work will utilize functional studies to determine whether CF IFN is more a- or b-like. In addition, the genetic organization of CF IFN will be

examined and the presence or absence of introns (a feature of type II IFNs) determined. One marked difference between CF IFN and other bona fide IFNs is the apparent absence of a signal sequence within the catfish homolog. It is unlikely that our inability to demonstrate a signal sequence was due to our failure to detect the 50 end of the CF IFN message since . 100 nucleotides upstream of the putative translational start site were identified (Fig. 1). Within the upstream sequence neither an alternative translational start codon, nor a frame-shift caused by a sequencing error were detected. It is not known if the absence of a signal sequence is a feature of catfish IFN, or if the CF IFN cDNA identified here contains a deletion that eliminated the signal sequence and thus represents an expressed pseudogene. The absence of a signal sequence coupled with the reported downregulation of plasmid-borne genes in stably-transfected COS-7 [37] cells might explain the lower than expected yields of IFN-like activity in the spent culture medium of COS-7 cells transfected with a vector expressing recombinant CF IFN (Fig. 7). Thus while RT-PCR and western blot analyses indicate that CF IFN transcripts and protein are present in transfected cells, the absence of a signal sequence might block secretion of CF IFN and ensure that the bulk of the product remains in the cytoplasm. Future work will focus on determining if additional CF IFN genes exist in catfish and in related species, and on increasing expression of recombinant CF IFN protein. Despite the above uncertainties, comparison of CF IFN with the newly described ZF IFN strongly supports the hypothesis that the CF gene product is an authentic IFN molecule. Firstly, both CF IFN and ZF IFN are transiently induced by poly[I:C] (Fig. 6 and Ref. [15]). Secondly, in a pair-wise comparison CF IFN showed 39% identity/55% similarity to ZF IFN. In contrast, CF IFN showed only 9% identity/ 20% similarity to putative flounder IFN [14]. While this difference may reflect the phylogenetic distance between different fish species, it could also indicate that the previously identified flounder cDNA encodes a protein which, although possessing antiviral activity, is only distantly related, if at all, to IFN [43,44]. It remains to be determined whether CF IFN and ZF IFN inhibit virus replication through the induction of antiviral proteins such as PKR, 20 50 OAS, and RNase L, or whether they block virus replication

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

by functioning as type II IFNs and increase MHC expression and activate NK cells. While it is likely that fish cells possess a homolog of PKR [45,46], 20 50 OAS has not yet been detected in fish [47]. Thus, it is not known whether all aspects of IFN-induced antiviral immunity that are found in mammals are also present in fish. The inability to classify CF IFN as an a-, b-, or glike protein may indicate that fish do not possess the presumably more highly evolved IFN classes seen in mammals and birds. It is possible that since the divergence of tetrapods from bony fish , 450 million years ago [41], mammalian IFN genes underwent considerable duplication and diversification leading to the generation of the three main classes of IFN genes currently known, whereas teleost IFN genes failed to expand or diversify. Moreover, since the gene duplication that gave rise to the mammalian IFN a/ b families occurred after the divergence of birds and mammals [40], it is likely that the IFN gene(s) detected in extant fish species encodes a protein with both IFNa- and IFNb-like features. The situation with teleost IFN genes may be analogous to that of teleost and mammalian immunoglobulin (Ig) heavy chain genes. For example, although presumably derived from a common ancestor, fish possess only two Ig heavy chain isotypes (corresponding to Igm and Igd), whereas mammals possess five Ig isotypes (Igg, -m, a, -d, and -e), two of which (Igg and Iga) are characterized by the presence of four and two subclasses, respectively [48]. RT-PCR analysis of various lymphoid and fibroblast cell lines and freshly isolated PBLs indicate that CF IFN mRNA was clearly present in four of five catfish LCL, but not in uninduced CCO or BB cells. However, CF IFN mRNA was readily detected by RTPCR in CCO cells following infection with UV-CRV or treatment with poly[I:C]. UV-CRV had been shown previously to induce an antiviral factor in CCO cells with IFN-like properties. This result is consistent with the observation that other viruses within the family Reoviridae are potent inducers of IFN. Moreover, the kinetics of induction of CF IFN mRNA and antiviral activity are similar suggesting that CF IFN is responsible for the observed antiviral activity. In addition to induction with UV-CRV, CF IFN transcription was also upregulated following exposure of CCO cells to poly[I:C], a synthetic

109

dsRNA which is a potent inducer of IFN in other systems. Although it is formally possible that induction of the antiviral factor and transcription of the putative CF IFN gene are not causally related (i.e. the antiviral factor is not encoded by the putative CF IFN gene), the ability of COS-7 cells to secrete an antiviral factor following transfection with a mammalian expression vector containing the CF IFN gene supports the hypothesis that expression of CF IFN is directly responsible for antiviral activity. The identification of a putative CF IFN gene is the first step in elucidating pathways of innate immunity in catfish and other ectothermic vertebrates. Current genetic and/or functional evidence supports the existence of various effectors of innate immunity, including NK cells [26,32,48], complement [49], antimicrobial peptides [50], and IFN [15] in teleosts. Future work will focus on characterizing these elements more fully and determining how they interact to control viral infections in fish. Furthermore, this study demonstrates the utility of constructing, and systematically analyzing, EST libraries prepared from activated catfish lymphoid cells. In addition to the identification of the putative CF IFN gene, BLASTX analysis supports the existence of other IFN-related genes such as homologs of the mammalian IFN a/b receptor, interferon regulatory factors 2 and 4, as well as a large number of other immune-related gene products [51 and our unpublished observations]. Given the economic importance of channel catfish to aquaculture, and the utility of catfish as a model for teleost immunity, these studies are important not only because they will elucidate the role of innate responses in antiviral immunity in fish, but also because they may provide a way to better protect commercially-important fish against viral infection.

Acknowledgements This work was supported by grants from the USDA (NRI/CGP 99-35204-7844 and 2002-35204-12211) and the National Institutes of Health (RO1-AI-19530). Sequencing studies performed during the course of these studies were a collaborative effort involving Dr Greg Warr (Department of Biochemistry, Medical University of South Carolina, Charleston, SC),

110

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111

Dr Geoffrey Waldbieser (Catfish Genetics Research Unit, USDA, Stoneville, MS), Dr Charles Woodley (Department of Biochemistry, Univ. Miss. Med. Ctr., Jackson, MS), and Dr Vincent Ling (Genetics Institute/Wyeth Ayerst Research, Cambridge, MA). We thank Sudhir Kumar and Patrick Kolb (Arizona State University) for assistance in the construction and interpretation of the phylogenetic trees.

[15]

[16]

[17]

[18]

References [19] [1] Leonard WJ. Type I cytokines and interferons and their receptors. In: Paul WE, editor. Fundamental immunology, 4th ed. Philadelphia: Lippincott-Raven; 1999. p. 741–74. [2] Biron CA, Sen GC. Interferons and other cytokines. In: Knipe DM, Howley PM, editors. Fundamental virology. Philadelphia: Lippincott Williams and Wilkins; 2001. p. 321–51. [3] Pestka S, Langer JA, Zoon KC, Samuel CE. Interferons and their actions. Annu Rev Biochem 1987;56:727–77. [4] Eaton WD. Antiviral activity in four species of salmonids following exposure to poly inosinic:cytidylic acid. Dis Aquat Org 1990;9:193–8. [5] Jensen I, Robertsen B. Effect of double-stranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anemia virus and infectious pancreatic necrosis virus. Fish Shellfish Immunol 2002;13:221–41. [6] Jensen I, Larsen R, Robertsen B. An antiviral state induced in Chinook salmon embryo cells (CHSE-214) by transfection with the double-stranded RNA poly I:C. Fish Shellfish Immunol 2002;13:367–78. [7] Renault T, Torchy C, de Kinkelin P. Spectrophotometric method for titration of trout interferon and its application to rainbow trout fry experimentally infected with viral haemorrhagic septicaemia virus. Dis Aquat Org 1991;10:23 –9. [8] Rogel-Gaillard C, Chilmonczyk S, de Kinkelin P. In vitro induction of interferon-like activity from rainbow trout leucocytes stimulated by Egtved virus. Fish Shellfish Immunol 1993;3:383–94. [9] De Sena J, Rio GJ. Partial purification and characterization of RTG-2 fish cell interferon. Infect Immun 1975;11:815–22. [10] Snegaroff J. Induction of interferon synthesis in rainbow trout leucocytes by various homeotherm viruses. Fish Shellfish Immunol 1993;3:191–8. [11] Staeheli P, Yu Y-X, Grob R, Haller O. A double-stranded RNA inducible fish gene homologous to the murine influenza virus resistance gene Mx. Mol Cell Biol 1989;9:3117–21. [12] LaPatra SE, Kauda KA, Jones GR. Aquareovirus interference mediated resistance to infectious hematapoietic necrosis virus. Vet Res 1995;26:455–9. [13] Oie HK, Loh PC. Reovirus type 2: induction of viral resistance and interferon production in FHM cells. Proc Soc Exp Biol Med 1971;136:323 –69. [14] Tamai T, Shirahata S, Noguichi T, Sata N, Kimura S, Muradami H. Cloning and expression of flatfish (Paralichthys

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

olivaceus) interferon cDNA. Biochem Biophys Acta 1993; 1174:182– 6. Altmann SM, Mellon MT, Distel DL, Kim CH. Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio. J Virol 2003;77:1992–2002. Muller U, Steinhoff U, Reis LFL, Hemmi S, Pavlovic J, Zinkernagel RM, Aguet M. Functional role of type I and type II interferons in antiviral disease. Science 1994;264:1918–24. Janeway CA, Travers P, Walport M, Shlomchik M. Immunobiology: the immune system in health and disease, 5th ed. ; 2001. Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14:778– 809. Trobridge GD, Leong JC. Characterization of a rainbow trout Mx gene. J Interferon Cytokine Res 1995;15:691–702. De Maeyer E, de Maeyer-Guignard J. Interferons. The cytokine handbook, San Diego: Academic Press; 1991. p. 215 –239. Vilcek J, Sen GC. Interferons and other cytokines. In: Fields BN, Knipe DM, Hoyle DM, editors. Fundamental Virol, 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 341 –65. Deonarain R, Alcami A, Alexiou M, Dallman MJ, Gewert DR, Porter AC. Impaired anti-viral response and alpha/beta interferon induction in mice lacking beta interferon. J Virol 2000;3404– 9. Alcami A, Symons JA, Smith GL. The vaccinia virus soluble alpha/beta interferon (IFN) receptor binds to the cell surface and protects cells from the antiviral effects of IFN. J Virol 2000;74:11230–9. Eidson KM, Hobbs WE, Manning BJ, Carlson P, DeLuca NA. Expression of herpes simplex virus ICP0 inhibits the induction of interferon-stimulated genes by viral infection. J Virol 2002; 76:2180–91. Chinchar VG, Logue O, Antao A, Chinchar GD. Channel catfish reovirus (CRV) inhibits replication of channel catfish herpesvirus (CCV) by two distinct mechanisms: viral interference and induction of an anti-viral factor. Dis Aquat Org 1998;33:77–85. Hogan RJ, Waldbieser GC, Goudie CA, Antao AB, Godwin UB, Wilson WR, Miller NW, Clem LW, McConnell TJ, Wolters WR, Chinchar VG. Molecular and immunologic characterization of gynogenetic channel catfish. Marine Biotechnol 1999;1:317–27. Stuge TB, Wilson MR, Zhou H, Barker KS, Bengten E, Chinchar G, Miller NW, Clem LW. Development and analysis of various clonal alloantigen-dependent cytotoxic cell lines from channel catfish. J Immunol 2000;164:2971–7. Miller NW, Chinchar VG, Clem LW. Development of leukocyte cell lines from the channel catfish (Ictalurus punctatus). J Tissue Culture Meth 1994;16:1– 7. Miller NW, Rycyzyn MA, Wilson MR, Warr GW, Naftel JP, Clem LW. Development and characterization of channel catfish long term B cell lines. J Immunol 1994;152:2180– 9. Bowser P, Plumb J. Growth rates of a new cell line from channel catfish ovary and channel catfish virus replication at different temperatures. Can J Fish Aquat Sci 1980;37:871–3.

S. Long et al. / Developmental and Comparative Immunology 28 (2004) 97–111 [31] Gluzman Y. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 1981;23:175 –82. [32] Stuge TB, Yoshida S, Chinchar VG, Miller NW, Clem LW. Cytotoxic activity generated from channel catfish peripheral blood leukocytes in mixed leukocyte culture. Cell Immunol 1997;177:154 –61. [33] Altschul SF, Maden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389–402. [34] Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 2001; 17:1244–5. [35] Nielson H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Prot Engng 1997;10: 1 –6. [36] Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, Hofmann K, Bairoch A. The PROSITE database, its status in 2002. Nucleic Acids Res 2002;(2002):235 –8. [37] Sambrook JE, Russel DW. Molecular cloning: a laboratory manual, 3rd ed. Plainview, NY: Cold Spring Harbor Laboratory Press; 2001. [38] Taniguichi T. Regulation of cytokine gene expression. Annu Rev Immunol 1988;6:439– 64. [39] Darnell J, Lodish H, Baltimore D. Molecular cell biology. Scientific American books, New York: WH Freeman and Company; 1990. [40] Hughes AL, Roberts RM. Independent origin of interferon a and interferon b in birds and mammals. J Interferon Cytokine Res 2000;20:737–9. [41] Kumar S, Hedges SB. A molecular timescale for vertebrate evolution. Nature 1998;392:917–20.

111

[42] Morehead H, Johnston PD, Wetzel R. Roles of the 29–138 disulfide bond of subtype A of human alpha interferon on its antiviral activity and conformational stability. Biochemistry 1984;23:2500–4. [43] Sekellick MJ, Ferrandino AF, Hopkins DA, Marcus PI. Chicken interferon gene: cloning, expression, and analysis. J Interferon Res 1994;14:71–9. [44] Magor BG, Magor KE. Evolution of effectors and receptors of innate immunity. Dev Compar Immunol 2001;25:651–82. [45] Chinchar VG, Dholakia JN. Frog virus 3-induced translational shut-off: activation of an eIF-2 kinase in virus-infected cells. Virus Res 1989;14:207 –24. [46] Garner JN, Joshi B, Jagus R. Characterization of rainbow trout and zebrafish eukaryotic initiation factor 2 alpha and its response to endoplasmic reticulum stress and IPNV infection. Dev Compar Immunol 2003;27:217–32. [47] Cayley PJ, White RF, Antoniw F, Walesby NJ, Kerr IM. Distribution of the ppp(A2(p)nA-binding protein and interferon-related enzymes in animals, plants, and lower organisms. Biochem Biophys Res Commun 1982;108:1243–50. [48] Miller N, Wilson M, Bengten E, Stuge T, Warr G, Clem LW. Functional and molecular characterization of teleost leukocytes. Immunol Rev 1998;166:187 –97. [49] Yano T. The nonspecific immune system: humoral defenses. In: Iwama G, Nakanishi T, editors. The fish immune system: organisms, pathogens, and environment. London: Academic Press; 1996. p. 106–57. [50] Silphaduang U, Noga EJ. Peptide antibiotics in mast cells of fish. Nature 2001;414:268 –9. [51] Long S, Wilson M, Bengten E, Khayat M, Hawke N, Clem LW, Miller NW, Chinchar VG. Identification of apoptosis genes in the channel catfish and their role in cell-mediated immunity. FASEB J 2002;16:A1229.