- Email: [email protected]
Identification of a Differentially Expressed RNA Helicase by Gene Trapping
Biochemical and Biophysical Research Communications 262, 677– 684 (1999) Article ID bbrc.1999.1208, available online at http://www.idealibrary.com on
Identification of a Differentially Expressed RNA Helicase by Gene Trapping Daniel S. Wagner, 1 Lin Gan, and William H. Klein 2 Department of Biochemistry and Molecular Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Received July 20, 1999
A mouse line was generated that expressed a gene trap reporter construct, bgeo, in a dynamic pattern during embryonic development. Differential expression was seen within the developing eyes, limbs, heart, neural tube, and skeleton. Two transcripts were cloned that contained endogenous sequences fused to the gene trap vector sequence. Analysis of the endogenous sequences revealed that the reporter integrated within a gene belonging to a small group of eukaryotic superfamily I helicases. Unexpectedly, the majority of transcripts produced from the trapped locus were not affected by the insertion of the reporter. Although the function of the trapped helicase gene is unknown, its complex transcription patterns and widespread spatial– temporal distribution suggest that the gene product plays a role in RNA metabolism in multiple tissues and organs within the developing embryo. © 1999 Academic Press Key Words: gene trap; helicase; mouse embryogenesis; embryonic gene expression.
RNA helicases are important components of the cellular machinery [1]. Their primary function, to change the conformation of RNA by unwinding a doublestranded region, alters the biological activity of the RNA molecule and regulates access to other proteins. Individual RNA helicases have been directly implicated in regulating RNA splicing, RNA localization, ribosome assembly, translation initiation and mRNA stability. Proteins with this activity are expressed ubiquitously and in very specific patterns during embryogenesis and adulthood. Most functionally identified RNA helicases and their sequence homologs are divided into two superfamilies, 1 Current address: Department of Cell and Developmental Biology, University of Pennsylvania, Philadelphia, PA 19104. 2 To whom correspondence should be addressed at Department of Biochemistry and Molecular Biology, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 117, Houston, TX 77030. Fax: 713-790-0329. E-mail: [email protected].
I and II, which contain proteins with both DNA and RNA helicase activities [1–3]. Helicases share a loose NTP binding consensus, thought in most cases to be a component of an ATP or GTP hydrolysis motif. Outside of this domain, the families diverge, but within the separate families there is extensive conservation in domains near the NTP binding site. Superfamily I contains many prokaryotic and viral genes, but only a few eukaryotic family members have been identified [3]. These share significant homology and are more closely related to each other than to the rest of the family [3]. Two yeast genes, SEN1 and NAM7/UPF1, have been shown to play roles in RNA metabolism [4, 5]. SEN1 is required for proper splicing of tRNA molecules and is essential for viability. In contrast, NAM7/UPF1 is not necessary for cell viability and is involved in destabilizing mRNA with premature termination codons. Other members of this group are the mammalian homologs of NAM7/UPF1, RENT1/ HUPF1 in humans [6, 7] and Mov 10 in mice [8]. Besides their initial characterization, however, little is known about the functions of the mammalian members of this group. Functional conservation of the central domain of the RENT1/HUPF1 gene was shown by generating chimeric molecules with the C and N termini of UPF1 and the conserved central domain of HUPF1, which rescued yeast UPF1 mutants [7]. Expression of Mov 10 appears to be down-regulated during differentiation [8], but homozygous null ES cells appear phenotypically normal and differentiate in vitro as expected [9]. Gene trapping methods have been used extensively in a variety of organisms to identify genes with novel expression patterns and functions. For this study we generated a gene trap mouse line, GT-2, that expressed the reporter construct bgeo in a dynamic temporal and spatial pattern in the developing mouse embryo. Sequences obtained from this locus were highly similar to a human cDNA that in turn shared similarity with the eukaryotic members of the superfamily I class of RNA helicases. Analysis of transcripts produced from the
677
0006-291X/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. GT-2 expression patterns in E7.0 to E12.5 embryos. X-gal-stained embryos displayed a dynamic pattern of reporter gene expression throughout development. (A) A transverse section through a GT-2 heterozygous E7.0 embryo showing a variety of expression patterns. Strong staining is apparent in the posterior mesoderm near the primitive streak (arrowhead) while punctate staining appears in the embryonic ectoderm and more anterior and lateral mesoderm. (B) A dorsal view of a whole-mount X-gal-stained E12.5 embryo showing strong expression in stripes along the dorsal midline and lateral to the neural tube. (C) A lateral view of the embryo shown in B, showing complex expression in the eye, ear, heart, limbs and other organs. (D) A transverse section of an E10.5 embryo showing expression in the notochord (arrow), floorplate (arrowhead), and roofplate. (E) A transverse section of the eye of an E12.5 embryo showing strong expression in the retinal ganglion layer and punctate staining in the lens. (F) A transverse section of the heart of an E11.5 embryo with intense expression in cardiac cells. Note that the surrounding pericardium is negative. (G) A transverse section of the distal forelimb of an E11.5 embryo where expression is observed in the apical ectodermal ridge (arrowhead) as well as in cells scattered throughout the rest of the limb ectoderm and mesenchyme.
locus indicated that those responsible for the expression of the reporter construct represented only a small fraction of the total transcript population. While a function for the trapped helicase gene has not been revealed in this analysis, the complex transcript and expression patterns suggest that it plays a role in RNA metabolism in a variety of tissues and organs within the developing embryo. METHODS Generation of trapped ES cells and line GT-2. The gene-trapped ES cell clones were generated essentially as described [10] with one important modification; the vector pSAbgeo was electroporated as a supercoiled rather than linear form. Initial experiments indicated
that the rates of obtaining gene trap ES cell clones were the same for the two DNA conformations. bGeo encodes a protein with both b-galactosidase and neomycin phosphotransferase activity. X-gal staining was as described by Gossler and Zachgo [11]. Cloning of fusion transcripts. Clones #14 and #16 were obtained from a specifically primed library as described [12]. Briefly, a cDNA library was prepared from poly A RNA isolated from embryonic day (E)12.5 heterozygous GT-2 embryos. The first strand was synthesized with the lacZ-specific primer lacmer, GAGAGAGAGAGAGAGACTCGAGATGCGCTCAGGTCAAATTCAG. The library was constructed using a ZAP-cDNA Gigapack cloning kit (Stratagene, La Jolla, CA). The phage were screened with an oligonucleotide corresponding to the 59 end of the SAbgeo construct, ROSA, CTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTGG, which was 32Pradiolabeled at its 59 end with T4 kinase. The resulting positive clones were excised from the phage vector and sequenced.
678
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. GT-2 expression in the forming skeleton of E14.5 embryos. (A) Alcian blue staining. (B) X-gal staining. Embryos shown in A and B are littermates. The X-gal-stained embryo was cleared with benzyl alcohol and benzyl benzoate (1:2) to reveal the overlap and differences between the cartilaginous skeleton and GT-2 expression. Alcian blue and X-gal staining is seen in the forming ribs, in a periodic pattern along the spine, and in the front base and back of the skull. The most striking difference is the lack of GT-2 expression in Meckle’s cartilage (arrowheads in A and B). (C) GT-2 expression (left) and Alcian blue staining (right) in the forelimb. Strong expression is seen at the forming joints (elbow and wrist, arrows), but relatively little expression is observed in the long bones. (D) GT-2 expression (top) and Alcian blue staining (bottom) in a dissected digit 3. Expression is seen in the forming tendons (arrows) dorsal and ventral to the forming bones of the digit, as well in the forming joints (arrowheads). (E) GT-2 expression in the ribs of a neonate. Expression is seen in the cartilaginous rib (arrowhead) but not in the ossified rib (arrow). 679
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
PCR 4-3 cloning. The PCR 4-3 product was amplified by the GT-2 Clone #16 sequence primer, 21 5 prime 4, AGCCGGTGAGATGTGCAAG AAAAT, and the HumORF5 primer, hORF5 3, CCTAGGTGGTGGGCG GAAATG, as the 59 and 39 primers respectively. Thirtyfive cycles were performed with the following parameters: 94°C 1 min., 55°C 1 min., 72°C 2 min. The PCR product was phosphorylated at the 59 ends with T4 kinase and cloned into the Eco RV site of pBluescript II SK. Embryonic cartilage staining. E14.5 specimens were stained for cartilage by the chondroitin sulfate binding dye Alcian blue 8GX as described [13]. Northern blot analysis. Total RNA was isolated from adult brain (left cerebrum and cerebellum), heart and kidney from a wild-type C57B/6J female and a mixed hybrid 129/SVEV C57B/6J female of the GT-2 homozygous line. Blots were washed at 65°C to a final stringency of 0.13 SSC for EST4, 0.53 SSC for PCR4-3, and 13 SSC for bgeo. Sequence analysis. The 59 fusion clone sequences were used as input to a BLAST search of all nucleotide entries in GenBank. The search returned two identical entries that were highly similar to the Clone #16 endogenous sequence. One of these entries was HumORF5, accession number D29677. This sequence contains a putative open reading frame, SWISSPROT entry YY05_HUMAN, accession number P42694. This protein sequence was used to perform another BLAST search on protein and translated nucleotide sequences that returned a group of related sequences; MV10_MOUSE accession number P23249, NAM7_YEAST accession number P30771, HSU59323 (HUPF1) accession number U59323, HSU65533 (RENT1) accession number U65533, SEN1_YEAST accession number Q00416. The two human sequences RENT1 and HUPF1 had identical protein translations, and so a single entry was used in further analyses. The yeast gene NAM7 is identical to the yeast gene UPF1. These protein sequences were compiled and submitted to the BLOCKMAKER e-mail service ([email protected]). This service returns blocks of ungapped sequence alignments from two independent protein alignment programs MOTIF and GIBBS. Further information is available at http://blocks.fhcrc.org/. These results were compared against each other, and the blocks that were in agreement are presented in Fig. 4.
RESULTS AND DISCUSSION Dynamic expression of the bgeo reporter construct in GT-2 during embryogenesis. A screen of gene trap lines for restricted expression patterns led to the identification of GT-2, which showed a dynamic and complex pattern of bgeo expression in heterozygous embryos. Expression was observed at every stage examined, appearing in several tissues and organs at each stage. This pattern was accentuated by qualitative differences in expression within a given tissue. When X-gal-stained tissues were sectioned, two staining patterns were observed; a strong, generally cytoplasmic staining that is typically seen with an unmodified lacZ transgene, and a subcellular, localized pattern, where the staining was restricted to vesicles within the cytoplasm (Fig. 1A). In addition, some tissues in later staged embryos showed a general staining that was not restricted by cell boundaries after paraffin embedding and sectioning, suggesting that the bgeo activity was being secreted. The subcellular localization and secretion of some of the bgeo product implied that the gene trap vector had inserted into a gene
encoding a secreted protein. It was thus possible that sequences within this putative protein were directing the localization of the bgeo activity towards a secretion pathway. The qualitative differences in bgeo expression were evident as early as E7.0 (Fig. 1A). Although cells in most of the tissues of the embryo at this stage were positive, the ingressing cells of the primitive streak showed strong cytoplasmic staining (arrowhead in Fig. 1A) while cells of other tissues showed the punctate staining pattern. At E11.5 and E12.5, bgeo expression was detected in whole mount and sectioned embryos in a number of tissues (Figs. 1A–1G). Particularly notable was expression along the dorsal midline in central and lateral stripes (Fig. 1B). Histological sections through these embryos showed that the stained central stripe was composed of the neural tube and notochord (Fig. 1D). Lateral views of whole-mount stained embryos showed additional bgeo expression in the developing ears, eyes, heart, and limbs (Fig. 1C). Expression was not uniform within these organs as histological sections revealed intense expression in the retinal ganglion layer of the eye (Fig. 1E), myocardiocytes of the heart (Fig. 1F) and apical ectodermal ridge of the limb (Fig. 1G). bgeo expression was observed as early as E9.5 in the retina and presumptive lens of the eye and at E10.5 in the heart myocardium (not shown). At E14.5, intense bgeo expression was found in elements of the forming skeleton (Fig. 2). When embryos displaying this expression pattern were compared with littermates that were stained with Alcian blue, a dye that detects the cartilaginous elements of the forming skeleton, it was clear that much, but not all of the developing skeleton expressed the bgeo reporter. A striking example of cartilage elements not expressing bgeo was Meckle’s cartilage, a prominent structure running through the lower jaw (Figs. 2A and 2B, arrowheads). Closer examination of the forelimb uncovered the overlapping but not exclusive pattern of cartilage versus bgeo expression. Limbs showed strong bgeo expression in the forming joints (Fig. 2C, arrows) while the long bones were only weakly positive. In the developing autopod, the pattern was complex, the articular surfaces of the carpels were positive as well as the forming tendons. A lateral view of forelimb digit 3 showed expression of the tendons dorsal and ventral to the central axis of the digit (Fig. 2D, arrows) as well as in the forming joints (Fig. 2D, arrowheads). Some nonossified cartilage remained strongly positive for bgeo expression, as can be seen in the ribcages of newborn pups, where the cartilaginous rib is darkly stained (Fig. 2E, arrowhead) but the ossified rib is negative (Fig. 2E, arrow). In summary, the embryonic expression patterns suggested that the product of the trapped gene at
680
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
the GT-2 locus was used multiple times during development in a variety of distinct tissues and organs. Cloning and characterization of the GT-2 locus. As a first step towards understanding the basis of the complex GT-2 expression patterns, we attempted to clone the genomic region of insertion. We first generated a cDNA library from RNA containing GT-2 sequences. Two classes of fusion transcripts were cloned that contained 59 endogenous sequences spliced to the SAbgeo sequence and these clones were designated Clone #14 and Clone #16 (Fig. 3). Multiple clones with the Clone #16 sequence were isolated. Sequences immediately upstream of the SAbgeo vector sequences in both Clone #14 and Clone #16 ended with the AAG or CAG of the consensus splice donor and joined with the SAbgeo sequences at the expected acceptor site (Fig. 3). Clone #16 appeared to have an additional intron inserted between the Clone #14 sequence and the SAbgeo sequence. The two clones had different ATG initiation codons in frame with the ATG that initiated the bgeo coding sequence. It was thus possible that the two forms generated two different N-terminal fusion proteins that contained bgeo. These differences might reflect the qualitative difference in cytoplasmic localization that was observed in bgeo expression patterns during embryogenesis. Analysis of the cloned sequences revealed significant homology between GT-2 and a sequence in the GenBank database, HumORF5. Clone #16 and HumORF5 shared 93.8% identity over 113 bp. The 6274-bp HumORF5 sequence was obtained from an immature myeloid cell line KG1 cDNA library and encoded a predicted protein of 1942 amino acids. An alignment of HumORF5 and Clone #14 or Clone #16 from this region showed that the matched sequences were within the putative 59 UTR of the human transcript and extended throughout the length of the overlapping region (Fig. 3). The HumORF5 open reading frame began after the point of fusion to bgeo in Clone #16, but immediately upstream of the putative initiation codon of HumORF5 was a stop codon. Both the stop and initiation codons were in the same frame as the upstream ATG codons found in Clone #16, which in turn were in frame with the bgeo coding sequence and preceded the breakpoint between the endogenous Clone #16 sequence and the SAbgeo sequence. This implied that translation initiating from either of the Clone #16 upstream ATG codons would be terminated before reaching the major HumORF5 open reading frame. We therefore sought to clone additional mouse sequences within this region to determine if the stop and initiation codons found in human HumORF5 were conserved in mice. Matched primer pairs were designed corresponding to the GT-2 and HumORF5 sequences and RT-PCR was performed on E12.5 RNA to amplify mouse sequences spanning the putative stop and initiation
codons. The largest amplified product, PCR 4-3, was 89.3% identical to 610 bp of the corresponding HumORF5 sequence (Fig. 3). Most notably, the stop and the initiation codons present in the human sequence were also present in the mouse (Fig. 3). The HumORF5 sequence was used to search an EST database. Multiple human and mouse clones were found and three mouse EST clones were analyzed further. EST1 (AA170476), EST2 (AA154236) and EST3 (W20798) were overlapping clones whose sequences matched the 39 end of HumORF5, indicating that conservation between the human and mouse sequences was maintained at the 39 as well as the 59 end of the molecule. These results strongly suggested that GT-2 represented an insertion into the mouse homolog of the HumORF5 locus. Sequence analysis of HumORF5. To gain further insights into the HumORF5 locus, BLAST was used to search sequence databases with the predicted HumORF5 protein sequence. Matches with several previously identified sequences were revealed, all of which were related eukaryotic members of the RNA helicase superfamily I. The most related sequence was the mouse gene Mov 10, originally identified by cloning a viral integration site within the transcription unit. There is no known function for Mov 10, other than a putative purine nucleotide-binding site, which was conserved in HumORF5 (Fig. 4). The yeast genes SEN1 and Nam7/UPF1, and the human RENT1/HUPF1, also contained these regions of homology (Fig. 4). Alignment analysis identified several other regions of similarity that were common to all five sequences. The sequences shared by these proteins extended beyond the NTP binding motif (Fig. 4, Block A) to several blocks of homology toward the C-terminal end, spanning approximately 600 amino acids of HumORF5. These related blocks include the domains that define this family with the exception of domain IV [3]. However, sequences corresponding to this domain were present in HumORF5 between Blocks D and E but were not returned in the alignment analysis. Of the six residues mutated in dominant-negative NAM7/UPF1 mutants [14], three were conserved in all five proteins and were present within the identified homology blocks, indicating that these functionally important sites were conserved among the family members. The residue mutated in the SEN1 temperature-sensitive mutant, G1628 [4], located between Blocks F and G was also conserved in all five proteins (Fig. 4). The related regions contained the sequences that defined the consensus sequence for the RNA helicase superfamily I [2, 3]. However, there were some strong discrepancies between this consensus sequence and the HumORF5 sequence, notably the substitution of conserved hydrophobic residues for polar amino acids in the RNA helicase domains in the HumORF5 se-
681
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
682
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Sequence comparisons of HumORF5 with the eukaryotic members of RNA helicase superfamily I. The depicted alignment is a modified output of the BLOCKMAKER sequence analysis program. Blocks from the GIBBS output are presented that were in agreement with the blocks generated by MOTIF. The amino acid position is indicated by the numbers at the beginning of the sequence, and the distances between the blocks are indicated by the preceding numbers in parentheses. Residues conserved in all five sequences are shaded in light gray. Conserved sites that are mutated in NAM7/UPF1 dominant-negative mutants conserved in all five sequences are shaded in dark gray. HumORF5 residues that diverge from the general superfamily I consensus motif are boxed. Block B was extended 4 amino acids to include the two divergent residues.
quence (boxed in Blocks F and G in Fig. 4). It remains to be established whether these alterations affect the function of the HumORF5 protein as an RNA helicase.
Complex RNA expression patterns within the GT-2 locus. RNA extracted from brain, heart and kidney of wild type and GT-2 homozygous mice was hybridized with a probe derived from bgeo sequences. A 4.5-kb transcript was detected in RNA from GT-2 homozygous mice, but as expected, not in RNA from wild-type mice (Fig. 5). The transcript size was consistent with the fusion of the upstream endogenous sequences to the 4.0-kb bgeo mRNA. When the PCR 4-3 sequence was used as a probe, four major transcripts at approximately 10.0, 7.0, 1.8, and 1.1 kb were observed in both the wild-type and homozygous GT-2 samples (Fig. 5). Unexpectedly, no differences were observed between the wild type and homozygous GT-2 RNA samples. In particular, no 4.5-kb RNA transcript corresponding to the SAbgeo fusion transcript was detected by the PCR 4-3 probe in homozygous GT-2 RNA. These results indicated that the gene trap insertion did not disrupt the major transcripts detected by PCR 4-3. Two possible reasons might explain why no endogenous transcripts were disrupted by the SAbgeo insertion. First, the SAbgeo may be spliced out of most transcripts. In this case, essentially normal levels of wild-type products would be produced and the transcript detected by the bgeo probe would represent a minor, perhaps aberrant, product. Second, Clone #14 and Clone #16 may represent only minor transcripts produced from the GT-2 locus, and the PCR 4-3 probe may hybridize to transcripts not affected by the SAbgeo insertion. These transcripts might arise by differential splicing or differential promoter utilization. In this regard, we have been unable to detect any transcripts using Clone #16 as a probe. While it is difficult to interpret a negative result, it suggests that Clone #16 transcripts are present at very low levels in these RNA populations. Animals homozygous for the GT-2 allele are viable and fertile. Litter sizes from crosses of heterozygous GT-2 animals were normal (6-8 pups), indicating no decrease in viability associated with the gene trap allele. Homozygous GT-2 animals derived from these crosses were identified by breeding and were normal in appearance and fertility. In particular, no defects were observed in the skeletons of newborn homozygous GT-2 animals (not shown). Because the bgeo insertion failed to disrupt the major transcripts produced from the GT-2 locus, it was not surprising that no mutant phenotypes were observed in GT-2 homozygous mice.
FIG. 3. Alignment of the GT-2 locus with human HumORF5 and mouse PCR 4-3. The top portion of the figure is a schematic describing the relationships between the GT-2 sequences (Clone #14 and Clone #16), PCR 4-3, and HumORF5. The placement of the initiation and stop codons are indicated in red and blue, respectively. In the bottom portion of the figure, nucleotide sequence alignments are displayed with the translated sequences shown above them. The in-frame initiation codons from Clone #14 and Clone #16 are shown in red and the stop codon immediately downstream of the bgeo splice site is shown in blue. 683
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
well as subcellular localization. The D-E-A-D/H family protein Mvh, a potential murine homologue of vasa, is localized to a perinuclear granule in round spermatids but shows diffuse cytoplasmic staining during other germ cell stages [15]. Other members of the D-E-A-D/H box family also show spatial regulation of RNA or protein such as An3 [16], rck/p54 [17], vasa [18] and HEL-T [19], which is detected on the cell surface. While the intracellular structures and cell types involved with these helicase genes may be different, a common feature is a localized or regulated RNA helicase activity. ACKNOWLEDGMENTS This work was supported by an NICHD grant (HD22619) and the Welch Foundation (W.H.K.) and an NIHCD Training grant to D.S.W. Support for the DNA core sequencing facility was provided by an NCI Comprehensive Cancer Center Support Grant (CA16672).
REFERENCES FIG. 5. Northern analysis of GT-2 RNA expression in adult brain, heart and kidney. The top portion of the figure shows a Northern blot hybridized with the bgeo probe. The bottom portion of the figure shows a Northern blot hybridized with the PCR 4-3 probe.
CONCLUSIONS In the absence of a mutant phenotype in GT-2 homozygous mice, the predictions that can be made regarding the function of this helicase gene are limited. Nevertheless, our results indicate that a complex pattern of transcripts with widespread spatial and temporal distribution is produced from this locus. The results presented here demonstrate that gene trap insertions can uncover subtle aspects of gene expression. Because the SAbgeo vector was not included in the majority of transcripts produced from the GT-2 locus, it is likely that Clone #14 and Clone #16 represent rare transcripts that might not have been detected by a more conventional analysis. The differential expression of the GT-2 locus is in accordance with the two previously characterized mammalian family members. Rent1/HUPF1 transcripts were expressed in all tissues examined, but an additional smaller transcript was observed in a pancreatic cell line [7]. Mov10 expression appears to be down-regulated during differentiation of cells in culture [8]. The regulated expression of the GT-2 locus and these related helicases raises intriguing questions as to their roles in the developing embryo. The related helicase superfamily II has many more eukaryotic members than helicase superfamily I. Several of these have regulated expression patterns as
1. Schmid, S. R., and Linder, P. (1992) Mol. Microbiol. 6, 283–291. 2. Gorbalenya, A. E., and Koonin, E. V. (1993) Curr. Opin. Struct. Biol. 3, 419 – 429. 3. Koonin, E. V. (1992) Trends Biochem. Sci. 17, 495– 497. 4. DeMarini, D. J., Winey, M., Ursic, D., Webb, F., and Culbertson, M. R. (1992) Mol. Cell. Biol. 12, 2154 –2164. 5. Leeds, P., Peltz, S. W., Jacobson, A., and Culbertson, M. R. (1991) Genes Dev. 5, 2303–2314. 6. Applequist, S. E., Selg, M., Raman, C., and Jack, H. M. (1997) Nucleic Acids Res. 25, 814 – 821. 7. Perlick, H. A., Medghalchi, S. M., Spencer, F. A., Kendzior, R. J., Jr., and Dietz, H. C. (1996) Proc. Natl. Acad. Sci. USA 93, 10928 –10932. 8. Mooslehner, K., Muller, U., Karls, U., Hamann, L., and Harbers, K. (1991) Mol. Cell. Biol. 11, 886 – 893. 9. Hamann, L., Jensen, K., and Harbers, K. (1993) Gene 126, 279–284. 10. Friedrich, G., and Soriano, P. (1991) Genes Dev. 5, 1513–1523. 11. Gossler, A., and Zachgo, J. (1993) in Gene Targeting: A Practical Approach (Joyner, A. L., Ed.), pp. 181–227. Oxford University Press, New York, NY. 12. Chen, Z., Friedrich, G. A., and Soriano, P. (1994) Genes Dev. 8, 2293–2301. 13. Jegalian, B. G., and De Robertis, E. M. (1992) Cell 71, 901–910. 14. Leeds, P., Wood, J. M., Lee, B. S., and Culbertson, M. R. (1992) Mol. Cell. Biol. 12, 2165–2177. 15. Fujiwara, Y., Komiya, T., Kawabata, H., Sato, M., Fujimoto, H., Furusawa, M., and Noce, T. (1994) Proc. Natl. Acad Sci. USA 91, 12258 –12262. 16. Longo, F. J., Mathews, L., Gururajan, R., Chen, J., and Weeks, D. L. (1996) Mol. Reprod. Dev. 45, 491–502. 17. Akao, Y., Marukawa, O., Morikawa, H., Nakao, K., Kamei, M., Hachiya, T., and Tsujimoto, Y. (1995) Cancer Res. 55, 3444 –3449. 18. Hay, B., Jan, L. Y., and Jan, Y. N. (1988) Cell 55, 577–587. 19. Miazek, A., Brockhaus, M., Langen, H., Braun, A., and Kisielow, P. (1997) Eur. J. Immunol. 27, 3269 –3282.
684
Identification of a Differentially Expressed RNA Helicase by Gene Trapping Daniel S. Wagner, 1 Lin Gan, and William H. Klein 2 Department of Biochemistry and Molecular Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Received July 20, 1999
A mouse line was generated that expressed a gene trap reporter construct, bgeo, in a dynamic pattern during embryonic development. Differential expression was seen within the developing eyes, limbs, heart, neural tube, and skeleton. Two transcripts were cloned that contained endogenous sequences fused to the gene trap vector sequence. Analysis of the endogenous sequences revealed that the reporter integrated within a gene belonging to a small group of eukaryotic superfamily I helicases. Unexpectedly, the majority of transcripts produced from the trapped locus were not affected by the insertion of the reporter. Although the function of the trapped helicase gene is unknown, its complex transcription patterns and widespread spatial– temporal distribution suggest that the gene product plays a role in RNA metabolism in multiple tissues and organs within the developing embryo. © 1999 Academic Press Key Words: gene trap; helicase; mouse embryogenesis; embryonic gene expression.
RNA helicases are important components of the cellular machinery [1]. Their primary function, to change the conformation of RNA by unwinding a doublestranded region, alters the biological activity of the RNA molecule and regulates access to other proteins. Individual RNA helicases have been directly implicated in regulating RNA splicing, RNA localization, ribosome assembly, translation initiation and mRNA stability. Proteins with this activity are expressed ubiquitously and in very specific patterns during embryogenesis and adulthood. Most functionally identified RNA helicases and their sequence homologs are divided into two superfamilies, 1 Current address: Department of Cell and Developmental Biology, University of Pennsylvania, Philadelphia, PA 19104. 2 To whom correspondence should be addressed at Department of Biochemistry and Molecular Biology, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 117, Houston, TX 77030. Fax: 713-790-0329. E-mail: [email protected].
I and II, which contain proteins with both DNA and RNA helicase activities [1–3]. Helicases share a loose NTP binding consensus, thought in most cases to be a component of an ATP or GTP hydrolysis motif. Outside of this domain, the families diverge, but within the separate families there is extensive conservation in domains near the NTP binding site. Superfamily I contains many prokaryotic and viral genes, but only a few eukaryotic family members have been identified [3]. These share significant homology and are more closely related to each other than to the rest of the family [3]. Two yeast genes, SEN1 and NAM7/UPF1, have been shown to play roles in RNA metabolism [4, 5]. SEN1 is required for proper splicing of tRNA molecules and is essential for viability. In contrast, NAM7/UPF1 is not necessary for cell viability and is involved in destabilizing mRNA with premature termination codons. Other members of this group are the mammalian homologs of NAM7/UPF1, RENT1/ HUPF1 in humans [6, 7] and Mov 10 in mice [8]. Besides their initial characterization, however, little is known about the functions of the mammalian members of this group. Functional conservation of the central domain of the RENT1/HUPF1 gene was shown by generating chimeric molecules with the C and N termini of UPF1 and the conserved central domain of HUPF1, which rescued yeast UPF1 mutants [7]. Expression of Mov 10 appears to be down-regulated during differentiation [8], but homozygous null ES cells appear phenotypically normal and differentiate in vitro as expected [9]. Gene trapping methods have been used extensively in a variety of organisms to identify genes with novel expression patterns and functions. For this study we generated a gene trap mouse line, GT-2, that expressed the reporter construct bgeo in a dynamic temporal and spatial pattern in the developing mouse embryo. Sequences obtained from this locus were highly similar to a human cDNA that in turn shared similarity with the eukaryotic members of the superfamily I class of RNA helicases. Analysis of transcripts produced from the
677
0006-291X/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. GT-2 expression patterns in E7.0 to E12.5 embryos. X-gal-stained embryos displayed a dynamic pattern of reporter gene expression throughout development. (A) A transverse section through a GT-2 heterozygous E7.0 embryo showing a variety of expression patterns. Strong staining is apparent in the posterior mesoderm near the primitive streak (arrowhead) while punctate staining appears in the embryonic ectoderm and more anterior and lateral mesoderm. (B) A dorsal view of a whole-mount X-gal-stained E12.5 embryo showing strong expression in stripes along the dorsal midline and lateral to the neural tube. (C) A lateral view of the embryo shown in B, showing complex expression in the eye, ear, heart, limbs and other organs. (D) A transverse section of an E10.5 embryo showing expression in the notochord (arrow), floorplate (arrowhead), and roofplate. (E) A transverse section of the eye of an E12.5 embryo showing strong expression in the retinal ganglion layer and punctate staining in the lens. (F) A transverse section of the heart of an E11.5 embryo with intense expression in cardiac cells. Note that the surrounding pericardium is negative. (G) A transverse section of the distal forelimb of an E11.5 embryo where expression is observed in the apical ectodermal ridge (arrowhead) as well as in cells scattered throughout the rest of the limb ectoderm and mesenchyme.
locus indicated that those responsible for the expression of the reporter construct represented only a small fraction of the total transcript population. While a function for the trapped helicase gene has not been revealed in this analysis, the complex transcript and expression patterns suggest that it plays a role in RNA metabolism in a variety of tissues and organs within the developing embryo. METHODS Generation of trapped ES cells and line GT-2. The gene-trapped ES cell clones were generated essentially as described [10] with one important modification; the vector pSAbgeo was electroporated as a supercoiled rather than linear form. Initial experiments indicated
that the rates of obtaining gene trap ES cell clones were the same for the two DNA conformations. bGeo encodes a protein with both b-galactosidase and neomycin phosphotransferase activity. X-gal staining was as described by Gossler and Zachgo [11]. Cloning of fusion transcripts. Clones #14 and #16 were obtained from a specifically primed library as described [12]. Briefly, a cDNA library was prepared from poly A RNA isolated from embryonic day (E)12.5 heterozygous GT-2 embryos. The first strand was synthesized with the lacZ-specific primer lacmer, GAGAGAGAGAGAGAGACTCGAGATGCGCTCAGGTCAAATTCAG. The library was constructed using a ZAP-cDNA Gigapack cloning kit (Stratagene, La Jolla, CA). The phage were screened with an oligonucleotide corresponding to the 59 end of the SAbgeo construct, ROSA, CTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTGG, which was 32Pradiolabeled at its 59 end with T4 kinase. The resulting positive clones were excised from the phage vector and sequenced.
678
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. GT-2 expression in the forming skeleton of E14.5 embryos. (A) Alcian blue staining. (B) X-gal staining. Embryos shown in A and B are littermates. The X-gal-stained embryo was cleared with benzyl alcohol and benzyl benzoate (1:2) to reveal the overlap and differences between the cartilaginous skeleton and GT-2 expression. Alcian blue and X-gal staining is seen in the forming ribs, in a periodic pattern along the spine, and in the front base and back of the skull. The most striking difference is the lack of GT-2 expression in Meckle’s cartilage (arrowheads in A and B). (C) GT-2 expression (left) and Alcian blue staining (right) in the forelimb. Strong expression is seen at the forming joints (elbow and wrist, arrows), but relatively little expression is observed in the long bones. (D) GT-2 expression (top) and Alcian blue staining (bottom) in a dissected digit 3. Expression is seen in the forming tendons (arrows) dorsal and ventral to the forming bones of the digit, as well in the forming joints (arrowheads). (E) GT-2 expression in the ribs of a neonate. Expression is seen in the cartilaginous rib (arrowhead) but not in the ossified rib (arrow). 679
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
PCR 4-3 cloning. The PCR 4-3 product was amplified by the GT-2 Clone #16 sequence primer, 21 5 prime 4, AGCCGGTGAGATGTGCAAG AAAAT, and the HumORF5 primer, hORF5 3, CCTAGGTGGTGGGCG GAAATG, as the 59 and 39 primers respectively. Thirtyfive cycles were performed with the following parameters: 94°C 1 min., 55°C 1 min., 72°C 2 min. The PCR product was phosphorylated at the 59 ends with T4 kinase and cloned into the Eco RV site of pBluescript II SK. Embryonic cartilage staining. E14.5 specimens were stained for cartilage by the chondroitin sulfate binding dye Alcian blue 8GX as described [13]. Northern blot analysis. Total RNA was isolated from adult brain (left cerebrum and cerebellum), heart and kidney from a wild-type C57B/6J female and a mixed hybrid 129/SVEV C57B/6J female of the GT-2 homozygous line. Blots were washed at 65°C to a final stringency of 0.13 SSC for EST4, 0.53 SSC for PCR4-3, and 13 SSC for bgeo. Sequence analysis. The 59 fusion clone sequences were used as input to a BLAST search of all nucleotide entries in GenBank. The search returned two identical entries that were highly similar to the Clone #16 endogenous sequence. One of these entries was HumORF5, accession number D29677. This sequence contains a putative open reading frame, SWISSPROT entry YY05_HUMAN, accession number P42694. This protein sequence was used to perform another BLAST search on protein and translated nucleotide sequences that returned a group of related sequences; MV10_MOUSE accession number P23249, NAM7_YEAST accession number P30771, HSU59323 (HUPF1) accession number U59323, HSU65533 (RENT1) accession number U65533, SEN1_YEAST accession number Q00416. The two human sequences RENT1 and HUPF1 had identical protein translations, and so a single entry was used in further analyses. The yeast gene NAM7 is identical to the yeast gene UPF1. These protein sequences were compiled and submitted to the BLOCKMAKER e-mail service ([email protected]). This service returns blocks of ungapped sequence alignments from two independent protein alignment programs MOTIF and GIBBS. Further information is available at http://blocks.fhcrc.org/. These results were compared against each other, and the blocks that were in agreement are presented in Fig. 4.
RESULTS AND DISCUSSION Dynamic expression of the bgeo reporter construct in GT-2 during embryogenesis. A screen of gene trap lines for restricted expression patterns led to the identification of GT-2, which showed a dynamic and complex pattern of bgeo expression in heterozygous embryos. Expression was observed at every stage examined, appearing in several tissues and organs at each stage. This pattern was accentuated by qualitative differences in expression within a given tissue. When X-gal-stained tissues were sectioned, two staining patterns were observed; a strong, generally cytoplasmic staining that is typically seen with an unmodified lacZ transgene, and a subcellular, localized pattern, where the staining was restricted to vesicles within the cytoplasm (Fig. 1A). In addition, some tissues in later staged embryos showed a general staining that was not restricted by cell boundaries after paraffin embedding and sectioning, suggesting that the bgeo activity was being secreted. The subcellular localization and secretion of some of the bgeo product implied that the gene trap vector had inserted into a gene
encoding a secreted protein. It was thus possible that sequences within this putative protein were directing the localization of the bgeo activity towards a secretion pathway. The qualitative differences in bgeo expression were evident as early as E7.0 (Fig. 1A). Although cells in most of the tissues of the embryo at this stage were positive, the ingressing cells of the primitive streak showed strong cytoplasmic staining (arrowhead in Fig. 1A) while cells of other tissues showed the punctate staining pattern. At E11.5 and E12.5, bgeo expression was detected in whole mount and sectioned embryos in a number of tissues (Figs. 1A–1G). Particularly notable was expression along the dorsal midline in central and lateral stripes (Fig. 1B). Histological sections through these embryos showed that the stained central stripe was composed of the neural tube and notochord (Fig. 1D). Lateral views of whole-mount stained embryos showed additional bgeo expression in the developing ears, eyes, heart, and limbs (Fig. 1C). Expression was not uniform within these organs as histological sections revealed intense expression in the retinal ganglion layer of the eye (Fig. 1E), myocardiocytes of the heart (Fig. 1F) and apical ectodermal ridge of the limb (Fig. 1G). bgeo expression was observed as early as E9.5 in the retina and presumptive lens of the eye and at E10.5 in the heart myocardium (not shown). At E14.5, intense bgeo expression was found in elements of the forming skeleton (Fig. 2). When embryos displaying this expression pattern were compared with littermates that were stained with Alcian blue, a dye that detects the cartilaginous elements of the forming skeleton, it was clear that much, but not all of the developing skeleton expressed the bgeo reporter. A striking example of cartilage elements not expressing bgeo was Meckle’s cartilage, a prominent structure running through the lower jaw (Figs. 2A and 2B, arrowheads). Closer examination of the forelimb uncovered the overlapping but not exclusive pattern of cartilage versus bgeo expression. Limbs showed strong bgeo expression in the forming joints (Fig. 2C, arrows) while the long bones were only weakly positive. In the developing autopod, the pattern was complex, the articular surfaces of the carpels were positive as well as the forming tendons. A lateral view of forelimb digit 3 showed expression of the tendons dorsal and ventral to the central axis of the digit (Fig. 2D, arrows) as well as in the forming joints (Fig. 2D, arrowheads). Some nonossified cartilage remained strongly positive for bgeo expression, as can be seen in the ribcages of newborn pups, where the cartilaginous rib is darkly stained (Fig. 2E, arrowhead) but the ossified rib is negative (Fig. 2E, arrow). In summary, the embryonic expression patterns suggested that the product of the trapped gene at
680
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
the GT-2 locus was used multiple times during development in a variety of distinct tissues and organs. Cloning and characterization of the GT-2 locus. As a first step towards understanding the basis of the complex GT-2 expression patterns, we attempted to clone the genomic region of insertion. We first generated a cDNA library from RNA containing GT-2 sequences. Two classes of fusion transcripts were cloned that contained 59 endogenous sequences spliced to the SAbgeo sequence and these clones were designated Clone #14 and Clone #16 (Fig. 3). Multiple clones with the Clone #16 sequence were isolated. Sequences immediately upstream of the SAbgeo vector sequences in both Clone #14 and Clone #16 ended with the AAG or CAG of the consensus splice donor and joined with the SAbgeo sequences at the expected acceptor site (Fig. 3). Clone #16 appeared to have an additional intron inserted between the Clone #14 sequence and the SAbgeo sequence. The two clones had different ATG initiation codons in frame with the ATG that initiated the bgeo coding sequence. It was thus possible that the two forms generated two different N-terminal fusion proteins that contained bgeo. These differences might reflect the qualitative difference in cytoplasmic localization that was observed in bgeo expression patterns during embryogenesis. Analysis of the cloned sequences revealed significant homology between GT-2 and a sequence in the GenBank database, HumORF5. Clone #16 and HumORF5 shared 93.8% identity over 113 bp. The 6274-bp HumORF5 sequence was obtained from an immature myeloid cell line KG1 cDNA library and encoded a predicted protein of 1942 amino acids. An alignment of HumORF5 and Clone #14 or Clone #16 from this region showed that the matched sequences were within the putative 59 UTR of the human transcript and extended throughout the length of the overlapping region (Fig. 3). The HumORF5 open reading frame began after the point of fusion to bgeo in Clone #16, but immediately upstream of the putative initiation codon of HumORF5 was a stop codon. Both the stop and initiation codons were in the same frame as the upstream ATG codons found in Clone #16, which in turn were in frame with the bgeo coding sequence and preceded the breakpoint between the endogenous Clone #16 sequence and the SAbgeo sequence. This implied that translation initiating from either of the Clone #16 upstream ATG codons would be terminated before reaching the major HumORF5 open reading frame. We therefore sought to clone additional mouse sequences within this region to determine if the stop and initiation codons found in human HumORF5 were conserved in mice. Matched primer pairs were designed corresponding to the GT-2 and HumORF5 sequences and RT-PCR was performed on E12.5 RNA to amplify mouse sequences spanning the putative stop and initiation
codons. The largest amplified product, PCR 4-3, was 89.3% identical to 610 bp of the corresponding HumORF5 sequence (Fig. 3). Most notably, the stop and the initiation codons present in the human sequence were also present in the mouse (Fig. 3). The HumORF5 sequence was used to search an EST database. Multiple human and mouse clones were found and three mouse EST clones were analyzed further. EST1 (AA170476), EST2 (AA154236) and EST3 (W20798) were overlapping clones whose sequences matched the 39 end of HumORF5, indicating that conservation between the human and mouse sequences was maintained at the 39 as well as the 59 end of the molecule. These results strongly suggested that GT-2 represented an insertion into the mouse homolog of the HumORF5 locus. Sequence analysis of HumORF5. To gain further insights into the HumORF5 locus, BLAST was used to search sequence databases with the predicted HumORF5 protein sequence. Matches with several previously identified sequences were revealed, all of which were related eukaryotic members of the RNA helicase superfamily I. The most related sequence was the mouse gene Mov 10, originally identified by cloning a viral integration site within the transcription unit. There is no known function for Mov 10, other than a putative purine nucleotide-binding site, which was conserved in HumORF5 (Fig. 4). The yeast genes SEN1 and Nam7/UPF1, and the human RENT1/HUPF1, also contained these regions of homology (Fig. 4). Alignment analysis identified several other regions of similarity that were common to all five sequences. The sequences shared by these proteins extended beyond the NTP binding motif (Fig. 4, Block A) to several blocks of homology toward the C-terminal end, spanning approximately 600 amino acids of HumORF5. These related blocks include the domains that define this family with the exception of domain IV [3]. However, sequences corresponding to this domain were present in HumORF5 between Blocks D and E but were not returned in the alignment analysis. Of the six residues mutated in dominant-negative NAM7/UPF1 mutants [14], three were conserved in all five proteins and were present within the identified homology blocks, indicating that these functionally important sites were conserved among the family members. The residue mutated in the SEN1 temperature-sensitive mutant, G1628 [4], located between Blocks F and G was also conserved in all five proteins (Fig. 4). The related regions contained the sequences that defined the consensus sequence for the RNA helicase superfamily I [2, 3]. However, there were some strong discrepancies between this consensus sequence and the HumORF5 sequence, notably the substitution of conserved hydrophobic residues for polar amino acids in the RNA helicase domains in the HumORF5 se-
681
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
682
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Sequence comparisons of HumORF5 with the eukaryotic members of RNA helicase superfamily I. The depicted alignment is a modified output of the BLOCKMAKER sequence analysis program. Blocks from the GIBBS output are presented that were in agreement with the blocks generated by MOTIF. The amino acid position is indicated by the numbers at the beginning of the sequence, and the distances between the blocks are indicated by the preceding numbers in parentheses. Residues conserved in all five sequences are shaded in light gray. Conserved sites that are mutated in NAM7/UPF1 dominant-negative mutants conserved in all five sequences are shaded in dark gray. HumORF5 residues that diverge from the general superfamily I consensus motif are boxed. Block B was extended 4 amino acids to include the two divergent residues.
quence (boxed in Blocks F and G in Fig. 4). It remains to be established whether these alterations affect the function of the HumORF5 protein as an RNA helicase.
Complex RNA expression patterns within the GT-2 locus. RNA extracted from brain, heart and kidney of wild type and GT-2 homozygous mice was hybridized with a probe derived from bgeo sequences. A 4.5-kb transcript was detected in RNA from GT-2 homozygous mice, but as expected, not in RNA from wild-type mice (Fig. 5). The transcript size was consistent with the fusion of the upstream endogenous sequences to the 4.0-kb bgeo mRNA. When the PCR 4-3 sequence was used as a probe, four major transcripts at approximately 10.0, 7.0, 1.8, and 1.1 kb were observed in both the wild-type and homozygous GT-2 samples (Fig. 5). Unexpectedly, no differences were observed between the wild type and homozygous GT-2 RNA samples. In particular, no 4.5-kb RNA transcript corresponding to the SAbgeo fusion transcript was detected by the PCR 4-3 probe in homozygous GT-2 RNA. These results indicated that the gene trap insertion did not disrupt the major transcripts detected by PCR 4-3. Two possible reasons might explain why no endogenous transcripts were disrupted by the SAbgeo insertion. First, the SAbgeo may be spliced out of most transcripts. In this case, essentially normal levels of wild-type products would be produced and the transcript detected by the bgeo probe would represent a minor, perhaps aberrant, product. Second, Clone #14 and Clone #16 may represent only minor transcripts produced from the GT-2 locus, and the PCR 4-3 probe may hybridize to transcripts not affected by the SAbgeo insertion. These transcripts might arise by differential splicing or differential promoter utilization. In this regard, we have been unable to detect any transcripts using Clone #16 as a probe. While it is difficult to interpret a negative result, it suggests that Clone #16 transcripts are present at very low levels in these RNA populations. Animals homozygous for the GT-2 allele are viable and fertile. Litter sizes from crosses of heterozygous GT-2 animals were normal (6-8 pups), indicating no decrease in viability associated with the gene trap allele. Homozygous GT-2 animals derived from these crosses were identified by breeding and were normal in appearance and fertility. In particular, no defects were observed in the skeletons of newborn homozygous GT-2 animals (not shown). Because the bgeo insertion failed to disrupt the major transcripts produced from the GT-2 locus, it was not surprising that no mutant phenotypes were observed in GT-2 homozygous mice.
FIG. 3. Alignment of the GT-2 locus with human HumORF5 and mouse PCR 4-3. The top portion of the figure is a schematic describing the relationships between the GT-2 sequences (Clone #14 and Clone #16), PCR 4-3, and HumORF5. The placement of the initiation and stop codons are indicated in red and blue, respectively. In the bottom portion of the figure, nucleotide sequence alignments are displayed with the translated sequences shown above them. The in-frame initiation codons from Clone #14 and Clone #16 are shown in red and the stop codon immediately downstream of the bgeo splice site is shown in blue. 683
Vol. 262, No. 3, 1999
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
well as subcellular localization. The D-E-A-D/H family protein Mvh, a potential murine homologue of vasa, is localized to a perinuclear granule in round spermatids but shows diffuse cytoplasmic staining during other germ cell stages [15]. Other members of the D-E-A-D/H box family also show spatial regulation of RNA or protein such as An3 [16], rck/p54 [17], vasa [18] and HEL-T [19], which is detected on the cell surface. While the intracellular structures and cell types involved with these helicase genes may be different, a common feature is a localized or regulated RNA helicase activity. ACKNOWLEDGMENTS This work was supported by an NICHD grant (HD22619) and the Welch Foundation (W.H.K.) and an NIHCD Training grant to D.S.W. Support for the DNA core sequencing facility was provided by an NCI Comprehensive Cancer Center Support Grant (CA16672).
REFERENCES FIG. 5. Northern analysis of GT-2 RNA expression in adult brain, heart and kidney. The top portion of the figure shows a Northern blot hybridized with the bgeo probe. The bottom portion of the figure shows a Northern blot hybridized with the PCR 4-3 probe.
CONCLUSIONS In the absence of a mutant phenotype in GT-2 homozygous mice, the predictions that can be made regarding the function of this helicase gene are limited. Nevertheless, our results indicate that a complex pattern of transcripts with widespread spatial and temporal distribution is produced from this locus. The results presented here demonstrate that gene trap insertions can uncover subtle aspects of gene expression. Because the SAbgeo vector was not included in the majority of transcripts produced from the GT-2 locus, it is likely that Clone #14 and Clone #16 represent rare transcripts that might not have been detected by a more conventional analysis. The differential expression of the GT-2 locus is in accordance with the two previously characterized mammalian family members. Rent1/HUPF1 transcripts were expressed in all tissues examined, but an additional smaller transcript was observed in a pancreatic cell line [7]. Mov10 expression appears to be down-regulated during differentiation of cells in culture [8]. The regulated expression of the GT-2 locus and these related helicases raises intriguing questions as to their roles in the developing embryo. The related helicase superfamily II has many more eukaryotic members than helicase superfamily I. Several of these have regulated expression patterns as
1. Schmid, S. R., and Linder, P. (1992) Mol. Microbiol. 6, 283–291. 2. Gorbalenya, A. E., and Koonin, E. V. (1993) Curr. Opin. Struct. Biol. 3, 419 – 429. 3. Koonin, E. V. (1992) Trends Biochem. Sci. 17, 495– 497. 4. DeMarini, D. J., Winey, M., Ursic, D., Webb, F., and Culbertson, M. R. (1992) Mol. Cell. Biol. 12, 2154 –2164. 5. Leeds, P., Peltz, S. W., Jacobson, A., and Culbertson, M. R. (1991) Genes Dev. 5, 2303–2314. 6. Applequist, S. E., Selg, M., Raman, C., and Jack, H. M. (1997) Nucleic Acids Res. 25, 814 – 821. 7. Perlick, H. A., Medghalchi, S. M., Spencer, F. A., Kendzior, R. J., Jr., and Dietz, H. C. (1996) Proc. Natl. Acad. Sci. USA 93, 10928 –10932. 8. Mooslehner, K., Muller, U., Karls, U., Hamann, L., and Harbers, K. (1991) Mol. Cell. Biol. 11, 886 – 893. 9. Hamann, L., Jensen, K., and Harbers, K. (1993) Gene 126, 279–284. 10. Friedrich, G., and Soriano, P. (1991) Genes Dev. 5, 1513–1523. 11. Gossler, A., and Zachgo, J. (1993) in Gene Targeting: A Practical Approach (Joyner, A. L., Ed.), pp. 181–227. Oxford University Press, New York, NY. 12. Chen, Z., Friedrich, G. A., and Soriano, P. (1994) Genes Dev. 8, 2293–2301. 13. Jegalian, B. G., and De Robertis, E. M. (1992) Cell 71, 901–910. 14. Leeds, P., Wood, J. M., Lee, B. S., and Culbertson, M. R. (1992) Mol. Cell. Biol. 12, 2165–2177. 15. Fujiwara, Y., Komiya, T., Kawabata, H., Sato, M., Fujimoto, H., Furusawa, M., and Noce, T. (1994) Proc. Natl. Acad Sci. USA 91, 12258 –12262. 16. Longo, F. J., Mathews, L., Gururajan, R., Chen, J., and Weeks, D. L. (1996) Mol. Reprod. Dev. 45, 491–502. 17. Akao, Y., Marukawa, O., Morikawa, H., Nakao, K., Kamei, M., Hachiya, T., and Tsujimoto, Y. (1995) Cancer Res. 55, 3444 –3449. 18. Hay, B., Jan, L. Y., and Jan, Y. N. (1988) Cell 55, 577–587. 19. Miazek, A., Brockhaus, M., Langen, H., Braun, A., and Kisielow, P. (1997) Eur. J. Immunol. 27, 3269 –3282.
684