- Email: [email protected]
Identification of a dopamine receptor from Caenorhabditis elegans
Neuroscience Letters 319 (2002) 13–16 www.elsevier.com/locate/neulet
Identification of a dopamine receptor from Caenorhabditis elegans Satoshi Suo, Noboru Sasagawa, Shoichi Ishiura* Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo 153-8902, Japan Received 25 September 2001; received in revised form 1 November 2001; accepted 5 November 2001
Abstract The neurotransmitter dopamine regulates locomotion and egg laying in the nematode Caenorhabditis elegans. We have cloned a cDNA encoding the C. elegans G protein-coupled receptor (CeDOP1). The deduced amino acid sequence of the cloned cDNA shows high sequence similarities with D1-like dopamine receptors from other species. Three splice variants that differ in the length of the predicted third intracellular loop and C-terminal tail were identified. COS-7 cells transiently transfected with CeDOP1 showed high affinity binding to [ 125I]iodo-lysergic acid diethylamide (K D ¼ 3:43 ^ 0:83 nM). Dopamine showed the highest affinity (K i ¼ 0:186 mM) for this receptor among several vertebrate and invertebrate amine neurotransmitters tested, suggesting that the natural ligand for this receptor is dopamine. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Caenorhabditis elegans; Dopamine; Dopamine receptor; G protein-coupled receptor; [ 125I]iodo-lysergic acid diethylamide; Ligand binding
In mammals, at least five subtypes of dopamine receptor have been identified and all of them are G protein-coupled, seven transmembrane receptors [9]. According to their sequence similarities and pharmacological profiles, the receptors are divided into two classes, D1-like and D2like receptors. D1-like receptors are capable of activating adenylyl cyclase whereas D2-like receptors inhibit it. The free living nematode Caenorhabditis elegans is a good model organism in which to study the molecular mechanisms of the nervous system. The nervous system of C. elegans consists of 302 neurons and the precise position and synaptic connectivity of all neurons have been determined. Since the complete genome, powerful genetics, and germline transformations are available, C. elegans is desirable for molecular genetics. Furthermore, a number of assays have been developed by which the behaviors of the animals are easily quantified. Eight dopaminergic neurons exist in C. elegans [13], and several genes that act in dopamine synthesis and signaling have been identified and functionally characterized [17]. It is shown that dopamine plays important roles in the control of several behaviors. Exogenous dopamine inhibits locomotion and egg laying and treatment with dopamine receptor antagonists leads to the activation of egg laying and defecation * Corresponding author. Tel./fax: 181-3-5454-6739. E-mail address: [email protected] (S. Ishiura).
[11,16]. Mutant strains deficient in dopamine have defects in food sensation [3,10]. These facts suggest the presence of a functional dopaminergic system and, possibly, dopamine receptors. However, no dopamine receptors have as yet been identified from C. elegans. The C. elegans genome sequencing project revealed the presence of about 1000 putative G protein-coupled receptor genes, 18 of which are predicted to encode amine receptors [1]. We have carried out BLAST searches against the protein sequences predicted from the C. elegans genome by GeneFinder using mammalian dopamine receptor amino acid sequences. The predicted gene F15A8.5 showed high similarity to dopamine receptors. F15A8.5 was expressed heterologously in COS-7 cells. Radioligand binding studies showed that the receptor (CeDOP1) binds to dopamine with higher affinity than other biogenic amines. The oligonucleotides AS1 (GAAAAGGAACCTCGTAGA), AS2 (GATTTGTTTCGTTGTTGAAGGG), and SL1 (GGTTTAATTACCCAAGTTTGAG) were used for RT-PCR to clone F15A8.5 from the total RNA. AS1 and AS2 match the 3 0 untranslated region of F15A8.5 and SL1 matches the 5 0 trans-spliced leader sequence found on the C. elegans mRNAs [8]. A reverse-transcription of the total RNA was conducted with AS1 and the thermoscripte RTPCR System (Gibco BRL). PCR was carried out in a total volume of 20 ml containing LA buffer, 0.4 mM dNTPs, 0.5 units of LA-Taq polymerase (TAKARA), primers at 0.5 mM
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 1) 02 47 7- 6
14
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
and the synthesized cDNA. The reaction began with a single denaturation step at 978C for 3 min, followed by 30 cycles of 30 s at 978C, 30 s at 608C, and 3 min at 728C. Reactions were completed by one step at 728C for 10 min. The PCR products of 1.5 and 1.3 kbp were gel purified and ligated into pGEM-T easy vector (Promega). The cDNA sequences of the receptor were determined using a Thermo Sequenase fluorescent labeled primer cycle sequencing kit (Amersham Pharmacia) according to the manufacturer’s instructions, to identify three splice variants (CeDOP1L, CeDOP1M, and CeDOP1S). The coding sequences of CeDOP1M were amplified by PCR using oligonucleotides F (CCAAGTTTGCTAGCCACCATGAACGAT) and R (GGAAAATTTGAATTCCTATTCCGGAATG), which were designed to contain a Kozak consensus sequence on the 5 0 side of the initiation codon and restriction enzyme sites. The PCR product was digested with NheI and EcoRI, gel purified, and ligated into NheI and EcoRI digested pSecTagA (Invitrogen) to obtain pCeDOP1M. pCeDOP1M was transiently transfected into exponentially growing COS-7 cells using Fugene 6 (Roche) according to the manufacturer’s instructions. Thirty hours after transfection, the cells were washed with ice-cold 50 mM Tris–HCl (pH 7.4), scraped from the culture dish, centrifuged at 1500 £ g for 10 min, and resuspended in 50 mM Tris–HCl (pH 7.4). The cells were treated with a Polytron homogenizer (setting 8 for 10 s), and the homogenate was centrifuged at 40,000 £ g for 30 min. The resulting pellet was resuspended in the same buffer with a Polytron homogenizer, and the membrane was flash-frozen in aliquots and stored at 2808C. The protein concentration was determined using a DC Protein assay kit (Bio Rad). For the saturation experiment, aliquots of the COS-7 cell membrane preparation (10–15 mg) were added to assay tubes containing 50 mM Tris–HCl (pH 7.4), 2 mM ascorbic acid and increasing concentrations of [ 125I]iodo-lysergic acid diethylamide ([ 125I]iodo-LSD, 2200 Ci/mmol; NEN Life Science Products), and incubated for 30 min at room temperature. Nonspecific binding was determined by coincubation with 100 mM dopamine. For the competition experiments, aliquots of the membrane preparation were incubated with 0.5 nM [ 125I]iodo-LSD and various concentrations of competing ligands. Assays were terminated by rapid dilution with ice-cold 50 mM Tris–HCl (pH 7.4), followed by filtration through a Whatman GF/B filter presoaked in 0.3% polyethylenimine. The filters were washed three times with 3 ml of 50 mM Tris–HCl (pH 7.4). The radioligand remaining on the filters was detected by a gamma counter (Aloka). All data are representative of at least two independent experiments performed in duplicate. Analyses of the binding data were performed with the computer program Prism (GraphPad Software). The coding sequence prediction of the C. elegans genome with GeneFinder identified a putative gene, F15A8.5, that shows similarities to vertebrate and invertebrate D1-like
dopamine receptors. To clone the cDNA of this gene, RTPCR was carried out using oligonucleotides matching the 3 0 untranslated region of the gene and an SL1 trans-spliced leader sequence. The PCR products were cloned, and subsequent DNA sequence analyses revealed the presence of three splice variants. The cDNA sequences of the cloned receptors were roughly identical to the predicted sequence, but some differences were observed and the first exon and some exon–intron junctions were not predicted correctly. An extra exon was inserted in CeDOP1L and alternative splicing to generate a shorter exon 8 was observed in CeDOP1S as compared with CeDOP1M (Fig. 1A). The hydropathy profile of the deduced amino acid sequence of CeDOP1 predicts seven putative transmembrane domains (TMs). Many characteristic features of G proteincoupled receptors were identified in CeDOP1, such as a conserved DRY sequence at the end of TM III, several consensus phosphorylation sites for protein kinases in the intracellular loops, and a consensus N-glycosylation site in
Fig. 1. (A) The splicing of CeDOP1. Filled boxes indicate the transspliced SL1 leader sequence and open boxes indicate the protein-coding region. The upper and lower numbers indicate the length of the coding sequences and introns, respectively. The positions of the initiation (ATG) and termination (Stop) codons are also indicated. The 5 0 - and 3 0 -termini of the proteincoding region correspond to positions 9978 and 5502 of the cosmid F15A8, respectively. (B) Deduced amino acid sequence of CeDOP1L. The seven putative transmembrane domains estimated from comparisons with other dopamine receptors are underlined. The consensus phosphorylation sites for PKC, PKA, and casein kinase are marked by circles, triangles, and diamonds, respectively. The consensus N-glycosylation site is indicated by an asterisk. The amino acids in the solid box represent the region inserted in CeDOP1L, and the amino acids in the dotted box represent the region deleted in CeDOP1S.
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
the extracellular loop (Fig. 1B). CeDOP1 also contains amino acid residues thought to be important for the binding of dopamine, such as an aspartic acid residue in TM III and two serine residues in TM V [9]. The splice variants of CeDOP1 differ in their third intracellular loop and C-terminal tail. CeDOP1L has a 58 amino acid insertion after position 225, and residues 413–415 of CeDOP1L are deleted in CeDOP1S. Both alternatively spliced regions consist of a consensus phosphorylation site, but whether these variants show distinct phosphorylation remains to be examined. The deduced amino acid sequence of CeDOP1 shows significant similarity to vertebrate and invertebrate dopamine receptors. The highest homologies are with Drosophila melanogaster dopamine receptor DmDOP1 (48% identity) and Apis mellifera dopamine receptor AmDOP1 (48%). It has been reported that both DmDOP1 and AmDOP1 activate adenylyl cyclase and are classified as D1-like receptors [2,5,12]. As compared with mammalian dopamine receptors, CeDOP1 shows higher homology with D1-like receptors (43% for human D1 and D5) than D2-like receptors (40% for human D2 and D3 and 34% for D4), which suggests that CeDOP1 is a D1-like dopamine receptor (Fig. 2). The receptors of other biogenic amines and Drosophila dopamine receptor DAMB [4,6] show 30–40% identity. COS-7 cells were transiently transfected with pCeDOP1M. The membrane preparation from transfected cells was examined for its ability to bind [ 125I]iodo-LSD. Fig. 3A shows the saturation binding curve and Scatchard plot for [ 125I]iodo-LSD binding to CeDOP1M (K D ¼ 3:43 ^ 0:83 nM, Bmax ¼ 0:245 ^ 0:028 pmol/mg protein). COS-7 cells transfected with the control plasmid showed no specific binding (data not shown). Several biogenic amine neurotransmitters were tested for their ability
Fig. 2. Dendrogram of dopamine receptors. GENETYX-WIN was used to compare human D1 dopamine receptor (Accession number: P21728), D2 dopamine receptor (P14416), D3 dopamine receptor (P35462), D4 dopamine receptor (P21917), D5 dopamine receptor (P21918), Drosophila dopamine receptor DmDOP1 (S68780), Drosophila dopamine receptor DAMB (AAB08000), and Apis mellifera dopamine receptor AmDOP1 (CAA73841).
15
Fig. 3. (A) Saturation binding curve for [ 125I]iodo-LSD binding to CeDOP1M expressed in COS-7 cells. Inset: Scatchard plot of the same data. The estimated dissociation constant KD (3.43 ^ 0.83 nM) and maximal binding Bmax (0.245 ^ 0.028 pmol/mg membrane protein) were obtained by the Prism program. (B) Inhibition of specific [ 125I]iodo-LSD binding to CeDOP1M by biogenic amines. Membranes from CeDOP1M expressing cells were incubated with [ 125I]iodo-LSD (0.5 nM) in the presence of dopamine (K i ¼ 0:186 mM), norepinephrine (K i ¼ 3:73 mM), serotonin (K i ¼ 16:2 mM), octopamine (K i ¼ 28:3 mM), or tyramine (K i ¼ 62:1 mM). The results are shown as percentages of specific bindings in the absence of the competitors.
to displace [ 125I]iodo-LSD binding to CeDOP1M (Fig. 3B). Dopamine was the most potent competitor among the drugs tested with a calculated dissociation constant (Ki) of 0.186 mM. In contrast, norepinephrine (K i ¼ 3:73 mM), serotonin (K i ¼ 16:2 mM), octopamine (K i ¼ 28:3 mM), and tyramine (K i ¼ 62:1 mM) were less potent competitors, and drug concentrations greater than 10 24 M were required to displace 90% of [ 125I]iodo-LSD binding. CeDOP1M expressing cells were also examined for their ability to bind the D1-like dopamine receptor antagonist [ 3H]SCH23390 (10 nM) and the D2-like dopamine receptor antagonist [ 3H]spiperone (10 nM), but no specific binding was observed (data not shown). In this study we have cloned and characterized the C. elegans dopamine receptor (CeDOP1), which is the first dopamine receptor identified from C. elegans. Analysis of
16
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
the deduced amino acid sequence of CeDOP1 revealed it to contain conserved amino acid residues important for dopamine binding, and the overall sequence shows high homology with D1-like dopamine receptors. D1-like receptors tend to have a short third intracellular loop and a long Cterminal tail. CeDOP1 also has a relatively short third intracellular loop and a long C-terminal tail, except for the CeDOP1L variant, which has a longer third intracellular loop than some D2-like dopamine receptors. These features of the amino acid sequence of CeDOP1 suggest that this receptor belongs to the D1-like family of dopamine receptors. Mammalian D1-like receptors do not have introns in their coding sequences; however, CeDOP1 contains introns, and we also found three splice variants (CeDOP1L, CeDOP1M, and CeDOP1S). The alternative splicings occur in the regions coding the third intracellular loop and the C-terminus. The inserted or deleted amino acid sequences contained consensus phosphorylation sites. Dopamine D2 receptor has been reported to have a variation in the third intracellular loop, and these variants have almost the same pharmacological profile but show differing functional properties [1,7,14,15]. Although we have only characterized the pharmacological properties of CeDOP1M, CeDOP1L and CeDOP1S should be almost identical to CeDOP1M, since variations are outside of the TMs. Radioligand binding studies using [ 125I]iodo-LSD confirmed that CeDOP1 is a dopamine receptor. We have expressed CeDOP1M in COS-7 cells and showed that dopamine displaces [ 125I]iodo-LSD binding with the greatest potency among several amine neurotransmitters. However, CeDOP1M shows no specific binding to the D1-like dopamine receptor antagonist [ 3H]SCH23390. Dopamine receptors from insects, DmDOP1 and AmDOP1, also show low affinities for this compound [2,12]. A low affinity for benzazepines might be a general property of invertebrate dopamine receptors. In C. elegans, dopamine is required for food sensation. Dopaminergic neurons transduce the mechanosensory stimuli to modulate the locomotory rate [10]. It is also known that exogenously applied dopamine suppresses egg laying in animals, and that D2-like receptor antagonists have an opposite effect on egg laying [11,16]. Future analyses of the expression pattern of CeDOP1 and the isolation of a mutant lacking CeDOP1 will clarify the behavior regulated by CeDOP1, and which G protein is coupled by CeDOP1 in the C. elegans nervous system. We are grateful to Drs A. Kawaguchi and A. IwamotoKihara for valuable discussions. S.S. is supported by JSPS Research Fellowship for Young Scientists. This work is supported in part by a Grant-in-Aid for Scientific Research on Priority Areas (C) – Advanced Brain Science Project – from the Ministry of Education, Culture, Sports, and Science and Technology, Japan.
[1] Bargmann, C.I., Neurobiology of the Caenorhabditis elegans genome, Science, 282 (1998) 2028–2033. [2] Blenau, W., Erber, J. and Baumann, A., Characterization of a dopamine D1 receptor from Apis mellifera: cloning, functional expression, pharmacology, and mRNA localization in the brain, J. Neurochem., 70 (1998) 15–23. [3] Duerr, J.S., Frisby, D.L., Gaskin, J., Duke, A., Asermely, K., Huddleston, D., Eiden, L.E. and Rand, J.B., The cat-1 gene of Caenorhabditis elegans encodes a vesicular monoamine transporter required for specific monoamine-dependent behaviors, J. Neurosci., 19 (1999) 72–84. [4] Feng, G., Hannan, F., Reale, V., Honm, Y.Y., Kousky, C.T., Evans, P.D. and Hall, L.M., Cloning and functional characterization of a novel dopamine receptor from Drosophila melanogaster, J. Neurosci., 16 (1996) 3925–3933. [5] Gotzes, F., Balfanz, S. and Baumann, A., Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors, Recept. Channels, 2 (1994) 131–141. [6] Han, K.A., Millar, N.S., Grotewiel, M.S. and Davis, R.L., DAMB, a novel dopamine receptor expressed specifically in Drosophila mushroom bodies, Neuron, 16 (1996) 1127– 1135. [7] Itokawa, M., Toru, M., Ito, K., Tsuga, H., Kameyama, K., Haga, T., Arinami, T. and Hamaguchi, H., Sequestration of the short and long isoforms of dopamine D2 receptors expressed in Chinese hamster ovary cells, Mol. Pharmacol., 49 (1996) 560–566. [8] Krause, M. and Hirsh, D., A trans-spliced leader sequence on actin mRNA in C. elegans, Cell, 49 (1987) 753–761. [9] Missale, C., Nash, S.R., Robinson, S.W., Jaber, M. and Caron, M.G., Dopamine receptors: from structure to function, Physiol. Rev., 78 (1998) 189–225. [10] Sawin, E.R., Ranganathan, R. and Horvitz, H.R., C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway, Neuron, 26 (2000) 619–631. [11] Schafer, W.R. and Kenyon, C.J., A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans, Nature, 375 (1995) 73–78. [12] Sugamori, K.S., Demchyshyn, L.L., McConkey, F., Forte, M.A. and Niznik, H.B., Protein, Nucleotide A primordial dopamine D1-like adenylyl cyclase-linked receptor from Drosophila melanogaster displaying poor affinity for benzazepines, FEBS Lett., 362 (1995) 131–138. [13] Sulston, J., Dew, M. and Brenner, S., Dopaminergic neurons in the nematode Caenorhabditis elegans, J. Comp. Neurol., 15 (1975) 215–226. [14] Usiello, A., Baik, J.H., Rouge-Pont, F., Picetti, R., Dierich, A., LeMeur, M., Piazza, P.V. and Borrelli, E., Distinct functions of the two isoforms of dopamine D2 receptors, Nature, 408 (2000) 199–203. [15] Wang, Y., Xu, R., Sasaoka, T., Tonegawa, S., Kung, M.P. and Sankoorikal, E.B., Dopamine D2 long receptor-deficient mice display alterations in striatum-dependent functions, J. Neurosci., 20 (2000) 8305–8314. [16] Weinshenker, D., Garriga, G. and Thomas, J.H., Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans, J. Neurosci., 15 (1995) 6975– 6985. [17] Wintle, R.F. and Van Tol, H.H., Dopamine signaling in Caenorhabditis elegans – potential for parkinsonism research, Parkinsonism Relat. Disord., 7 (2001) 177–183.
Identification of a dopamine receptor from Caenorhabditis elegans Satoshi Suo, Noboru Sasagawa, Shoichi Ishiura* Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo 153-8902, Japan Received 25 September 2001; received in revised form 1 November 2001; accepted 5 November 2001
Abstract The neurotransmitter dopamine regulates locomotion and egg laying in the nematode Caenorhabditis elegans. We have cloned a cDNA encoding the C. elegans G protein-coupled receptor (CeDOP1). The deduced amino acid sequence of the cloned cDNA shows high sequence similarities with D1-like dopamine receptors from other species. Three splice variants that differ in the length of the predicted third intracellular loop and C-terminal tail were identified. COS-7 cells transiently transfected with CeDOP1 showed high affinity binding to [ 125I]iodo-lysergic acid diethylamide (K D ¼ 3:43 ^ 0:83 nM). Dopamine showed the highest affinity (K i ¼ 0:186 mM) for this receptor among several vertebrate and invertebrate amine neurotransmitters tested, suggesting that the natural ligand for this receptor is dopamine. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Caenorhabditis elegans; Dopamine; Dopamine receptor; G protein-coupled receptor; [ 125I]iodo-lysergic acid diethylamide; Ligand binding
In mammals, at least five subtypes of dopamine receptor have been identified and all of them are G protein-coupled, seven transmembrane receptors [9]. According to their sequence similarities and pharmacological profiles, the receptors are divided into two classes, D1-like and D2like receptors. D1-like receptors are capable of activating adenylyl cyclase whereas D2-like receptors inhibit it. The free living nematode Caenorhabditis elegans is a good model organism in which to study the molecular mechanisms of the nervous system. The nervous system of C. elegans consists of 302 neurons and the precise position and synaptic connectivity of all neurons have been determined. Since the complete genome, powerful genetics, and germline transformations are available, C. elegans is desirable for molecular genetics. Furthermore, a number of assays have been developed by which the behaviors of the animals are easily quantified. Eight dopaminergic neurons exist in C. elegans [13], and several genes that act in dopamine synthesis and signaling have been identified and functionally characterized [17]. It is shown that dopamine plays important roles in the control of several behaviors. Exogenous dopamine inhibits locomotion and egg laying and treatment with dopamine receptor antagonists leads to the activation of egg laying and defecation * Corresponding author. Tel./fax: 181-3-5454-6739. E-mail address: [email protected] (S. Ishiura).
[11,16]. Mutant strains deficient in dopamine have defects in food sensation [3,10]. These facts suggest the presence of a functional dopaminergic system and, possibly, dopamine receptors. However, no dopamine receptors have as yet been identified from C. elegans. The C. elegans genome sequencing project revealed the presence of about 1000 putative G protein-coupled receptor genes, 18 of which are predicted to encode amine receptors [1]. We have carried out BLAST searches against the protein sequences predicted from the C. elegans genome by GeneFinder using mammalian dopamine receptor amino acid sequences. The predicted gene F15A8.5 showed high similarity to dopamine receptors. F15A8.5 was expressed heterologously in COS-7 cells. Radioligand binding studies showed that the receptor (CeDOP1) binds to dopamine with higher affinity than other biogenic amines. The oligonucleotides AS1 (GAAAAGGAACCTCGTAGA), AS2 (GATTTGTTTCGTTGTTGAAGGG), and SL1 (GGTTTAATTACCCAAGTTTGAG) were used for RT-PCR to clone F15A8.5 from the total RNA. AS1 and AS2 match the 3 0 untranslated region of F15A8.5 and SL1 matches the 5 0 trans-spliced leader sequence found on the C. elegans mRNAs [8]. A reverse-transcription of the total RNA was conducted with AS1 and the thermoscripte RTPCR System (Gibco BRL). PCR was carried out in a total volume of 20 ml containing LA buffer, 0.4 mM dNTPs, 0.5 units of LA-Taq polymerase (TAKARA), primers at 0.5 mM
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 1) 02 47 7- 6
14
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
and the synthesized cDNA. The reaction began with a single denaturation step at 978C for 3 min, followed by 30 cycles of 30 s at 978C, 30 s at 608C, and 3 min at 728C. Reactions were completed by one step at 728C for 10 min. The PCR products of 1.5 and 1.3 kbp were gel purified and ligated into pGEM-T easy vector (Promega). The cDNA sequences of the receptor were determined using a Thermo Sequenase fluorescent labeled primer cycle sequencing kit (Amersham Pharmacia) according to the manufacturer’s instructions, to identify three splice variants (CeDOP1L, CeDOP1M, and CeDOP1S). The coding sequences of CeDOP1M were amplified by PCR using oligonucleotides F (CCAAGTTTGCTAGCCACCATGAACGAT) and R (GGAAAATTTGAATTCCTATTCCGGAATG), which were designed to contain a Kozak consensus sequence on the 5 0 side of the initiation codon and restriction enzyme sites. The PCR product was digested with NheI and EcoRI, gel purified, and ligated into NheI and EcoRI digested pSecTagA (Invitrogen) to obtain pCeDOP1M. pCeDOP1M was transiently transfected into exponentially growing COS-7 cells using Fugene 6 (Roche) according to the manufacturer’s instructions. Thirty hours after transfection, the cells were washed with ice-cold 50 mM Tris–HCl (pH 7.4), scraped from the culture dish, centrifuged at 1500 £ g for 10 min, and resuspended in 50 mM Tris–HCl (pH 7.4). The cells were treated with a Polytron homogenizer (setting 8 for 10 s), and the homogenate was centrifuged at 40,000 £ g for 30 min. The resulting pellet was resuspended in the same buffer with a Polytron homogenizer, and the membrane was flash-frozen in aliquots and stored at 2808C. The protein concentration was determined using a DC Protein assay kit (Bio Rad). For the saturation experiment, aliquots of the COS-7 cell membrane preparation (10–15 mg) were added to assay tubes containing 50 mM Tris–HCl (pH 7.4), 2 mM ascorbic acid and increasing concentrations of [ 125I]iodo-lysergic acid diethylamide ([ 125I]iodo-LSD, 2200 Ci/mmol; NEN Life Science Products), and incubated for 30 min at room temperature. Nonspecific binding was determined by coincubation with 100 mM dopamine. For the competition experiments, aliquots of the membrane preparation were incubated with 0.5 nM [ 125I]iodo-LSD and various concentrations of competing ligands. Assays were terminated by rapid dilution with ice-cold 50 mM Tris–HCl (pH 7.4), followed by filtration through a Whatman GF/B filter presoaked in 0.3% polyethylenimine. The filters were washed three times with 3 ml of 50 mM Tris–HCl (pH 7.4). The radioligand remaining on the filters was detected by a gamma counter (Aloka). All data are representative of at least two independent experiments performed in duplicate. Analyses of the binding data were performed with the computer program Prism (GraphPad Software). The coding sequence prediction of the C. elegans genome with GeneFinder identified a putative gene, F15A8.5, that shows similarities to vertebrate and invertebrate D1-like
dopamine receptors. To clone the cDNA of this gene, RTPCR was carried out using oligonucleotides matching the 3 0 untranslated region of the gene and an SL1 trans-spliced leader sequence. The PCR products were cloned, and subsequent DNA sequence analyses revealed the presence of three splice variants. The cDNA sequences of the cloned receptors were roughly identical to the predicted sequence, but some differences were observed and the first exon and some exon–intron junctions were not predicted correctly. An extra exon was inserted in CeDOP1L and alternative splicing to generate a shorter exon 8 was observed in CeDOP1S as compared with CeDOP1M (Fig. 1A). The hydropathy profile of the deduced amino acid sequence of CeDOP1 predicts seven putative transmembrane domains (TMs). Many characteristic features of G proteincoupled receptors were identified in CeDOP1, such as a conserved DRY sequence at the end of TM III, several consensus phosphorylation sites for protein kinases in the intracellular loops, and a consensus N-glycosylation site in
Fig. 1. (A) The splicing of CeDOP1. Filled boxes indicate the transspliced SL1 leader sequence and open boxes indicate the protein-coding region. The upper and lower numbers indicate the length of the coding sequences and introns, respectively. The positions of the initiation (ATG) and termination (Stop) codons are also indicated. The 5 0 - and 3 0 -termini of the proteincoding region correspond to positions 9978 and 5502 of the cosmid F15A8, respectively. (B) Deduced amino acid sequence of CeDOP1L. The seven putative transmembrane domains estimated from comparisons with other dopamine receptors are underlined. The consensus phosphorylation sites for PKC, PKA, and casein kinase are marked by circles, triangles, and diamonds, respectively. The consensus N-glycosylation site is indicated by an asterisk. The amino acids in the solid box represent the region inserted in CeDOP1L, and the amino acids in the dotted box represent the region deleted in CeDOP1S.
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
the extracellular loop (Fig. 1B). CeDOP1 also contains amino acid residues thought to be important for the binding of dopamine, such as an aspartic acid residue in TM III and two serine residues in TM V [9]. The splice variants of CeDOP1 differ in their third intracellular loop and C-terminal tail. CeDOP1L has a 58 amino acid insertion after position 225, and residues 413–415 of CeDOP1L are deleted in CeDOP1S. Both alternatively spliced regions consist of a consensus phosphorylation site, but whether these variants show distinct phosphorylation remains to be examined. The deduced amino acid sequence of CeDOP1 shows significant similarity to vertebrate and invertebrate dopamine receptors. The highest homologies are with Drosophila melanogaster dopamine receptor DmDOP1 (48% identity) and Apis mellifera dopamine receptor AmDOP1 (48%). It has been reported that both DmDOP1 and AmDOP1 activate adenylyl cyclase and are classified as D1-like receptors [2,5,12]. As compared with mammalian dopamine receptors, CeDOP1 shows higher homology with D1-like receptors (43% for human D1 and D5) than D2-like receptors (40% for human D2 and D3 and 34% for D4), which suggests that CeDOP1 is a D1-like dopamine receptor (Fig. 2). The receptors of other biogenic amines and Drosophila dopamine receptor DAMB [4,6] show 30–40% identity. COS-7 cells were transiently transfected with pCeDOP1M. The membrane preparation from transfected cells was examined for its ability to bind [ 125I]iodo-LSD. Fig. 3A shows the saturation binding curve and Scatchard plot for [ 125I]iodo-LSD binding to CeDOP1M (K D ¼ 3:43 ^ 0:83 nM, Bmax ¼ 0:245 ^ 0:028 pmol/mg protein). COS-7 cells transfected with the control plasmid showed no specific binding (data not shown). Several biogenic amine neurotransmitters were tested for their ability
Fig. 2. Dendrogram of dopamine receptors. GENETYX-WIN was used to compare human D1 dopamine receptor (Accession number: P21728), D2 dopamine receptor (P14416), D3 dopamine receptor (P35462), D4 dopamine receptor (P21917), D5 dopamine receptor (P21918), Drosophila dopamine receptor DmDOP1 (S68780), Drosophila dopamine receptor DAMB (AAB08000), and Apis mellifera dopamine receptor AmDOP1 (CAA73841).
15
Fig. 3. (A) Saturation binding curve for [ 125I]iodo-LSD binding to CeDOP1M expressed in COS-7 cells. Inset: Scatchard plot of the same data. The estimated dissociation constant KD (3.43 ^ 0.83 nM) and maximal binding Bmax (0.245 ^ 0.028 pmol/mg membrane protein) were obtained by the Prism program. (B) Inhibition of specific [ 125I]iodo-LSD binding to CeDOP1M by biogenic amines. Membranes from CeDOP1M expressing cells were incubated with [ 125I]iodo-LSD (0.5 nM) in the presence of dopamine (K i ¼ 0:186 mM), norepinephrine (K i ¼ 3:73 mM), serotonin (K i ¼ 16:2 mM), octopamine (K i ¼ 28:3 mM), or tyramine (K i ¼ 62:1 mM). The results are shown as percentages of specific bindings in the absence of the competitors.
to displace [ 125I]iodo-LSD binding to CeDOP1M (Fig. 3B). Dopamine was the most potent competitor among the drugs tested with a calculated dissociation constant (Ki) of 0.186 mM. In contrast, norepinephrine (K i ¼ 3:73 mM), serotonin (K i ¼ 16:2 mM), octopamine (K i ¼ 28:3 mM), and tyramine (K i ¼ 62:1 mM) were less potent competitors, and drug concentrations greater than 10 24 M were required to displace 90% of [ 125I]iodo-LSD binding. CeDOP1M expressing cells were also examined for their ability to bind the D1-like dopamine receptor antagonist [ 3H]SCH23390 (10 nM) and the D2-like dopamine receptor antagonist [ 3H]spiperone (10 nM), but no specific binding was observed (data not shown). In this study we have cloned and characterized the C. elegans dopamine receptor (CeDOP1), which is the first dopamine receptor identified from C. elegans. Analysis of
16
S. Suo et al. / Neuroscience Letters 319 (2002) 13–16
the deduced amino acid sequence of CeDOP1 revealed it to contain conserved amino acid residues important for dopamine binding, and the overall sequence shows high homology with D1-like dopamine receptors. D1-like receptors tend to have a short third intracellular loop and a long Cterminal tail. CeDOP1 also has a relatively short third intracellular loop and a long C-terminal tail, except for the CeDOP1L variant, which has a longer third intracellular loop than some D2-like dopamine receptors. These features of the amino acid sequence of CeDOP1 suggest that this receptor belongs to the D1-like family of dopamine receptors. Mammalian D1-like receptors do not have introns in their coding sequences; however, CeDOP1 contains introns, and we also found three splice variants (CeDOP1L, CeDOP1M, and CeDOP1S). The alternative splicings occur in the regions coding the third intracellular loop and the C-terminus. The inserted or deleted amino acid sequences contained consensus phosphorylation sites. Dopamine D2 receptor has been reported to have a variation in the third intracellular loop, and these variants have almost the same pharmacological profile but show differing functional properties [1,7,14,15]. Although we have only characterized the pharmacological properties of CeDOP1M, CeDOP1L and CeDOP1S should be almost identical to CeDOP1M, since variations are outside of the TMs. Radioligand binding studies using [ 125I]iodo-LSD confirmed that CeDOP1 is a dopamine receptor. We have expressed CeDOP1M in COS-7 cells and showed that dopamine displaces [ 125I]iodo-LSD binding with the greatest potency among several amine neurotransmitters. However, CeDOP1M shows no specific binding to the D1-like dopamine receptor antagonist [ 3H]SCH23390. Dopamine receptors from insects, DmDOP1 and AmDOP1, also show low affinities for this compound [2,12]. A low affinity for benzazepines might be a general property of invertebrate dopamine receptors. In C. elegans, dopamine is required for food sensation. Dopaminergic neurons transduce the mechanosensory stimuli to modulate the locomotory rate [10]. It is also known that exogenously applied dopamine suppresses egg laying in animals, and that D2-like receptor antagonists have an opposite effect on egg laying [11,16]. Future analyses of the expression pattern of CeDOP1 and the isolation of a mutant lacking CeDOP1 will clarify the behavior regulated by CeDOP1, and which G protein is coupled by CeDOP1 in the C. elegans nervous system. We are grateful to Drs A. Kawaguchi and A. IwamotoKihara for valuable discussions. S.S. is supported by JSPS Research Fellowship for Young Scientists. This work is supported in part by a Grant-in-Aid for Scientific Research on Priority Areas (C) – Advanced Brain Science Project – from the Ministry of Education, Culture, Sports, and Science and Technology, Japan.
[1] Bargmann, C.I., Neurobiology of the Caenorhabditis elegans genome, Science, 282 (1998) 2028–2033. [2] Blenau, W., Erber, J. and Baumann, A., Characterization of a dopamine D1 receptor from Apis mellifera: cloning, functional expression, pharmacology, and mRNA localization in the brain, J. Neurochem., 70 (1998) 15–23. [3] Duerr, J.S., Frisby, D.L., Gaskin, J., Duke, A., Asermely, K., Huddleston, D., Eiden, L.E. and Rand, J.B., The cat-1 gene of Caenorhabditis elegans encodes a vesicular monoamine transporter required for specific monoamine-dependent behaviors, J. Neurosci., 19 (1999) 72–84. [4] Feng, G., Hannan, F., Reale, V., Honm, Y.Y., Kousky, C.T., Evans, P.D. and Hall, L.M., Cloning and functional characterization of a novel dopamine receptor from Drosophila melanogaster, J. Neurosci., 16 (1996) 3925–3933. [5] Gotzes, F., Balfanz, S. and Baumann, A., Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors, Recept. Channels, 2 (1994) 131–141. [6] Han, K.A., Millar, N.S., Grotewiel, M.S. and Davis, R.L., DAMB, a novel dopamine receptor expressed specifically in Drosophila mushroom bodies, Neuron, 16 (1996) 1127– 1135. [7] Itokawa, M., Toru, M., Ito, K., Tsuga, H., Kameyama, K., Haga, T., Arinami, T. and Hamaguchi, H., Sequestration of the short and long isoforms of dopamine D2 receptors expressed in Chinese hamster ovary cells, Mol. Pharmacol., 49 (1996) 560–566. [8] Krause, M. and Hirsh, D., A trans-spliced leader sequence on actin mRNA in C. elegans, Cell, 49 (1987) 753–761. [9] Missale, C., Nash, S.R., Robinson, S.W., Jaber, M. and Caron, M.G., Dopamine receptors: from structure to function, Physiol. Rev., 78 (1998) 189–225. [10] Sawin, E.R., Ranganathan, R. and Horvitz, H.R., C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway, Neuron, 26 (2000) 619–631. [11] Schafer, W.R. and Kenyon, C.J., A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans, Nature, 375 (1995) 73–78. [12] Sugamori, K.S., Demchyshyn, L.L., McConkey, F., Forte, M.A. and Niznik, H.B., Protein, Nucleotide A primordial dopamine D1-like adenylyl cyclase-linked receptor from Drosophila melanogaster displaying poor affinity for benzazepines, FEBS Lett., 362 (1995) 131–138. [13] Sulston, J., Dew, M. and Brenner, S., Dopaminergic neurons in the nematode Caenorhabditis elegans, J. Comp. Neurol., 15 (1975) 215–226. [14] Usiello, A., Baik, J.H., Rouge-Pont, F., Picetti, R., Dierich, A., LeMeur, M., Piazza, P.V. and Borrelli, E., Distinct functions of the two isoforms of dopamine D2 receptors, Nature, 408 (2000) 199–203. [15] Wang, Y., Xu, R., Sasaoka, T., Tonegawa, S., Kung, M.P. and Sankoorikal, E.B., Dopamine D2 long receptor-deficient mice display alterations in striatum-dependent functions, J. Neurosci., 20 (2000) 8305–8314. [16] Weinshenker, D., Garriga, G. and Thomas, J.H., Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans, J. Neurosci., 15 (1995) 6975– 6985. [17] Wintle, R.F. and Van Tol, H.H., Dopamine signaling in Caenorhabditis elegans – potential for parkinsonism research, Parkinsonism Relat. Disord., 7 (2001) 177–183.