- Email: [email protected]
Identification of a genomic locus containing three slow myosin heavy chain genes in the chicken
Biochimica et Biophysica Acta 1353 Ž1997. 148–156
Identification of a genomic locus containing three slow myosin heavy chain genes in the chicken Qun ¨ Chen 1, Laurie A. Moore 2 , Macdonald Wick, Everett Bandman
)
Department of Food Science and Technology, UniÕersity of California at DaÕis, DaÕis, CA 95616, USA Received 29 January 1997; accepted 27 March 1997
Abstract Two unique cDNA clones containing chicken slow myosin heavy chain ŽMyHC. inserts have been isolated from an expression library. Immunochemical analyses of the expressed proteins using different slow MyHC specific monoclonal antibodies were consistent with the two clones encoding slow MyHC 1 ŽSM1. and slow MyHC 2 ŽSM2. protein sequences. Northern blot analyses showed that the clones hybridized with 6-kb mRNAs that are differentially expressed in developing and adult slow muscles, further supporting the conclusion that these two clones represent SM1 and SM2 cDNAs. Sequence analyses show that both clones encode the highly conserved light meromyosin portion of the sarcomeric myosin rod and are 78–81% homologous to a mammalian slowrcardiac b-MyHC cDNA. Hybridization using PCR generated probes specific for SM1 and SM2 sequences demonstrated that the genes encoding these two slow MyHCs colocalized to an 80-kb BssHII genomic fragment. We further show that a probe specific to a third slow MyHC gene also hybridized with the same 80-kb genomic fragment. We conclude that in the chicken genome there is a slow MyHC locus containing at least three distinct slow MyHC genes. q 1997 Elsevier Science B.V. Keywords: Myosin; Myosin isoform; Slow myosin; Myosin gene; Muscle; Multigene family; Genome mapping; Chicken
1. Introduction Myosin heavy chains ŽMyHC. are a superfamily of motor proteins w1,2x. In most species MyHCs are Abbreviations: ALD, anterior latissimus dorsi; MA, medial adductor; PM, pectoralis major; PCR, polymerase chain reaction; PFGE, pulse field gel electrophoresis; CHEF, contour-clamped homogeneous electric fields; IPTG, isopropyl-b-D-thiogalactoside ) Corresponding author. Fax: Žq1. 916-752-4759; E-mail: [email protected] 1 Present address: Aids Research Program, Department of Pathology, P.O. Box 0874, University of California, San Francisco, CA 94143, USA. 2 Present address: PE Zoogen, 1756 Picasso Avenue, Davis, CA 95616, USA.
encoded by a large and diverse multigene family w3,4x. Sarcomeric MyHCs represent the myosin subclass expressed in muscle cells. Sarcomeric MyHCs were originally classified into two subgroups, fast and slow, based upon their relative ATPase activities w5x. Many fast and slow MyHCs have now been cloned. Sequence analyses have suggested that the ancestral genes of these two classes of MyHCs evolved hundreds of millions of years ago w6,7x and thus are represented in the genomes of all extant vertebrates. In mammals, slow MyHC genes are also expressed in the heart w8,9x. Fast and slow sarcomeric MyHC genes have been mapped to two separate chromosomes in mammals w8,10–12x. Studies of the fast MyHC gene locus in
0167-4781r97r$17.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 7 . 0 0 0 6 7 - 5
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
humans and rodents suggest there are as many as 7 clustered genes w13,14x, while the slowrcardiac locus contains only two genes, a- and b-MyHC, with the b-MyHC gene approximately 4 kb upstream of aMyHC gene w10,15x. While mammalian slowrcardiac MyHC genes are expressed both in cardiac and skeletal muscle, regulation of the gene is distinct in the two tissues w9x. In the chicken, there are significant differences in both the number of sarcomeric MyHC genes and their patterns of expression during development w16,17x. An embryonic fast MyHC gene has been fully sequenced w18x and has been mapped to a microchromosome w19x. Five cDNAs for fast MyHCs have been previously characterized by our laboratory w20x and it has been shown that unlike in mammals, three embryonic MyHCs, in addition to a neonatal MyHC, are also expressed in many adult fast skeletal muscles w17x. Also the number of slowrcardiac MyHC genes in avians appears different from that seen in mammals. Partial cDNAs encoding a chicken ventricular and two atrial MyHCs have been identified and their expression in cardiac and developing skeletal muscles studied w21–23x. Recently, a quail slow MyHC gene Ž slow MyHC 3 . , the homologue to the chicken atrial AMHC1 gene w22x, has been fully sequenced and characterized w24,25x. This gene is expressed continuously in the atria and in early slow skeletal muscles of quail w24x. To date there have been no reports of cDNAs or genes corresponding to the two slow MyHC proteins, slow MyHC 1 ŽSM1. and slow MyHC 2 ŽSM2., that have been extensively characterized biochemically and immunologically in chicken muscles w26–30x. Here we report the sequencing and characterization of two slow MyHC cDNA clones that encode the light meromyosin ŽLMM. portion of SM1 and SM2, respectively. The identification of these clones is based on immunochemical analyses with slow specific monoclonal antibodies, sequence homology with other slowrcardiac MyHCs, and their hybridization with transcripts expressed in developing chicken slow muscles. Using sequence specific probes and Southern blotting we demonstrate that the genes encoding these two MyHCs are found on a 80-kb DNA genomic fragment. We further show that a third chicken slowrcardiac gene, AMHC1, is also present on the gene cluster and is tandemly linked to the SM1 gene.
149
Our data indicate that in the chicken the slowrcardiac MyHC locus consists of at least three genes that are expressed in cardiac and skeletal muscle tissues during development.
2. Materials and methods 2.1. Fibroblast and tissue preparation Fertilized white leghorn chicken eggs were incubated at 378C and fibroblasts were isolated from 7-day-old embryos, and cultured in F10 media ŽHazelton. with 10% fetal bovine serum for 7 days. The fibroblasts were isolated and sealed into In-Cert agarose ŽFMC. as a source of total intact genomic DNA for further analysis. Medial adductor ŽMA. and pectoralis major ŽPM. muscles were excised from 13–14-day white leghorn chicken embryos. MA, PM, and anterior latissimus dorsi ŽALD. muscles were excised from 1-year-old white leghorn chickens. Total mRNA was purified from freshly isolated muscles as previously described w17x. 2.2. cDNA library screening, protein expression, and DNA sequencing Screening of slow MyHC cDNAs from a l-ZAP II cDNA library prepared from 19-day embryonic chicken leg muscle mRNA was performed with monoclonal antibodies using enzyme linked immunosorbent assay ŽELISA. Ž1:500 dilution. and Western blot analysis Ž1:1000 dilution. as previously described w20x. The monoclonal antibodies used were NA4 Žall sarcomeric MyHCs w20x, EB165 Žfast embryonic and adult MyHCs. w20x, 3B1 Žall slow MyHCs. w29x, and NA1 ŽSM2 MyHC. w31x. The positive clones were then selected to generate subclones of pBluescrept SKŽ y. according to manufacturer’s protocol ŽStratagene.. The host strain used for protein expression was Escherichia coli BL21. Protein was harvested 5 h following induction by isopropyl-b-Dthiogalactoside ŽIPTG.. cDNA clones were sequenced with the dideoxy chain termination method using a Sequenase 2.0 kit
150
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
ŽAmersham. or using PCR on a 9600 GeneAmp thermal cycler and the ABI Prism 377 DNA automated sequencer ŽPE Applied Biosystems.. Nucleotide sequences and deduced amino acid sequences were analyzed by EditView Ž PE Applied Biosystems., SeqEd ŽPE Applied Biosystems. programs, and the Genetics Computer Group ŽGCG. sequence analysis software w32x. The sequences of clone F1 encoding SM1 MyHC and of clone N9 encoding SM2 MyHC have been submitted to GenBank with accession numbers U85022 and U85023, respectively. 2.3. Pulse field gel electrophoresis (PFGE) Chicken embryonic fibroblast cells were harvested by trypsinization and sealed in In-Cert agarose Ž 1 = 10 7 cellsrml. plugs. The plugs were digested with proteinase K Ž1 mgrml. at 508C for 2 days and then stored at 48C. Plugs could be kept for more than 1 year with no degradation. Prior to use, plugs were incubated in wash buffer Ž20 mM Tris-HCl, pH 8.0, 50 mM EDTA. for 30 min at 378C. The buffer was replaced with fresh wash buffer containing 1 mM phenylmethanesulfonyl fluoride to inactivate proteinase K and the plugs were incubated for an additional 30 min at 378C. Plugs were incubated twice more with fresh wash buffer for 30 min and then once in deionized and degassed water and then once in the buffer for restriction enzyme digestion Ž Boehringer Mannheim.. Digestion with restriction endonucleases was carried out for 50 h Ž10 Urm g DNA. at the optimal temperature indicated by the manufacturer w33x. Restriction digestion was stopped by the addition of wash buffer and the plugs were sealed into 1% SeaKem GoldrGTG agarose ŽFMC. and equilibrated in 0.5 = TBE buffer Ž45 mM Tris-borate, 0.5 mM EDTA, pH 8.0. for 30 min. Electrophoresis was performed by contour-clamped homogeneous electric fields ŽCHEF. ŽHex CHEF 6000, C.B.S. and Scientific Co. Del Mar, CA. at 6 Vrcm for 24 h at 128C ŽSeaKem GTG agarose. in TBE buffer. The run consisted of 14 identical cycles using linearly increasing pulses beginning with 20 s and increasing by 2 s to 60 s. Alternatively, electrophoresis was carried out at 5 Vrcm for 36 h at 158C Ž SeaKem Gold agarose. for 7 identical cycles using the same 2-s interval but starting at 40 s and increasing to 130 s w34x.
2.4. Polymerase chain reactions (PCR) and probes Specific SM1 and SM2 probes were amplified by PCR in 50 m l reaction buffer ŽPromega. containing DNA template Ž10 ngrml., dNTP Ž0.2 mM., MgCl Ž2 mM., primers Ž1 m M. and Taq polymerase Ž25 Urml.. The initial cycle was 4 min at 948C, 1 min at 508C, and 1 min at 728C, followed by 29 cycles of 1 min at 948C, 45 s at 508C, and 45 s at 728C. PCR products were electrophoresed and purified. The primers used for SM1 were: Ž1. TGCGGCTGGACG A G G C A G A G ; and Ž 2 . A T C G C C A C T GCTTTCACTCCTCGT. The primers used to amplify SM2 were: Ž 1. CCTGGACGAAGCAGAGCAGATTG; and Ž 2. CCAAGGTACAGCAGGTGGCAGGACAGGCAG. AMHC1a Ž284-bp cDNA. is a specific probe for AMHC1 w22x, a kind gift of Dr. D. Bader. 2.5. Northern and Southern hybridization Northern hybridization was performed as previously described in w17x with the following modifications: Ž1. each lane contained 15 m g total mRNA; and Ž2. hybridization and washes were performed at 708C. For Southern hybridization, following electrophoresis, the DNA was transferred to Hybond-N nylon membrane ŽAmersham. according to manufacturer’s protocol, except that the gel was exposed to UV Ž 60 mJ. ŽBioRad. before the transfer. Following transfer, DNA was crosslinked to the membrane by exposure to UV Ž 125 mJ. w35x. The probes were labeled by w a- 32 PxdATP random labeling w36,37x and each was purified by filtration through a Tris-acyl resin column ŽStratagene.. The blot was preincubated at 658C in a final solution of 5 = Denharts’ reagentr6= SSPEr1% SDSr200 m grml salmon sperm DNA for at least 1 h. Hybridizations with labeled probe Ž1 = 10 9 cpmrml. in the same solution were carried out overnight. After hybridization, the membrane was washed at 2 = SSCr1% SDS at room temperature for 10 min, and 0.5 = SSCr1% SDS at the hybridization temperature for 5–20 min. The blot was exposed to Kodak BioMax MS film at y708C overnight and developed w17,38x.
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
151
Fig. 1. Comparison and alignment of the nucleotide sequences for SM1 and SM2 MyHCs. The nucleotide sequences for clone F1 ŽSM1. and clone N9 ŽSM2. were aligned using Genetic Computer Group ŽGCG. sequence analysis software. The first residue of the 3X UTR is indicated over each of the sequences. The identification of F1 as SM1 and N9 as SM2 is based on the data shown in Figs. 3 and 4.
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
152
3. Results 3.1. Identification of SM1 and SM2 MyHC cDNA clones Two unique clones, F1 and N9, were isolated from a cDNA library screened with slow specific monoclonal antibodies as described in Section 2.2. F1 and N9 contained cDNAs of 0.9 and 2.4 kb, respectively. Fig. 1 shows the complete nucleotide sequences and alignment of these two slow MyHC clones. The homology of these sequences to chicken fast cDNAs, chicken atrial cDNA, and to mouse slowrcardiac cDNA is shown in Table 1. Both F1 and N9 sequences are more similar to mammalian slowrcardiac MyHC sequences than to chicken fast MyHC sequences. Neither clone is analogous to the atrial MyHC gene w22x which is expressed in embryonic presumptive slow muscle fibers w30x. F1 and N9 contain open-reading frames of 271 and 761 amino acids, respectively. These sequences corresponding to the C-terminal light meromyosin ŽLMM. portion of the MyHC are shown in Fig. 2. Both sequences exhibit the typical heptad repeat characteristic of a-helical coiled-coil peptides, the 28 amino acid repeat Ž4 heptads. characteristic of myosin rods w41x, and the presence of an extra amino acid referred to as a skip residue in repeats 20, 27, and 35 w41x. Following the termination codons, F1 contains an 85-bp 3X-UTR beginning at nucleotide 823, while N9 contains a 105-bp 3X-UTR beginning at nucleotide 2289. Similar to other MyHC cDNAs, the 3X-UTRs show
Table 1 % Homology of MyHC cDNA sequences SM1 SM2 AMHC1
SM2
AMHC1
VMHC1
Mb
Cfast
80
79 72
68 71 67
81 78 79
75 73 72
The homology of SM1 ŽF1. and SM2 ŽN9. to other chicken slowrcardiac MyHC cDNAs Ž AMHC1 and VMHC1., to all fast MyHC genes Ž Cfast ., and to a mammalian slowrcardiac MyHC cDNA wmurine b-MyHC Ž Mb .x was determined using the GAP and PILEUP programs of the GCG sequence analysis software as described in Section 2.2. In each comparison the sequence analyzed was truncated to the shortest of the pair and excluded the 3X-UTR region.
Fig. 2. The C-terminal light meromyosin sequences of SM1 and SM2 MyHCs. A. Clone F1 ŽSM1. contains an open-reading frame of 271 amino acids aligning with the last 10 repeats of the MyHC rod w7x. B. Clone N9 ŽSM2. contains an open-reading frame of 761 amino acid residues corresponding to MyHC rod repeats 13–40.
significantly less homology than the coding regions w20x. To characterize the identity of these two cDNAs, total protein was isolated from IPTG-induced cultures, separated by SDS-PAGE, and transferred to nitrocellulose. Fig. 3 shows a Western blot analysis of the proteins expressed by F1 and N9. Antibody
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
3B1 reacts with a 30-kDa protein in extracts from F1 cultures and with a 90-kDa protein in extracts from N9 cultures, consistent with the sizes of the deduced amino acid sequences. Since 3B1 antibody reacts only with slow MyHCs w39x, this demonstrates that F1 and N9 encode slow MyHC sequences. As shown in Fig. 3B, the protein expressed by N9, but not F1, reacted with NA1, an antibody specific for SM2 MyHC w31x. These data suggest that N9 encodes SM2 MyHC, and that F1 likely encodes SM1 MyHC. To further characterize these cDNA clones, Northern blot analyses were performed using mRNA prepared from developing and adult fast and slow muscles. Because F1 and N9 have an identical 263 nucleotide region, we used PCR to generate specific probes, SM1.418 Ž418 bp. and SM2.427 Ž427 bp., for further analysis as described in Section 2.4. As shown in Fig. 4, both probes hybridized to a 6-kb mRNA, consistent with the size of the MyHC mRNA w17x. Both probes hybridized with mRNA from slow muscles Žlanes 1, 3, 4. but not at all or only slightly with mRNA from fast muscles Ž lanes 2, 5.. The SM1.418 probe hybridized more intensely with mRNA from embryonic MA ŽFig. 2A, lane 1. than with mRNA from adult ALD ŽFig. 4A, lane 3., while the SM2.427 probe hybridized more intensely with mRNA from adult ALD ŽFig. 4B, lane 3. than with mRNA from embryonic MA ŽFig. 4B, lane 1.. Since SM1 MyHC is predominant in embryonic slow muscle while SM2 MyHC is predominant in adult slow muscle w27x, this observation further supports the conclusion that F1 encodes SM1 MyHC, while N9 encodes SM2 MyHC.
Fig. 3. Western blot analysis of proteins expressed by slow MyHC cDNAs. Following IPTG induction for 5 h, total protein was isolated from cultures of F1 Žlane 1. and N9 Žlane 2. and separated by SDS-PAGE, transferred to nitrocellulose and incubated with monoclonal antibodies 3B1 ŽA. and NA1 ŽB.. The positions of molecular weight standards and the 90-kDa protein encoded by N9 and the 30-kDa protein encoded by F1 are indicated.
153
Fig. 4. Northern blot analysis of slow MyHC mRNAs. mRNA was isolated from MA of 14-day embryonic chicken Žlane 1., PM of 13-day embryonic chicken Ž2., adult ALD Ž3., adult MA Ž4., and adult PM Ž5.. Following electrophoresis and capillary transfer to Hybond-N membrane, the blots were hybridized with the specific SM1 probe ŽA. or the SM2 probe ŽB. as discussed in the text. The arrow indicates the position of the expected 6-kb MyHC mRNA. The relative positions of molecular weight standards stained with ethidium bromide in the agaroserformaldehyde gels are indicated.
3.2. Three slow MyHC genes are clustered in the chicken genome Probes specific for SM1, SM2, and AMHC1 were used to study the genomic organization of these genes. Chicken genomic DNA was digested by the restriction enzymes Bss HII, Not I and Sac II and separated by CHEF as described in Section 2.3. Fig. 5A shows a Southern blot hybridized with the SM1.418 probe. The probe hybridized to an 80-kb Bss HII fragment, an 80-kb Not I fragment, and a 50-kb Sac II fragment. The SM2.427 probe hybridized with 80-, 150-, and 125-kb fragments, respectively ŽFig. 5B. . The pattern of hybridization
Fig. 5. Southern blot analysis of chicken genomic DNA with slow MyHC probes. Agarose plugs containing chicken genomic DNA were prepared and incubated with various restriction enzymes as described in Section 2.3. Following CHEF and capillary transfer to Hybond-N membrane, the blots were hybridized with the SM1 ŽA., SM2 ŽB. and AMHC1a ŽC. probes, respectively. The restriction enzymes used are indicated on the top of the lanes. The sizes of the fragments hybridizing with the probes are estimated from the l DNA ladder standard ŽFMC..
154
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
with the AMHC1a probe was identical with that of the SM1.418 probe ŽFig. 5C. . Hybridization of both SM1.418 and AMHC1a probes to the 50-kb Sac II fragment suggests that the SM1 and AMHC1 genes are likely tandemly linked as other MyHC genes are approximately 20 kb in size w18,24x. The hybridization of three slow MyHC probes to the 80-kb Bss HII fragment under high-stringency conditions suggests that they are clustered at a single locus in the chicken genome.
4. Discussion In this report, we identified and characterized two slow MyHC cDNAs. Based upon their sequences, reactivity of the expressed proteins with monoclonal antibodies, and Northern hybridization data, F1 and N9 encode SM1 and SM2 MyHCs, respectively. As expected, SM1 and SM2 MyHCs were expressed at high levels in both the MA and ALD, both of which are slow muscles. We could detect little or no expression of these cDNAs in fast muscles, however, a very low level of expression of SM1 in PM would be consistent with previous studies using monoclonal antibodies w40x. The relative expression of SM1 and SM2 MyHC mRNAs is consistent with previous studies at the protein level using biochemical andror immunological methods w26–30x. The amino acid sequences deduced from the F1 and N9 clones exhibit the structural characteristics of a-helical coiled-coil myosin rods w41x consistent with other skeletal MyHCs that have been identified. The results shown in Fig. 3 permit us to localize the epitopes of 3B1 and NA1. Since 3B1 reacted with proteins expressed by both clones, it likely binds to a conserved sequence within the last 273 residues of the LMM domain of slow MyHCs. NA1 antibody also must bind to an epitope present in the myosin rod of SM2. We have also isolated another SM2 clone, G1, that contains 640 identical nucleotides to N9 including the 3X-UTR. The protein expressed by G1 also reacts with 3B1 and NA1 Ždata not shown., suggesting that the epitopes of these monoclonal antibodies are at the 3X-end of the slow MyHC near the C-terminal. At the protein level, SM1 and SM2 MyHC share 93% identity, the same degree of homology as that among fast MyHCs in the chicken.
Fig. 6. Diagram of the slow MyHC gene locus. A putative restriction map based upon the data in Fig. 5 and the nucleotide sequences of SM1, SM2, and AMHC1 illustrates the order of the genes at the slow MyHC gene locus. B, Bss HII; N, Not I; S, Sac II. The diagram is not drawn to scale.
This high degree of homology is partly due to the presence of a region of 87 identical amino acids shared by both isoforms. We and others have observed extensive areas of nucleotide identity between MyHC isoforms which are attributed to recent gene conversion-like events w7,42x. Gene conversions are often observed among highly homologous genes in close proximity to one another w43x. The close linkage of SM1 and SM2 genes that we demonstrate in this report suggests that gene conversion could be responsible for the observed sequence identity. However, other factors may also be involved since there is a high degree of sequence conservation among all sarcomeric MyHC a-helical coiled-coil rod sequences w6x. We also demonstrate that the genes encoding SM1 and SM2 are clustered with a third slow myosin gene, AMHC1. From the available cDNA sequences, there are two Bss HII sites and one Not I site at the 3X-end of the SM1 sequence and two Not I sites at the 3X-end of SM2 sequence. Combined with the hybridization data from Fig. 5, we can construct a putative map of this slow locus ŽFig. 6.. Like other MyHC gene loci that have been characterized, this map suggests that the slow MyHC genes are not arranged in the order that they are expressed during development w13x. Our conclusion that slow MyHC genes in the chicken genome are closely linked is analogous to the clustering of slowrcardiac MyHCs in mammalian genomes w8x. However, while there appears to be only 2 slow MyHC genes in mammals, there are at least 3 and perhaps as many 5 slowrcardiac genes in the chicken w21–23x. One of these genes, VMHC1, is the
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
major isoform expressed in the chicken ventricle throughout development w21x. The product of this gene is also expressed during skeletal myogenesis w31x. Preliminary data using the VMHC1 probe on Southern blots indicate that it is not closely linked to the cluster of the three MyHC genes we report here Ždata not shown.. Analysis of the ventricular MyHC sequence has suggested that it exhibits less similarity to mammalian slow MyHC genes than SM1, SM2, and AMHC1 do w39x. It has also been proposed that the chicken ventricular gene may represent a primordial MyHC gene that has no homologue in the mammalian genome w39x. There has been a recent report of a second atrial MyHC gene, CCSV2, w23x which may be distinct from AMHC1 w22x. If confirmed this would represent the fifth member of the chicken slowrcardiac gene subset of the chicken MyHC multigene family. Thus, the additional complexity and the corresponding diversity of slow MyHC gene expression in the chicken suggest that analyses of fast and slow muscle fiber development, based solely upon expression of different MyHC subsets w44x, may lead to conflicting conclusions in mammals and avians until the full extent of MyHC gene diversity is understood. Our data are further evidence that the chicken MyHC multigene family is distinct and more complex than that of primates, rodents, and other mammals that have been studied. In mammals only a single slow myosin isoform, b-MyHC, has been found to be expressed in both embryonic and adult slow muscles as well as in the heart. In chickens, there appear to be multiple slow myosin isoforms expressed in developing muscle Že.g., SM1 and SM2. as well as distinct isoforms that are coexpressed in muscle and heart Že.g., AMHC1 and VMHC1.. Since the slow MyHC locus that we identify in this report contains genes of both types, further analysis of this locus will be useful in studying the regulatory mechanisms underlying the distinct patterns of slow myosin gene expression that have evolved independently in avians.
Acknowledgements We thank Drs. Ta-Hsiang Chao, William E. Tidyman, Qingyi Zhang, Maria Arrizubietta and Ms. Mar-
155
garet Brody for helpful discussions. This work was partially supported by the USDA grant 94-37205-1024 and NIH grant AG08573.
References w1x R.E. Cheney, M.A. Riley, M.S. Mooseker, Cell Motil. Cytoskel. 24 Ž1993. 215–223. w2x H.V. Goodson, J.A. Spudich, Proc. Natl. Acad. Sci. USA 90 Ž1993. 659–663. w3x C.P. Emerson, S.I. Bernstein, Annu. Rev. Biochem. 56 Ž1987. 695–726. w4x R. Wade, L. Kedes, Annu. Rev. Physiol. 51 Ž1989. 179–188. w5x M. Barany, J. Gen Physiol. 50 Ž6 Suppl.. Ž1967. 197–218. w6x H.H. Stedman, M. Eller, E.H. Jullian, S.H. Fertels, S. Sarkar, J.E. Sylvester, A.M. Kelly, N.A. Rubinstein, J. Biol. Chem. 265 Ž1990. 3568–3576. w7x L.A. Moore, W.E. Tidyman, M.J. Arrizubieta, E. Bandman, J. Mol. Evol. 36 Ž1993. 21–30. w8x V. Mahdavi, A.P. Chambers, B. Nadal-Ginard, Proc. Natl. Acad. Sci. USA 81 Ž1984. 2626–2630. w9x V. Mahdavi, S. Izumo, B. Nadal-Ginard, Cir. Res. 60 Ž1987. 804–814. w10x L.J. Saez, K.M. Gisnola, E.M. McNally, R. Feghali, R. Eddy, T.B. Shows, L.A. Leinwand, Nucleic Acid Res. 15 Ž1987. 5443–5459. w11x A. Weydert, P. Daubas, I. Lazaridis, P. Barton, D.P. Leader, F. Bonhomme, J. Catalan, D. Simon, J.L. Guenet, F. Gros, ´ M.E. Buckingham, Proc. Natl. Acad. Sci. USA 82 Ž1985. 7183–7187. w12x L.A. Leinwand, R.E.K. Fournier, B. Nadal-Ginard, T.B. Shows, Science 221 Ž1983. 766–769. w13x S-J. Yoon, S.H. Seiler, R. Kucherapati, L. Leinwand, Proc. Natl. Acad. Sci. USA 89 Ž1992. 12078–12082. w14x N. Soussi-Yanicostas, R.G. Whalen, C. Perit, Hum. Mol. Genet. 2 Ž1993. 563–569. w15x J. Gulick, A. Subramaniam, J. Neumann, J. Robbins, J. Biol. Chem. 266 Ž1991. 9180–9185. w16x J. Robbins, T. Horan, J. Gulick, K. Kropp, J. Biol. Chem. 261 Ž1986. 6606–6612. w17x W. Tidyman, E. Bandman, Developmental Dynamics 208 Ž1997. 491–504. w18x M.I. Molina, K.E. Kropp, J. Gulick, J. Robbins, J. Biol. Chem. 262 Ž1987. 6478–6488. w19x M. Dominguez-Steglich, J. Robbins, M. Schmid, J. Exp. Zool. 265 Ž1993. 295–300. w20x L.A. Moore, M.J. Arrizubieta, W.E. Tidyman, L.A. Herman, E. Bandman, J. Mol. Biol. 225 Ž1992. 1143–1151. w21x J.G. Bisaha, D. Bader, Dev. Biol. 148 Ž1991. 355–364. w22x K.E. Yutzey, J.T. Rhee, D. Bader, Development 120 Ž1994. 871–883. w23x S. Oana, R. Matsuoka, H. Nakajima, E. Hiratsuka, Y. Furutani, A. Takao, K. Momma, Eur. J. Cell Biol. 67 Ž1995. 42–49.
156
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
w24x W. Nikovits, G.F. Wang, J.L. Feldman, J.B. Miller, R. Wade, L. Nelson, F.E. Stockdale, J. Biol. Chem. 271 Ž1996. 17047–17056. w25x G.F. Wang, W. Nikovits, M. Schleinitz, F.E. Stockdale, J. Biol. Chem. 271 Ž1996. 19836–19845. w26x J.F.Y. Hoh, FEBS Lett. 98 Ž1979. 267–270. w27x R. Matsuda, E. Bandman, R.C. Strohman, Differentiation 23 Ž1982. 36–42. w28x E. Bandman, Muscles Nerves 7 Ž1984. 312–326. w29x A.F. Stewart, J.M. Kennedy, E. Bandman, R. Zak, Dev. Biol. 135 Ž1989. 367–375. w30x D. Page, J.B. Miller, J.X. DiMario, E.J. Hager, A. Moser, F.E. Stockdale, Dev. Biol. 154 Ž1992. 118–128. w31x D.L. Bourke, S.R. Wylie, A. Theon, E. Bandman, Basic Appl. Myol. 5 Ž1995. 43–56. w32x J. Devereux, P. Haeberli, P. Marquess, Seq. Anal. Softw. Pack., Genet. Comput. Group, Univ. Wisc., Madison, WI, 1987. w33x P.A. Schad, Bio-Rad USrEG Bulletin 1753, PFE Application a 6 Ž1992. 1–3.
w34x J.T. den Dunnen, G.J.B. van Ommen, Resol. FMC Newslett. 8 Ž1992. 1–2. w35x H. Lee, B. Birren, E. Lai, Anal. Biochem. 199 Ž1991. 29–34. w36x A.P. Feinberg, B. Vogelstein, Anal. Biochem. 132 Ž1983. 6–13. w37x A.P. Feinberg, B. Vogelstein, Add. Anal. Biochem. 137 Ž1984. 266–267. w38x E.M. Southern, J. Mol. Biol. 98 Ž1975. 503–517. w39x A.F.R. Stewart, B. Camoretti-Mercado, D. Perlman, M. Gupta, S. Kakovcic, R. Zak, J. Mol. Biol. 33 Ž1991. 357– 366. w40x G.K. Dhook, Differentiation 37 Ž1988. 53–61. w41x A.D. McLanchlan, J. Mol. Biol. 169 Ž1983. 15–30. w42x T.A. Epp, R. Wang, M.J. Sole, C.C. Liew, J. Mol. Evol. 41 Ž1995. 284–292. w43x P. Kourilsky, Trends Genet. 2 Ž1986. 60–63. w44x F.E. Stockdale, Dev. Biol. 154 Ž1992. 284–298.
Identification of a genomic locus containing three slow myosin heavy chain genes in the chicken Qun ¨ Chen 1, Laurie A. Moore 2 , Macdonald Wick, Everett Bandman
)
Department of Food Science and Technology, UniÕersity of California at DaÕis, DaÕis, CA 95616, USA Received 29 January 1997; accepted 27 March 1997
Abstract Two unique cDNA clones containing chicken slow myosin heavy chain ŽMyHC. inserts have been isolated from an expression library. Immunochemical analyses of the expressed proteins using different slow MyHC specific monoclonal antibodies were consistent with the two clones encoding slow MyHC 1 ŽSM1. and slow MyHC 2 ŽSM2. protein sequences. Northern blot analyses showed that the clones hybridized with 6-kb mRNAs that are differentially expressed in developing and adult slow muscles, further supporting the conclusion that these two clones represent SM1 and SM2 cDNAs. Sequence analyses show that both clones encode the highly conserved light meromyosin portion of the sarcomeric myosin rod and are 78–81% homologous to a mammalian slowrcardiac b-MyHC cDNA. Hybridization using PCR generated probes specific for SM1 and SM2 sequences demonstrated that the genes encoding these two slow MyHCs colocalized to an 80-kb BssHII genomic fragment. We further show that a probe specific to a third slow MyHC gene also hybridized with the same 80-kb genomic fragment. We conclude that in the chicken genome there is a slow MyHC locus containing at least three distinct slow MyHC genes. q 1997 Elsevier Science B.V. Keywords: Myosin; Myosin isoform; Slow myosin; Myosin gene; Muscle; Multigene family; Genome mapping; Chicken
1. Introduction Myosin heavy chains ŽMyHC. are a superfamily of motor proteins w1,2x. In most species MyHCs are Abbreviations: ALD, anterior latissimus dorsi; MA, medial adductor; PM, pectoralis major; PCR, polymerase chain reaction; PFGE, pulse field gel electrophoresis; CHEF, contour-clamped homogeneous electric fields; IPTG, isopropyl-b-D-thiogalactoside ) Corresponding author. Fax: Žq1. 916-752-4759; E-mail: [email protected] 1 Present address: Aids Research Program, Department of Pathology, P.O. Box 0874, University of California, San Francisco, CA 94143, USA. 2 Present address: PE Zoogen, 1756 Picasso Avenue, Davis, CA 95616, USA.
encoded by a large and diverse multigene family w3,4x. Sarcomeric MyHCs represent the myosin subclass expressed in muscle cells. Sarcomeric MyHCs were originally classified into two subgroups, fast and slow, based upon their relative ATPase activities w5x. Many fast and slow MyHCs have now been cloned. Sequence analyses have suggested that the ancestral genes of these two classes of MyHCs evolved hundreds of millions of years ago w6,7x and thus are represented in the genomes of all extant vertebrates. In mammals, slow MyHC genes are also expressed in the heart w8,9x. Fast and slow sarcomeric MyHC genes have been mapped to two separate chromosomes in mammals w8,10–12x. Studies of the fast MyHC gene locus in
0167-4781r97r$17.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 7 . 0 0 0 6 7 - 5
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
humans and rodents suggest there are as many as 7 clustered genes w13,14x, while the slowrcardiac locus contains only two genes, a- and b-MyHC, with the b-MyHC gene approximately 4 kb upstream of aMyHC gene w10,15x. While mammalian slowrcardiac MyHC genes are expressed both in cardiac and skeletal muscle, regulation of the gene is distinct in the two tissues w9x. In the chicken, there are significant differences in both the number of sarcomeric MyHC genes and their patterns of expression during development w16,17x. An embryonic fast MyHC gene has been fully sequenced w18x and has been mapped to a microchromosome w19x. Five cDNAs for fast MyHCs have been previously characterized by our laboratory w20x and it has been shown that unlike in mammals, three embryonic MyHCs, in addition to a neonatal MyHC, are also expressed in many adult fast skeletal muscles w17x. Also the number of slowrcardiac MyHC genes in avians appears different from that seen in mammals. Partial cDNAs encoding a chicken ventricular and two atrial MyHCs have been identified and their expression in cardiac and developing skeletal muscles studied w21–23x. Recently, a quail slow MyHC gene Ž slow MyHC 3 . , the homologue to the chicken atrial AMHC1 gene w22x, has been fully sequenced and characterized w24,25x. This gene is expressed continuously in the atria and in early slow skeletal muscles of quail w24x. To date there have been no reports of cDNAs or genes corresponding to the two slow MyHC proteins, slow MyHC 1 ŽSM1. and slow MyHC 2 ŽSM2., that have been extensively characterized biochemically and immunologically in chicken muscles w26–30x. Here we report the sequencing and characterization of two slow MyHC cDNA clones that encode the light meromyosin ŽLMM. portion of SM1 and SM2, respectively. The identification of these clones is based on immunochemical analyses with slow specific monoclonal antibodies, sequence homology with other slowrcardiac MyHCs, and their hybridization with transcripts expressed in developing chicken slow muscles. Using sequence specific probes and Southern blotting we demonstrate that the genes encoding these two MyHCs are found on a 80-kb DNA genomic fragment. We further show that a third chicken slowrcardiac gene, AMHC1, is also present on the gene cluster and is tandemly linked to the SM1 gene.
149
Our data indicate that in the chicken the slowrcardiac MyHC locus consists of at least three genes that are expressed in cardiac and skeletal muscle tissues during development.
2. Materials and methods 2.1. Fibroblast and tissue preparation Fertilized white leghorn chicken eggs were incubated at 378C and fibroblasts were isolated from 7-day-old embryos, and cultured in F10 media ŽHazelton. with 10% fetal bovine serum for 7 days. The fibroblasts were isolated and sealed into In-Cert agarose ŽFMC. as a source of total intact genomic DNA for further analysis. Medial adductor ŽMA. and pectoralis major ŽPM. muscles were excised from 13–14-day white leghorn chicken embryos. MA, PM, and anterior latissimus dorsi ŽALD. muscles were excised from 1-year-old white leghorn chickens. Total mRNA was purified from freshly isolated muscles as previously described w17x. 2.2. cDNA library screening, protein expression, and DNA sequencing Screening of slow MyHC cDNAs from a l-ZAP II cDNA library prepared from 19-day embryonic chicken leg muscle mRNA was performed with monoclonal antibodies using enzyme linked immunosorbent assay ŽELISA. Ž1:500 dilution. and Western blot analysis Ž1:1000 dilution. as previously described w20x. The monoclonal antibodies used were NA4 Žall sarcomeric MyHCs w20x, EB165 Žfast embryonic and adult MyHCs. w20x, 3B1 Žall slow MyHCs. w29x, and NA1 ŽSM2 MyHC. w31x. The positive clones were then selected to generate subclones of pBluescrept SKŽ y. according to manufacturer’s protocol ŽStratagene.. The host strain used for protein expression was Escherichia coli BL21. Protein was harvested 5 h following induction by isopropyl-b-Dthiogalactoside ŽIPTG.. cDNA clones were sequenced with the dideoxy chain termination method using a Sequenase 2.0 kit
150
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
ŽAmersham. or using PCR on a 9600 GeneAmp thermal cycler and the ABI Prism 377 DNA automated sequencer ŽPE Applied Biosystems.. Nucleotide sequences and deduced amino acid sequences were analyzed by EditView Ž PE Applied Biosystems., SeqEd ŽPE Applied Biosystems. programs, and the Genetics Computer Group ŽGCG. sequence analysis software w32x. The sequences of clone F1 encoding SM1 MyHC and of clone N9 encoding SM2 MyHC have been submitted to GenBank with accession numbers U85022 and U85023, respectively. 2.3. Pulse field gel electrophoresis (PFGE) Chicken embryonic fibroblast cells were harvested by trypsinization and sealed in In-Cert agarose Ž 1 = 10 7 cellsrml. plugs. The plugs were digested with proteinase K Ž1 mgrml. at 508C for 2 days and then stored at 48C. Plugs could be kept for more than 1 year with no degradation. Prior to use, plugs were incubated in wash buffer Ž20 mM Tris-HCl, pH 8.0, 50 mM EDTA. for 30 min at 378C. The buffer was replaced with fresh wash buffer containing 1 mM phenylmethanesulfonyl fluoride to inactivate proteinase K and the plugs were incubated for an additional 30 min at 378C. Plugs were incubated twice more with fresh wash buffer for 30 min and then once in deionized and degassed water and then once in the buffer for restriction enzyme digestion Ž Boehringer Mannheim.. Digestion with restriction endonucleases was carried out for 50 h Ž10 Urm g DNA. at the optimal temperature indicated by the manufacturer w33x. Restriction digestion was stopped by the addition of wash buffer and the plugs were sealed into 1% SeaKem GoldrGTG agarose ŽFMC. and equilibrated in 0.5 = TBE buffer Ž45 mM Tris-borate, 0.5 mM EDTA, pH 8.0. for 30 min. Electrophoresis was performed by contour-clamped homogeneous electric fields ŽCHEF. ŽHex CHEF 6000, C.B.S. and Scientific Co. Del Mar, CA. at 6 Vrcm for 24 h at 128C ŽSeaKem GTG agarose. in TBE buffer. The run consisted of 14 identical cycles using linearly increasing pulses beginning with 20 s and increasing by 2 s to 60 s. Alternatively, electrophoresis was carried out at 5 Vrcm for 36 h at 158C Ž SeaKem Gold agarose. for 7 identical cycles using the same 2-s interval but starting at 40 s and increasing to 130 s w34x.
2.4. Polymerase chain reactions (PCR) and probes Specific SM1 and SM2 probes were amplified by PCR in 50 m l reaction buffer ŽPromega. containing DNA template Ž10 ngrml., dNTP Ž0.2 mM., MgCl Ž2 mM., primers Ž1 m M. and Taq polymerase Ž25 Urml.. The initial cycle was 4 min at 948C, 1 min at 508C, and 1 min at 728C, followed by 29 cycles of 1 min at 948C, 45 s at 508C, and 45 s at 728C. PCR products were electrophoresed and purified. The primers used for SM1 were: Ž1. TGCGGCTGGACG A G G C A G A G ; and Ž 2 . A T C G C C A C T GCTTTCACTCCTCGT. The primers used to amplify SM2 were: Ž 1. CCTGGACGAAGCAGAGCAGATTG; and Ž 2. CCAAGGTACAGCAGGTGGCAGGACAGGCAG. AMHC1a Ž284-bp cDNA. is a specific probe for AMHC1 w22x, a kind gift of Dr. D. Bader. 2.5. Northern and Southern hybridization Northern hybridization was performed as previously described in w17x with the following modifications: Ž1. each lane contained 15 m g total mRNA; and Ž2. hybridization and washes were performed at 708C. For Southern hybridization, following electrophoresis, the DNA was transferred to Hybond-N nylon membrane ŽAmersham. according to manufacturer’s protocol, except that the gel was exposed to UV Ž 60 mJ. ŽBioRad. before the transfer. Following transfer, DNA was crosslinked to the membrane by exposure to UV Ž 125 mJ. w35x. The probes were labeled by w a- 32 PxdATP random labeling w36,37x and each was purified by filtration through a Tris-acyl resin column ŽStratagene.. The blot was preincubated at 658C in a final solution of 5 = Denharts’ reagentr6= SSPEr1% SDSr200 m grml salmon sperm DNA for at least 1 h. Hybridizations with labeled probe Ž1 = 10 9 cpmrml. in the same solution were carried out overnight. After hybridization, the membrane was washed at 2 = SSCr1% SDS at room temperature for 10 min, and 0.5 = SSCr1% SDS at the hybridization temperature for 5–20 min. The blot was exposed to Kodak BioMax MS film at y708C overnight and developed w17,38x.
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
151
Fig. 1. Comparison and alignment of the nucleotide sequences for SM1 and SM2 MyHCs. The nucleotide sequences for clone F1 ŽSM1. and clone N9 ŽSM2. were aligned using Genetic Computer Group ŽGCG. sequence analysis software. The first residue of the 3X UTR is indicated over each of the sequences. The identification of F1 as SM1 and N9 as SM2 is based on the data shown in Figs. 3 and 4.
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
152
3. Results 3.1. Identification of SM1 and SM2 MyHC cDNA clones Two unique clones, F1 and N9, were isolated from a cDNA library screened with slow specific monoclonal antibodies as described in Section 2.2. F1 and N9 contained cDNAs of 0.9 and 2.4 kb, respectively. Fig. 1 shows the complete nucleotide sequences and alignment of these two slow MyHC clones. The homology of these sequences to chicken fast cDNAs, chicken atrial cDNA, and to mouse slowrcardiac cDNA is shown in Table 1. Both F1 and N9 sequences are more similar to mammalian slowrcardiac MyHC sequences than to chicken fast MyHC sequences. Neither clone is analogous to the atrial MyHC gene w22x which is expressed in embryonic presumptive slow muscle fibers w30x. F1 and N9 contain open-reading frames of 271 and 761 amino acids, respectively. These sequences corresponding to the C-terminal light meromyosin ŽLMM. portion of the MyHC are shown in Fig. 2. Both sequences exhibit the typical heptad repeat characteristic of a-helical coiled-coil peptides, the 28 amino acid repeat Ž4 heptads. characteristic of myosin rods w41x, and the presence of an extra amino acid referred to as a skip residue in repeats 20, 27, and 35 w41x. Following the termination codons, F1 contains an 85-bp 3X-UTR beginning at nucleotide 823, while N9 contains a 105-bp 3X-UTR beginning at nucleotide 2289. Similar to other MyHC cDNAs, the 3X-UTRs show
Table 1 % Homology of MyHC cDNA sequences SM1 SM2 AMHC1
SM2
AMHC1
VMHC1
Mb
Cfast
80
79 72
68 71 67
81 78 79
75 73 72
The homology of SM1 ŽF1. and SM2 ŽN9. to other chicken slowrcardiac MyHC cDNAs Ž AMHC1 and VMHC1., to all fast MyHC genes Ž Cfast ., and to a mammalian slowrcardiac MyHC cDNA wmurine b-MyHC Ž Mb .x was determined using the GAP and PILEUP programs of the GCG sequence analysis software as described in Section 2.2. In each comparison the sequence analyzed was truncated to the shortest of the pair and excluded the 3X-UTR region.
Fig. 2. The C-terminal light meromyosin sequences of SM1 and SM2 MyHCs. A. Clone F1 ŽSM1. contains an open-reading frame of 271 amino acids aligning with the last 10 repeats of the MyHC rod w7x. B. Clone N9 ŽSM2. contains an open-reading frame of 761 amino acid residues corresponding to MyHC rod repeats 13–40.
significantly less homology than the coding regions w20x. To characterize the identity of these two cDNAs, total protein was isolated from IPTG-induced cultures, separated by SDS-PAGE, and transferred to nitrocellulose. Fig. 3 shows a Western blot analysis of the proteins expressed by F1 and N9. Antibody
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
3B1 reacts with a 30-kDa protein in extracts from F1 cultures and with a 90-kDa protein in extracts from N9 cultures, consistent with the sizes of the deduced amino acid sequences. Since 3B1 antibody reacts only with slow MyHCs w39x, this demonstrates that F1 and N9 encode slow MyHC sequences. As shown in Fig. 3B, the protein expressed by N9, but not F1, reacted with NA1, an antibody specific for SM2 MyHC w31x. These data suggest that N9 encodes SM2 MyHC, and that F1 likely encodes SM1 MyHC. To further characterize these cDNA clones, Northern blot analyses were performed using mRNA prepared from developing and adult fast and slow muscles. Because F1 and N9 have an identical 263 nucleotide region, we used PCR to generate specific probes, SM1.418 Ž418 bp. and SM2.427 Ž427 bp., for further analysis as described in Section 2.4. As shown in Fig. 4, both probes hybridized to a 6-kb mRNA, consistent with the size of the MyHC mRNA w17x. Both probes hybridized with mRNA from slow muscles Žlanes 1, 3, 4. but not at all or only slightly with mRNA from fast muscles Ž lanes 2, 5.. The SM1.418 probe hybridized more intensely with mRNA from embryonic MA ŽFig. 2A, lane 1. than with mRNA from adult ALD ŽFig. 4A, lane 3., while the SM2.427 probe hybridized more intensely with mRNA from adult ALD ŽFig. 4B, lane 3. than with mRNA from embryonic MA ŽFig. 4B, lane 1.. Since SM1 MyHC is predominant in embryonic slow muscle while SM2 MyHC is predominant in adult slow muscle w27x, this observation further supports the conclusion that F1 encodes SM1 MyHC, while N9 encodes SM2 MyHC.
Fig. 3. Western blot analysis of proteins expressed by slow MyHC cDNAs. Following IPTG induction for 5 h, total protein was isolated from cultures of F1 Žlane 1. and N9 Žlane 2. and separated by SDS-PAGE, transferred to nitrocellulose and incubated with monoclonal antibodies 3B1 ŽA. and NA1 ŽB.. The positions of molecular weight standards and the 90-kDa protein encoded by N9 and the 30-kDa protein encoded by F1 are indicated.
153
Fig. 4. Northern blot analysis of slow MyHC mRNAs. mRNA was isolated from MA of 14-day embryonic chicken Žlane 1., PM of 13-day embryonic chicken Ž2., adult ALD Ž3., adult MA Ž4., and adult PM Ž5.. Following electrophoresis and capillary transfer to Hybond-N membrane, the blots were hybridized with the specific SM1 probe ŽA. or the SM2 probe ŽB. as discussed in the text. The arrow indicates the position of the expected 6-kb MyHC mRNA. The relative positions of molecular weight standards stained with ethidium bromide in the agaroserformaldehyde gels are indicated.
3.2. Three slow MyHC genes are clustered in the chicken genome Probes specific for SM1, SM2, and AMHC1 were used to study the genomic organization of these genes. Chicken genomic DNA was digested by the restriction enzymes Bss HII, Not I and Sac II and separated by CHEF as described in Section 2.3. Fig. 5A shows a Southern blot hybridized with the SM1.418 probe. The probe hybridized to an 80-kb Bss HII fragment, an 80-kb Not I fragment, and a 50-kb Sac II fragment. The SM2.427 probe hybridized with 80-, 150-, and 125-kb fragments, respectively ŽFig. 5B. . The pattern of hybridization
Fig. 5. Southern blot analysis of chicken genomic DNA with slow MyHC probes. Agarose plugs containing chicken genomic DNA were prepared and incubated with various restriction enzymes as described in Section 2.3. Following CHEF and capillary transfer to Hybond-N membrane, the blots were hybridized with the SM1 ŽA., SM2 ŽB. and AMHC1a ŽC. probes, respectively. The restriction enzymes used are indicated on the top of the lanes. The sizes of the fragments hybridizing with the probes are estimated from the l DNA ladder standard ŽFMC..
154
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
with the AMHC1a probe was identical with that of the SM1.418 probe ŽFig. 5C. . Hybridization of both SM1.418 and AMHC1a probes to the 50-kb Sac II fragment suggests that the SM1 and AMHC1 genes are likely tandemly linked as other MyHC genes are approximately 20 kb in size w18,24x. The hybridization of three slow MyHC probes to the 80-kb Bss HII fragment under high-stringency conditions suggests that they are clustered at a single locus in the chicken genome.
4. Discussion In this report, we identified and characterized two slow MyHC cDNAs. Based upon their sequences, reactivity of the expressed proteins with monoclonal antibodies, and Northern hybridization data, F1 and N9 encode SM1 and SM2 MyHCs, respectively. As expected, SM1 and SM2 MyHCs were expressed at high levels in both the MA and ALD, both of which are slow muscles. We could detect little or no expression of these cDNAs in fast muscles, however, a very low level of expression of SM1 in PM would be consistent with previous studies using monoclonal antibodies w40x. The relative expression of SM1 and SM2 MyHC mRNAs is consistent with previous studies at the protein level using biochemical andror immunological methods w26–30x. The amino acid sequences deduced from the F1 and N9 clones exhibit the structural characteristics of a-helical coiled-coil myosin rods w41x consistent with other skeletal MyHCs that have been identified. The results shown in Fig. 3 permit us to localize the epitopes of 3B1 and NA1. Since 3B1 reacted with proteins expressed by both clones, it likely binds to a conserved sequence within the last 273 residues of the LMM domain of slow MyHCs. NA1 antibody also must bind to an epitope present in the myosin rod of SM2. We have also isolated another SM2 clone, G1, that contains 640 identical nucleotides to N9 including the 3X-UTR. The protein expressed by G1 also reacts with 3B1 and NA1 Ždata not shown., suggesting that the epitopes of these monoclonal antibodies are at the 3X-end of the slow MyHC near the C-terminal. At the protein level, SM1 and SM2 MyHC share 93% identity, the same degree of homology as that among fast MyHCs in the chicken.
Fig. 6. Diagram of the slow MyHC gene locus. A putative restriction map based upon the data in Fig. 5 and the nucleotide sequences of SM1, SM2, and AMHC1 illustrates the order of the genes at the slow MyHC gene locus. B, Bss HII; N, Not I; S, Sac II. The diagram is not drawn to scale.
This high degree of homology is partly due to the presence of a region of 87 identical amino acids shared by both isoforms. We and others have observed extensive areas of nucleotide identity between MyHC isoforms which are attributed to recent gene conversion-like events w7,42x. Gene conversions are often observed among highly homologous genes in close proximity to one another w43x. The close linkage of SM1 and SM2 genes that we demonstrate in this report suggests that gene conversion could be responsible for the observed sequence identity. However, other factors may also be involved since there is a high degree of sequence conservation among all sarcomeric MyHC a-helical coiled-coil rod sequences w6x. We also demonstrate that the genes encoding SM1 and SM2 are clustered with a third slow myosin gene, AMHC1. From the available cDNA sequences, there are two Bss HII sites and one Not I site at the 3X-end of the SM1 sequence and two Not I sites at the 3X-end of SM2 sequence. Combined with the hybridization data from Fig. 5, we can construct a putative map of this slow locus ŽFig. 6.. Like other MyHC gene loci that have been characterized, this map suggests that the slow MyHC genes are not arranged in the order that they are expressed during development w13x. Our conclusion that slow MyHC genes in the chicken genome are closely linked is analogous to the clustering of slowrcardiac MyHCs in mammalian genomes w8x. However, while there appears to be only 2 slow MyHC genes in mammals, there are at least 3 and perhaps as many 5 slowrcardiac genes in the chicken w21–23x. One of these genes, VMHC1, is the
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
major isoform expressed in the chicken ventricle throughout development w21x. The product of this gene is also expressed during skeletal myogenesis w31x. Preliminary data using the VMHC1 probe on Southern blots indicate that it is not closely linked to the cluster of the three MyHC genes we report here Ždata not shown.. Analysis of the ventricular MyHC sequence has suggested that it exhibits less similarity to mammalian slow MyHC genes than SM1, SM2, and AMHC1 do w39x. It has also been proposed that the chicken ventricular gene may represent a primordial MyHC gene that has no homologue in the mammalian genome w39x. There has been a recent report of a second atrial MyHC gene, CCSV2, w23x which may be distinct from AMHC1 w22x. If confirmed this would represent the fifth member of the chicken slowrcardiac gene subset of the chicken MyHC multigene family. Thus, the additional complexity and the corresponding diversity of slow MyHC gene expression in the chicken suggest that analyses of fast and slow muscle fiber development, based solely upon expression of different MyHC subsets w44x, may lead to conflicting conclusions in mammals and avians until the full extent of MyHC gene diversity is understood. Our data are further evidence that the chicken MyHC multigene family is distinct and more complex than that of primates, rodents, and other mammals that have been studied. In mammals only a single slow myosin isoform, b-MyHC, has been found to be expressed in both embryonic and adult slow muscles as well as in the heart. In chickens, there appear to be multiple slow myosin isoforms expressed in developing muscle Že.g., SM1 and SM2. as well as distinct isoforms that are coexpressed in muscle and heart Že.g., AMHC1 and VMHC1.. Since the slow MyHC locus that we identify in this report contains genes of both types, further analysis of this locus will be useful in studying the regulatory mechanisms underlying the distinct patterns of slow myosin gene expression that have evolved independently in avians.
Acknowledgements We thank Drs. Ta-Hsiang Chao, William E. Tidyman, Qingyi Zhang, Maria Arrizubietta and Ms. Mar-
155
garet Brody for helpful discussions. This work was partially supported by the USDA grant 94-37205-1024 and NIH grant AG08573.
References w1x R.E. Cheney, M.A. Riley, M.S. Mooseker, Cell Motil. Cytoskel. 24 Ž1993. 215–223. w2x H.V. Goodson, J.A. Spudich, Proc. Natl. Acad. Sci. USA 90 Ž1993. 659–663. w3x C.P. Emerson, S.I. Bernstein, Annu. Rev. Biochem. 56 Ž1987. 695–726. w4x R. Wade, L. Kedes, Annu. Rev. Physiol. 51 Ž1989. 179–188. w5x M. Barany, J. Gen Physiol. 50 Ž6 Suppl.. Ž1967. 197–218. w6x H.H. Stedman, M. Eller, E.H. Jullian, S.H. Fertels, S. Sarkar, J.E. Sylvester, A.M. Kelly, N.A. Rubinstein, J. Biol. Chem. 265 Ž1990. 3568–3576. w7x L.A. Moore, W.E. Tidyman, M.J. Arrizubieta, E. Bandman, J. Mol. Evol. 36 Ž1993. 21–30. w8x V. Mahdavi, A.P. Chambers, B. Nadal-Ginard, Proc. Natl. Acad. Sci. USA 81 Ž1984. 2626–2630. w9x V. Mahdavi, S. Izumo, B. Nadal-Ginard, Cir. Res. 60 Ž1987. 804–814. w10x L.J. Saez, K.M. Gisnola, E.M. McNally, R. Feghali, R. Eddy, T.B. Shows, L.A. Leinwand, Nucleic Acid Res. 15 Ž1987. 5443–5459. w11x A. Weydert, P. Daubas, I. Lazaridis, P. Barton, D.P. Leader, F. Bonhomme, J. Catalan, D. Simon, J.L. Guenet, F. Gros, ´ M.E. Buckingham, Proc. Natl. Acad. Sci. USA 82 Ž1985. 7183–7187. w12x L.A. Leinwand, R.E.K. Fournier, B. Nadal-Ginard, T.B. Shows, Science 221 Ž1983. 766–769. w13x S-J. Yoon, S.H. Seiler, R. Kucherapati, L. Leinwand, Proc. Natl. Acad. Sci. USA 89 Ž1992. 12078–12082. w14x N. Soussi-Yanicostas, R.G. Whalen, C. Perit, Hum. Mol. Genet. 2 Ž1993. 563–569. w15x J. Gulick, A. Subramaniam, J. Neumann, J. Robbins, J. Biol. Chem. 266 Ž1991. 9180–9185. w16x J. Robbins, T. Horan, J. Gulick, K. Kropp, J. Biol. Chem. 261 Ž1986. 6606–6612. w17x W. Tidyman, E. Bandman, Developmental Dynamics 208 Ž1997. 491–504. w18x M.I. Molina, K.E. Kropp, J. Gulick, J. Robbins, J. Biol. Chem. 262 Ž1987. 6478–6488. w19x M. Dominguez-Steglich, J. Robbins, M. Schmid, J. Exp. Zool. 265 Ž1993. 295–300. w20x L.A. Moore, M.J. Arrizubieta, W.E. Tidyman, L.A. Herman, E. Bandman, J. Mol. Biol. 225 Ž1992. 1143–1151. w21x J.G. Bisaha, D. Bader, Dev. Biol. 148 Ž1991. 355–364. w22x K.E. Yutzey, J.T. Rhee, D. Bader, Development 120 Ž1994. 871–883. w23x S. Oana, R. Matsuoka, H. Nakajima, E. Hiratsuka, Y. Furutani, A. Takao, K. Momma, Eur. J. Cell Biol. 67 Ž1995. 42–49.
156
Q. Chen et al.r Biochimica et Biophysica Acta 1353 (1997) 148–156
w24x W. Nikovits, G.F. Wang, J.L. Feldman, J.B. Miller, R. Wade, L. Nelson, F.E. Stockdale, J. Biol. Chem. 271 Ž1996. 17047–17056. w25x G.F. Wang, W. Nikovits, M. Schleinitz, F.E. Stockdale, J. Biol. Chem. 271 Ž1996. 19836–19845. w26x J.F.Y. Hoh, FEBS Lett. 98 Ž1979. 267–270. w27x R. Matsuda, E. Bandman, R.C. Strohman, Differentiation 23 Ž1982. 36–42. w28x E. Bandman, Muscles Nerves 7 Ž1984. 312–326. w29x A.F. Stewart, J.M. Kennedy, E. Bandman, R. Zak, Dev. Biol. 135 Ž1989. 367–375. w30x D. Page, J.B. Miller, J.X. DiMario, E.J. Hager, A. Moser, F.E. Stockdale, Dev. Biol. 154 Ž1992. 118–128. w31x D.L. Bourke, S.R. Wylie, A. Theon, E. Bandman, Basic Appl. Myol. 5 Ž1995. 43–56. w32x J. Devereux, P. Haeberli, P. Marquess, Seq. Anal. Softw. Pack., Genet. Comput. Group, Univ. Wisc., Madison, WI, 1987. w33x P.A. Schad, Bio-Rad USrEG Bulletin 1753, PFE Application a 6 Ž1992. 1–3.
w34x J.T. den Dunnen, G.J.B. van Ommen, Resol. FMC Newslett. 8 Ž1992. 1–2. w35x H. Lee, B. Birren, E. Lai, Anal. Biochem. 199 Ž1991. 29–34. w36x A.P. Feinberg, B. Vogelstein, Anal. Biochem. 132 Ž1983. 6–13. w37x A.P. Feinberg, B. Vogelstein, Add. Anal. Biochem. 137 Ž1984. 266–267. w38x E.M. Southern, J. Mol. Biol. 98 Ž1975. 503–517. w39x A.F.R. Stewart, B. Camoretti-Mercado, D. Perlman, M. Gupta, S. Kakovcic, R. Zak, J. Mol. Biol. 33 Ž1991. 357– 366. w40x G.K. Dhook, Differentiation 37 Ž1988. 53–61. w41x A.D. McLanchlan, J. Mol. Biol. 169 Ž1983. 15–30. w42x T.A. Epp, R. Wang, M.J. Sole, C.C. Liew, J. Mol. Evol. 41 Ž1995. 284–292. w43x P. Kourilsky, Trends Genet. 2 Ž1986. 60–63. w44x F.E. Stockdale, Dev. Biol. 154 Ž1992. 284–298.