Identification of a Minimal Sequence Required for Activation of the Tomato Golden Mosaic Virus Coat Protein Promoter in Protoplasts

Virology 305, 452–462 (2003) doi:10.1006/viro.2002.1757

Identification of a Minimal Sequence Required for Activation of the Tomato Golden Mosaic Virus Coat Protein Promoter in Protoplasts Garry Sunter 1 and David M. Bisaro 2 Department of Molecular Genetics and Plant Biotechnology Center, The Ohio State University, Columbus, Ohio 43210 Received July 16, 2002; returned to author for revision August 21, 2002; accepted September 2, 2002 Transient expression studies using a Nicotiana benthamiana suspension cell-derived protoplast system have identified a minimal sequence that is necessary and sufficient for activation of the tomato golden mosaic virus coat protein (CP) promoter by the viral TrAP protein (also called AL2). The sequence has a bipartite arrangement in which elements located between ⫺125 to ⫺107 and ⫺96 to ⫺60 from the transcription start site are both required for TrAP-mediated activation. One of the sequences (⫺96 to ⫺60) also appears to interact with a repressor, as its deletion increases basal promoter activity in the absence of TrAP. That competition experiments using the ⫺107 to ⫺60 sequence to titrate the repressor also resulted in increased basal transcription is consistent with this idea. Thus, in a protoplast system which models mesophyll, regulation of the minimal CP promoter involves both activation and derepression by TrAP. © 2003 Elsevier Science (USA)

INTRODUCTION

served among the begomoviruses and its function is not virus specific. It has been demonstrated that the AL2 gene products of several begomoviruses can complement a TGMV al2 mutant in tobacco protoplasts (Sunter et al., 1994) and that TGMV can complement other begomovirus al2 mutants in planta (Saunders and Stanley, 1995; Sung and Coutts, 1995). This absence of functional specificity suggests that either all begomovirus late promoters contain sequence elements recognized by TrAP and/or that TrAP interacts with cellular proteins common to all begomovirus hosts to effect transcriptional activation. Direct promoter recognition seems unlikely as several laboratories have shown that TrAP only weakly binds dsDNA and that this weak activity is not sequencespecific (Noris et al., 1996; Sung and Coutts, 1996; Hartitz et al., 1999). It is therefore more likely that TrAP is directed to responsive promoters by protein–protein interactions. In this regard TrAP may be similar to the transcriptional activator proteins of several mammalian DNA viruses (e.g., adenovirus E1A and herpesvirus VP16) which also do not bind specific DNA sequences with high affinity, but instead are targeted by interactions with cellular factors that recognize specific sequences within responsive promoters (Gerster and Roeder, 1988; Triezenberg et al., 1988; Kristie et al., 1989; Lillie and Green, 1989; Liu and Green, 1994). Thus promoter targeting via protein–protein interaction appears to be a common theme among eukaryotic DNA viruses. Among other known properties of TrAP is its ability to bind ssDNA in a relatively strong but sequence-nonspecific manner (Noris et al., 1996; Sung and Coutts, 1996; Hartitz et al., 1999). TrAP also binds zinc, which appears to be necessary for optimal ssDNA binding activity (Har-

The Geminiviridae is a diverse family of plant viruses characterized by a genome consisting of circular, singlestranded DNA (ssDNA) and a unique geminate particle morphology. These viruses amplify their genomes in the nuclei of infected cells by rolling circle replication (RCR) using cellular DNA polymerases. Viral transcription is accomplished by host RNA polymerase II from doublestranded replicative form DNA (RF) templates generated during RCR (for review see Bisaro, 1996; Gutierrez, 1999; Hanley-Bowdoin et al., 1999). It is this reliance on cellular polymerases that makes geminiviruses such valuable model systems for the study of DNA replication and transcription in plants. The observation that purified geminiviral ssDNA is fully infectious indicates that the cellular replication and transcription machinery is sufficient for the initial synthesis of RF and for the expression of early viral genes involved in DNA replication (Hamilton et al., 1981). However, in bipartite geminiviruses belonging to the genus Begomovirus, the transcriptional activator protein TrAP is required for expression of late viral genes. In Tomato golden mosaic virus (TGMV), TrAP is necessary for efficient transcription from the coat protein (CP) and BR1 nuclear shuttle protein gene promoters (Sunter and Bisaro, 1991, 1992). The product of the AL2 gene in TGMV, TrAP (also known as AL2, AC2, or C2), is highly con-

1

Present address: Department of Biology, The University of Texas at San Antonio, San Antonio, TX 78249. 2 To whom correspondence and reprint requests should be addressed. Fax: (614) 292-5379. E-mail: [email protected]. 0042-6822/03 $30.00 © 2003 Elsevier Science (USA) All rights reserved.

452

TGMV CP PROMOTER ACTIVATION

453

FIG. 1. Organization of the TGMV coat protein promoter. The figure represents the TGMV sequence from ⫺657 to the transcription start site of the CP promoter (not to scale). The replication origin core includes the hairpin and its invariant loop sequence (TAATATTAC), the AL1 (Rep) binding sites, and the AL1 nick site where plus-strand DNA synthesis initiates. The start sites for the AL1 and CP transcription units are indicated by horizontal arrows. Vertical arrows indicate relevant restriction sites and/or endpoints of CP promoter-reporter constructs. Numbering is relative to the CP transcription (txn) start, designated ⫹1. The approximate locations of elements B (⫺125 to ⫺107) and C/R (⫺96 to ⫺60) defined in this study are indicated by shaded bars. The positions of the CP TATAA box, a putative CAAT box, and the CLE (conserved late element) are also shown. The G-box element is a major positive regulator of the AL1 promoter (Eagle and Hanley-Bowdoin, 1997).

titz et al., 1999). The biological significance of the zinc and ssDNA-binding activities is presently unclear. However, it is known that the C-terminal region of TrAP (amino acids 115–129 of the 15 kDa TGMV protein) constitutes a minimal activation domain. The activation domain is functional in mammalian, yeast, and plant cells when targeted to promoters by fusion with a heterologous DNA-binding domain (Hartitz et al., 1999 and unpublished results). A key question is how the remainder of the protein brings the activation domain, which no doubt interacts with highly conserved general transcription factors (GTFs), to responsive promoters. We are studying the mechanisms by which TrAP stimulates gene expression using TGMV as a model system. Characterization of the complex CP promoter, which may overlap the early AL1 promoter and the origin of replication, is crucial to our understanding of this process (Fig. 1). Previously, we showed that TrAP is required for promoter expression in all plant cell types and that it stimulates transcription by multiple mechanisms. By analyzing the activity of several CP promoter-reporter constructs in transgenic plants, we found that TrAP activates the promoter in mesophyll cells and acts to derepress the promoter in phloem cells. Distinct sequence elements are responsible for repression and expression in phloem tissue. Phloem repression is mediated by sequences located between 1.2 and 1.5 kb upstream of the transcription start site, whereas sequences necessary for phloem expression are located within 657 bp of the start site. Similarly, it was found that sequences required for expression in mesophyll, while apparently different

from those employed in the phloem, also are located within 657 bp of the start site (Sunter and Bisaro, 1997). In this article, we present results that allow us to describe a minimal sequence that reflects the behavior of the CP promoter in protoplasts prepared from Nicotiana benthamiana suspension culture cells, which in several respects appear to model mesophyll. The evidence indicates that in this system, CP promoter regulation is more complex than previously recognized and involves both activation and derepression by TrAP. Further, two distinct sequences within the minimal promoter are required for TrAP-mediated activation. RESULTS Characterization of a N. benthamiana suspension cell line In a previous study, we examined the activity of TGMV CP promoter-reporter constructs as transgenes in N. benthamiana plants (Sunter and Bisaro, 1997). To obtain a comparable system for transient expression analysis, a suspension cell line was developed from this species. Protoplasts prepared from these suspension culture cells were used to assess activation of the promoter by TrAP. In a series of experiments, protoplasts were transfected with a construct capable of generating a wild-type TGMV DNA A genome component with a ␤-glucuronidase (GUS) reporter in place of the coat protein coding region (TGMV-GUS), or with a derivative containing a frameshift mutation in the AL2 gene (TGMV-GUS/al2). Protoplasts were also cotransfected with TGMV-GUS/al2

454

SUNTER AND BISARO TABLE 1

Basal and Activated Expression of 5⬘-Truncated CP Promoters Mean GUS activity ⫾ SE (n) Promoterreporter

pUC118

35S-AL2

Fold increase with 35S-AL2

DNA A a CP[⫺657]-GUS CP[⫺214]-GUS CP[⫺184]-GUS CP[⫺163]-GUS CP[⫺147]-GUS CP[⫺125]-GUS CP[⫺107]-GUS CP[⫺60]-GUS

59 ⫾ 25 (4) 336 ⫾ 88 (3) 275 ⫾ 29 (3) 118 ⫾ 19 (3) 140 ⫾ 67 (3) 618 ⫾ 111 (4) 194 ⫾ 53 (4) 91 ⫾ 7 (2) 38 ⫾ 9 (2)

— 3521 ⫾ 627 (3) 3702 ⫾ 884 (3) 1577 ⫾ 386 (3) 1530 ⫾ 210 (3) 5289 ⫾ 969 (4) 1343 ⫾ 283 (4) 115 ⫾ 45 (2) 30 ⫾ 20 (2)

— 10.5 13.5 13.4 10.9 8.6 6.9 1.3 0.8

Cotransfecting DNA:

Note. Basal activity of promoter-reporter constructs was measured in cotransfections with pUC118, and TrAP-activated expression was measured in cotransfections with 35S-AL2. Mean GUS activities (in picomoles (pm) of 4-methylumbelliferone (MU) per minute per milligram protein) and standard error of the mean (SE) were calculated from the number of experiments indicated (n). Because transfections with different promoter-reporter constructs were performed with independent protoplast preparations, GUS activities cannot be directly compared. Fold increase with 35S-AL2 corresponds to the ratio [TrAP-mediated/ basal] GUS activity. a TGMV DNA A lacking the GUS reporter.

and a plasmid capable of expressing TrAP from the constitutive cauliflower mosaic virus 35S promoter (35SAL2), or with a negative control plasmid (pUC118). In addition, a pUC-based plasmid containing the CP promoter fused to GUS (CP[⫺657]-GUS) was cotransfected with either the 35S-AL2 expression plasmid or the negative control plasmid. The GUS reporter was inserted adjacent to the CP promoter at the transcription start site (⫹1) in all cases. A construct which generates a replicating, native TGMV DNA A served as a background control. Extracts were prepared 3 days posttransfection, and fluorometric GUS assays were performed as described (Sunter and Bisaro, 1991). Except where noted, direct comparisons of GUS activities were made only within experiments due to variability in reporter gene expression levels in different protoplast preparations. In all cases, maximal GUS activity was detected in protoplast extracts only when one of the transfecting DNAs contained a wild-type AL2 gene (i.e., TGMV-GUS, TGMV-GUS/al2 ⫹ 35S-AL2, and CP[⫺657]-GUS ⫹ 35SAL2). For example, in representative data shown in Tables 1 and 2, basal promoter activity observed in the absence of TrAP with the nonreplicating (CP[⫺657]-GUS ⫹ pUC118) and replicating (TGMV-GUS/al2 ⫹ pUC118) promoter-reporter constructs ranged from 4- and 16-fold above background (DNA A), respectively. In contrast, expression in the presence of TrAP (CP[⫺657]-GUS ⫹ 35S-AL2 and TGMV-GUS/al2 ⫹ 35S-AL2) was 25-fold to more than 100-fold greater than background. We con-

cluded that TrAP activation (TrAP-mediated activity/basal activity) was robust in this system, and in these experiments varied from 6- to 10-fold with the replicating and nonreplicating constructs (Figs. 2A and 2B). Thus TrAP mediates CP promoter activation whether the promoter is in the natural context of a replicating viral genome or in a plasmid that does not replicate in plant cells. These results are entirely consistent with those from previous experiments performed with N. benthamiana leaf mesophyll protoplasts and protoplasts from a N. tabacum var. Wisconsin 38 cell line (Sunter et al., 1990; Sunter and Bisaro, 1991). Further, in all protoplast systems so far examined, TrAP responsiveness of the CP promoter appears to model promoter behavior in mesophyll cells (Sunter and Bisaro, 1997). Protoplasts derived from the N. benthamiana suspension cell line were used in all experiments described in this article. Identification of sequences required for TrAPmediated activation of the CP promoter The TGMV A genome component is arranged with bidirectional transcription units diverging from a ⬃300 nucleotide intergenic region which contains the leftward (early) and rightward (late) viral promoters as well as the origin of replication (Fig. 1). The TGMV coat protein transcription unit is composed of a single, unspliced mRNA which initiates at nt 319/320 and terminates in the vicinity of nt 1090 (Petty et al., 1988; Sunter et al., 1989). A previous analysis of CP promoter-GUS reporter conTABLE 2 Basal and Activated Expression of CLE-Deleted Promoters Mean GUS activity ⫾ SE (n) Promoterreporter DNA A a TGMV-GUS TGMV-GUS/⌬CLE TGMV-GUS/al2 TGMV-GUS/al2/⌬CLE CP[⫺657]-GUS CP[⫺657/⌬CLE]-GUS

Cotransfecting DNA: pUC118

35S-AL2

37 ⫾ 20 (4) — 51140 (1) — 51176 (1) — 591 ⫾ 536 (2) 4391 ⫾ 2386 (2) 225 ⫾ 119 (2) 4147 ⫾ 2785 (2) 161 ⫾ 74 (3) 925 ⫾ 323 (3) 183 ⫾ 127 (3) 1487 ⫾ 891 (3)

Fold increase with 35S-AL2 — — — 7.4 18.4 5.7 8.1

Note. Basal activity of promoter-reporter constructs was measured in cotransfections with pUC118, and TrAP-activated expression was measured in cotransfections with 35S-AL2. Exceptions were TGMV-GUS and TGMV-GUS/⌬CLE, which contain a wild-type AL2 gene. Mean GUS activities (in picomoles (pm) of 4-methylumbelliferone (MU) per minute per mg protein) and standard error of the mean (SE) were calculated from the number of experiments indicated (n). GUS activities for TGMVGUS and TGMV-GUS/⌬CLE were determined in the same experiment. Because transfections with other promoter-reporter constructs were performed with independent protoplast preparations, their activities cannot be directly compared. Fold increase with 35S-AL2 corresponds to the ratio [TrAP-mediated/basal] GUS activity. a TGMV DNA A lacking the GUS reporter.

TGMV CP PROMOTER ACTIVATION

455

structs in transgenic plants demonstrated that elements which sponsor TrAP-mediated activation in mesophyll cells lie within 657 bp of the start site (Sunter and Bisaro, 1997). To further define sequences required for TrAP activation, a series of truncated promoters beginning with CP[⫺657]-GUS and including ⫺214, ⫺184, ⫺163, ⫺147, ⫺125, ⫺107, and ⫺60 were constructed (Fig. 1). For convenience, the truncated promoters are indicated here only by the position of the 5⬘ endpoint, with the transcription start site defined as ⫹1. These 5⬘-truncated promoters were linked to the GUS reporter in a transcriptional fusion (at ⫹1) and flanked at the 3⬘ end by the CP polyadenylation signal (nt 1038–1357 of TGMV DNA A). As described above, constructs were cotransfected into protoplasts prepared from N. benthamiana suspension culture cells, either with a negative control plasmid (pUC118) to determine basal activity or with an effector plasmid expressing TGMV TrAP from the 35S promoter (35S-AL2). Extracts were prepared and fluorometric GUS assays performed 3 days posttransfection, and TrAP activation levels were calculated as the ratio of TrAP-mediated/basal activity. As indicated in Table 1, extracts from protoplasts cotransfected with promoter-reporter constructs and the negative control plasmid exhibited basal GUS activity up to 10-fold greater than the TGMV DNA A background, depending on the amount and context of remaining promoter sequence. However, significantly greater activity was detected in extracts from protoplasts cotransfected with the 35S-AL2 expression plasmid and constructs containing promoter 5⬘ endpoints at ⫺657, ⫺214, ⫺184, ⫺163, ⫺147, or ⫺125 (Table 1). In these cases expression levels were 7- to 13-fold greater than basal activity (Fig. 2A). In contrast, no significant increase over basal activity was observed in protoplasts cotransfected with 35S-AL2 and promoter-reporter constructs with 5⬘ end-

FIG. 2. Activation of CP promoter-reporter constructs by TrAP. The ability of TrAP to activate transcription from promoter-reporter constructs was determined by comparing reporter (GUS) expression in the absence of TrAP (basal activity) and in the presence of TrAP (TrAP-

mediated activity). Transfections (2.5 ⫻ 10 5 cells) included 2.5 ␮g of a promoter-reporter construct with 5 ␮g of pUC118 (negative control plasmid) or the 35S-AL2 effector plasmid. Columns represent fold activation (Ratio [TrAP-mediated/Basal] GUS Activity) of each construct. Activation levels were compared using Student’s t test. Mean activation is given above each column, and error bars represent the standard error of the mean. (A) Activation of 5⬘-truncated CP promoters. Basal and TrAP-mediated activity of the indicated promoter-reporter constructs is compared from the data presented in Table 1. All constructs, except ⫺107 and ⫺60, exhibited a significant increase in expression in the presence of TrAP (P ⬍ 0.05). (B) Activation of CLE-deleted promoters. Basal and TrAP-mediated activity of the indicated promoter-reporter constructs is compared from the data presented in Table 2. Activation levels of the four promoters were not significantly different (P ⬍ 0.05). (C) Activation of CP:35S-core promoters. Basal and TrAPmediated activity of the indicated promoter-reporter constructs is compared from the data presented in Table 3. All constructs, with the exception of ⫺107 to ⫺60, ⫺657 to ⫺107, ⫺163 to ⫺107, and ⫺147 to ⫺96, exhibited a significant increase in expression in the presence of TrAP (P ⬍ 0.05).

456

SUNTER AND BISARO

points at ⫺107 or ⫺60. These results allow us to conclude that sequences required for CP promoter activation lie within 125 bp of the transcription start site and that an element (or elements) required for TrAP activation lies between ⫺125 and ⫺107. This element is referred to as element B (Fig. 1). The conserved late element is not required for TrAP activation of the CP promoter The ⫺125 to ⫺107 region of the TGMV CP promoter contains a sequence motif previously identified as the conserved late element (CLE) (Argu¨ello-Astorga et al., 1994). The CLE is present in many, but not all, begomovirus late promoters and was reported to mediate TrAP activation in tobacco and pea leaves when one or two copies of the sequence were fused to a heterologous promoter core (Ruiz-Medrano et al., 1999). The presence of the CLE in the ⫺125 to ⫺107 sequence, coupled with its absence in several promoters that are known to be activated by TrAP, led to an investigation of its role in the CP promoter. A deletion within the CLE (GTGGTCCC, deletion underlined) was introduced into a plasmidbased, ⫺657 promoter background (CP[⫺657/⌬CLE]GUS) and also within the replicating DNA A based constructs to generate TGMV-GUS/⌬CLE and TGMV-GUS/ al2/⌬CLE. No significant difference in reporter activity was detected in extracts from protoplasts transfected with TGMV-GUS or TGMV-GUS/⌬CLE, indicating that the CLE deletion had no effect on CP promoter activity from a replicating DNA A template containing a wild-type AL2 gene (Table 2). Likewise, the absence of the CLE did not negatively impact al2 complementation, as TGMV-GUS/ al2 ⫹ 35S-AL2 and TGMV-GUS/al2/⌬CLE ⫹ 35S-AL2 showed 7- and 18-fold activation, respectively (Table 2; Fig. 2B). Similarly, no significant difference in activation was observed with 35S-AL2 and CP[⫺657]-GUS or CP[⫺657/⌬CLE]-GUS. In these samples, activity was sixto eightfold greater than basal levels seen in control extracts which did not contain TrAP. The results indicate that the CLE is not required for TrAP-mediated activation of the TGMV CP promoter in N. benthamiana protoplasts. Identification of a minimal sequence required to confer the TrAP-response on a heterologous promoter core To further delineate the element(s) required for TrAPmediated activation of the CP promoter, promoter fragments were placed upstream of a heterologous 35S promoter core (⫺46 to ⫹8) (Benfey and Chua, 1990) in a pUC-based plasmid. Chimeric promoters (CP:35S core) were linked to the GUS reporter gene and used to cotransfect N. benthamiana protoplasts in conjunction with the 35S-AL2 expression plasmid or the negative control plasmid pUC118.

TABLE 3 Basal and Activated Expression of CP:35S Core Promoters Mean GUS activity ⫾ SE (n) Promoterreporter

pUC118

35S-AL2

Fold increase with 35S-AL2

DNA A a 35S core ⫺657 to ⫺60 ⫺163 to ⫺60 ⫺147 to ⫺60 ⫺125 to ⫺60 ⫺107 to ⫺60 ⫺657 to ⫺107 ⫺163 to ⫺107 ⫺147 to ⫺96

79 ⫾ 15 (5) 170 ⫾ 25 (5) 254 ⫾ 15 (3) 466 ⫾ 54 (4) 356 ⫾ 49 (3) 960 ⫾ 330 (3) 107 ⫾ 24 (5) 483 ⫾ 71 (4) 788 ⫾ 189 (4) 1151 ⫾ 221 (2)

— 179 ⫾ 88 (5) 1605 ⫾ 145 (3) 2715 ⫾ 765 (4) 1702 ⫾ 365 (3) 4042 ⫾ 650 (3) 268 ⫾ 74 (5) 694 ⫾ 116 (4) 1093 ⫾ 509 (4) 1480 ⫾ 408 (2)

— 1.0 6.3 5.8 4.7 4.2 2.5 1.4 1.4 1.3

Cotransfecting DNA:

Note. Promoter-reporter constructs contained the indicated CP promoter sequences fused to the 35S promoter core. Basal activity was measured in cotransfections with pUC118, and TrAP-activated expression was measured in cotransfections with 35S-AL2. Mean GUS activities (in picomoles (pm) of 4-methylumbelliferone (MU) per minute per milligram protein) and standard error of the mean (SE) were calculated from the number of experiments indicated (n). Because transfections with different promoter-reporter constructs were performed with independent protoplast preparations, GUS activities cannot be directly compared. Fold increase with 35S-AL2 corresponds to the ratio [TrAPmediated/basal] GUS activity. a TGMV DNA A lacking the GUS reporter.

Significant GUS activity above basal levels was observed in extracts prepared from protoplasts cotransfected with 35S-AL2 and CP:35S core promoter-reporter constructs containing CP sequences from ⫺657 to ⫺60, ⫺163 to ⫺60, ⫺147 to ⫺60, or ⫺125 to ⫺60 of the CP promoter. Increases of four- to sixfold were evident compared to extracts cotransfected with the same promoter-reporter constructs and the negative control plasmid (Table 3; Fig. 2C). In keeping with previous results, the activity of the ⫺107 to ⫺60 fragment did not exhibit a significant increase in response to TrAP, confirming that a sequence important for activation lies between ⫺125 and ⫺107. Surprisingly, however, promoter-reporter constructs containing CP sequences from ⫺657 to ⫺107, ⫺163 to ⫺107, and ⫺147 to ⫺96 also proved to be TrAP nonresponsive (Table 3; Fig. 2C). The most direct interpretation of these data are that two elements, one located between ⫺125 and ⫺107 (element B) and another between ⫺96 and ⫺60 (element C), are required for activation of the TGMV CP promoter by TrAP. The results also identify a 65-bp fragment of the CP promoter (⫺125 to ⫺60) as a minimal sequence necessary and sufficient to mediate TrAP activation in N. benthamiana protoplasts. An element within the minimal CP promoter represses transcription A comparison of basal activities observed in protoplasts transfected with CP:35S core promoter-reporter

TGMV CP PROMOTER ACTIVATION

FIG. 3. Basal activity of CP:35S core promoters. Promoter-reporter constructs containing CP sequences fused to the 35S core promoter were examined in sets. Promoters in each set had the same 5⬘ end, but a different 3⬘ end with respect to CP sequences. GUS activities obtained for promoters within each set were significantly different as determined by Student’s t test (P ⬍ 0.05). GUS activities were measured in extracts from protoplasts (2.5 ⫻ 10 5 cells) cotransfected with 5 ␮g pUC118 and 2.5 ␮g promoter-reporter: ⫺657 to ⫺60 or ⫺657 to ⫺107 (four experiments); ⫺163 to ⫺60 or ⫺163 to ⫺107 (four experiments); ⫺147 to ⫺60 or ⫺147 to ⫺96 (three experiments). Controls include TGMV DNA A (background), which lacks the reporter gene, and the 35S promoter core fused to the GUS reporter. Mean GUS activities, in picomoles (pm) of 4-methylumbelliferone (MU) per minute per milligram protein, are given above each column. Error bars represent the standard error of the mean.

constructs indicated an increase in TrAP-independent expression levels upon removal of sequences between ⫺107 and ⫺60 (Table 3). To more carefully assess the role of these sequences in CP expression, additional experiments were performed using the negative control plasmid and sets of promoter-reporter constructs with comparable 5⬘ endpoints: ⫺657 to ⫺60 and ⫺657 to ⫺107; ⫺163 to ⫺60 and ⫺163 to ⫺107; ⫺147 to ⫺60 and ⫺147 to ⫺96. Matched promoter-reporter constructs were used in experiments with the same protoplast preparations so that GUS activities would be directly comparable. Extracts were prepared 3 days posttransfection and GUS assays performed as previously described. As shown in Fig. 3, deletion of CP sequences downstream of ⫺107 from ⫺657 to ⫺60 and ⫺163 to ⫺60 resulted in a twofold increase in expression in the absence of TrAP. Similarly, removal of sequences downstream of ⫺96 from ⫺147 to ⫺60 led to nearly a threefold increase in basal expression. While these differences do not seem large, they are statistically significant as indicated by Student’s t test (P ⬍ 0.05). These results confirmed that deletion of CP promoter sequences proximal to ⫺60 leads to increased basal activity and suggested that an

457

element located between ⫺96 and ⫺60 represses basal expression of the promoter. Because it was possible that the observed increases in basal activity might be due to sequence context effects, an independent method of addressing the question of a repressor element was employed. Competition experiments were carried out in which the basal activity of promoter-reporter constructs containing CP sequences ⫺657 to ⫺60, ⫺657 to ⫺107, or ⫺163 to ⫺60 fused to the 35S core were individually cotransfected with increasing amounts of a competitor plasmid (pUC118-based) containing the ⫺107 to ⫺60 sequence. The rationale behind this experiment is that a competitor fragment should titrate the repressor away from its target sequence in the promoter, resulting in increased promoter activity. Protoplasts were transfected with the CP:35S core promoterreporter constructs (2.5 ␮g DNA) and either 40 ␮g of noncompetitor plasmid (pUC118), 30 ␮g noncompetitor ⫹ 10 ␮g competitor plasmid, 10 ␮g noncompetitor ⫹ 30 ␮g competitor plasmid, or 40 ␮g competitor plasmid. Thus the mass of DNA in each transfection remained constant, while the molar ratio of competitor sequence to promoter target sequence was varied from none to approximately 8:1, 24:1, and 32:1. Extracts were prepared 3 days posttransfection and GUS assays performed. As illustrated in Fig. 4, increasing the proportion of competitor DNA in transfections resulted in a corresponding increase (more than threefold) in the level of TrAP-inde-

FIG. 4. Relative activity of CP:35S core promoter-reporter constructs in the presence of varying amounts of competitor DNA. The relative basal activity of promoter-reporter constructs containing CP sequences fused to the 35S promoter core is shown. Protoplasts (2.5 ⫻ 10 5 cells) were cotransfected with the indicated promoter-reporter (2.5 ␮g) and 40 ␮g of negative control plasmid (relative activity ⫽ 1), 40 ␮g of plasmid containing a ⫺107 to ⫺60 competitor sequence, or varying ratios of the two plasmids (see text). Promoter-reporter constructs tested included ⫺657 to ⫺60 and ⫺657 to ⫺107 (one experiment), and ⫺163 to ⫺60 (two experiments). Error bars represent the standard error of the mean.

458

SUNTER AND BISARO

FIG. 5. Activity of CP:35S core promoter-reporter constructs in the presence and absence of competitor DNA. The histogram shows the basal activity of ⫺163 to ⫺107 and ⫺163 to ⫺60 promoter-reporter constructs (2.5 ␮g) when cotransfected with 40 ␮g negative control plasmid (⫺) or 40 ␮g plasmid containing the ⫺107 to ⫺60 competitor sequence (⫹), as described in the legend to Fig. 4. GUS activities were compared by Student’s t test, and only the ⫺163 to ⫺60 construct showed a significant increase in GUS activity (P ⬍ 0.05) with competitor DNA. Mean GUS activities from two experiments, in picomoles (pm) of 4-methylumbelliferone (MU) per minute per milligram protein, are given above each column. Error bars represent the standard error of the mean.

pendent expression from the ⫺657 to ⫺60 and ⫺163 to ⫺60 promoter-reporter constructs. In contrast, the presence of competitor DNA had no effect on the basal activity of the ⫺657 to ⫺107 promoter-reporter construct, which apparently lacks the repressor target sequence. In additional experiments, the matched ⫺163 to ⫺107 and ⫺163 to ⫺60 CP:35S core promoter-reporter constructs (2.5 ␮g each) were cotransfected with either 40 ␮g of competitor plasmid containing the ⫺107 to ⫺60 sequence, or with the negative control plasmid. These experiments were performed with the same protoplast preparations so that GUS activities would be comparable. As illustrated in Fig. 5, only the ⫺163 to ⫺60 construct exhibited a statistically significant increase in GUS activity (about threefold) in the presence of the competitor DNA. Taken together, these results are consistent with the presence of a repressor element, designated element R, within the ⫺96 to ⫺60 sequence of the TGMV CP promoter. DISCUSSION The transient expression studies presented here utilized a N. benthamiana suspension cell line for analysis of the TGMV CP promoter. Protoplasts prepared from this

line support promoter activation in a manner similar to leaf mesophyll protoplasts and mesophyll cells of the same species. A combination of experiments using 5⬘truncated promoters and promoter-reporter constructs containing a heterologous 35S promoter core have defined a minimal sequence that is necessary and sufficient for activation of the CP promoter by TrAP. This sequence lies between ⫺125 and ⫺60 bp upstream of the transcription start site and is bipartite, as deletion of sequences from ⫺125 to ⫺107 or ⫺96 to ⫺60 resulted in a loss of activation. The simplest interpretation of these results is that one (or more) elements within both regions are required for activation. These elements are designated B and C, respectively (Fig. 1). In addition, two lines of evidence are presented which indicate that an element located in the ⫺107 to ⫺60 region (between ⫺96 to ⫺60) interacts with a repressor. First, a comparison of promoters with identical 5⬘ endpoints showed that basal activity was consistently twoto threefold greater in the absence of the ⫺96 to ⫺60 sequence. Second, a ⫺107 to ⫺60 sequence that was not linked to a reporter was shown to increase, in a concentration-dependent manner, the basal activity of ⫺657 to ⫺60 and ⫺163 to ⫺60 promoter-reporter con-

TGMV CP PROMOTER ACTIVATION

structs when added to transfections as a competitor. The largest increase (more than threefold) in basal activity was observed when the competing fragment was present in a 32-fold molar excess over the target sequence in the promoters. The large competitor excess suggests that the repressor is abundant, and/or that sequences upstream of ⫺107 bind proteins that selectively recruit the repressor to the promoter. In any case, it is clear that the competitor sequence titrated a repressor, because comparable promoters lacking the ⫺107 to ⫺60 sequence (and therefore the repressor target sequence) were insensitive to the competitor. At this time, it is not known whether the element that mediates repression within the ⫺96 to ⫺60 sequence is the same as that required for activation, consequently it is designated C/R. An earlier study suggested that the conserved late element found in the late gene promoters of a number of begomoviruses was required for activation of the CP promoter of Pepper huasteco virus (PHV), and also that a single copy of the CLE was sufficient to confer a degree of TrAP responsiveness to a 35S promoter core (RuizMedrano et al., 1999). However, in our hands deletion of 5 of the 8 bp in the CLE consensus (GTGGTCCC to generate GTGTGTGA) had no significant effect on TGMV CP promoter activation by TrAP, either in the background of a replicating viral genome or in a nonreplicating plasmid backbone. These results are consistent with recent studies which have shown that the late promoters of Bean golden mosaic virus-Puerto Rico and cabbage leaf curl virus, which lack a CLE, are functionally equivalent to the TGMV late promoters and can be activated by cognate or heterologous TrAP (AL2) (Hung and Petty, 2001; Qin and Petty, 2001). Thus, it is clear that the CLE is not necessary for activation of all begomovirus late promoters, although it remains possible that it is one of several cis-acting sequences that are capable of recruiting TrAP (indirectly) to responsive promoters. Because TrAP does not bind dsDNA in a sequencespecific manner, it is unlikely that it is directed to responsive promoters by protein:DNA interactions. Rather, promoter targeting probably involves protein–protein interaction with cellular factors that recognize specific sequences within TrAP responsive promoters. Thus TrAP might act in a manner that is mechanistically similar to the VP16 or E1A activators of herpes simplex virus and adenovirus (Gerster and Roeder, 1988; Liu and Green, 1994). In addition, the EBNA-2 transactivator of Epstein– Barr virus is known to be targeted to a responsive promoter through interaction with a transcriptional repressor (Hsieh and Hayward, 1995). What are the advantages of an indirect promoter targeting scheme? For the geminiviruses this is not clear, but it may be that it provides an opportunity for the virus (via TrAP) to alter host gene expression, which in turn may aid in reprogramming the host to support virus infection. Certainly an ability to

459

interact with host factors which themselves might be transcriptional regulators would be useful if this were the goal. That TrAP can activate and derepress CP promoterreporter transgenes integrated into cellular chromosomes lends some support for this idea (Sunter and Bisaro, 1997). Whether promoter targeting is direct or indirect, one might expect to find conserved sequence motifs in TrAPresponsive promoters. However, a comparison of B and C/R region sequences from the TGMV CP promoter with the late promoters of other begomoviruses is somewhat disappointing in this regard. Between ⫺125 and ⫺107 (containing element B), only the CLE is reasonably conserved, and this sequence has been shown by us and others to be dispensable for activation. Thus the CLE either is not, or at least it cannot, be the sole element responsible for the action of TrAP in this region, but an additional conserved or partially conserved sequence is not immediately evident by inspection. Within the ⫺96 to ⫺60 region (C/R) there is a CAAT box that is found in many late promoters, but again there are no other obviously conserved sequences. The CAAT box is found in a number of plant promoters where its usual role is to positively regulate transcription. The paucity of conserved motifs within sequences known to mediate TrAP activation or derepression, and the dispensability of some that are partially conserved (e.g., the CLE), might suggest that the viral protein is somewhat promiscuous. That is, it may engage in interactions with several cellular dsDNA-binding proteins, and in some cases these interactions could be functionally redundant. Our current model for TGMV CP promoter regulation invokes different regulatory circuits in different tissues, but in all cases TrAP is required to activate and/or derepress the promoter. In phloem, TrAP stimulates the promoter primarily by derepression, apparently by interacting with a phloem-specific, cellular repressor that binds a sequence element located ⫺1.2 to ⫺1.5 kb upstream of the transcription start site. In truncated promoters that lack this element, phloem expression is otherwise TrAP-independent and requires sequences within ⫺625 bp of the start site (Sunter and Bisaro, 1997). In mesophyll, TrAP both activates and derepresses the promoter. Derepression probably occurs through interaction between TrAP and a cellular, mesophyll-specific repressor that recognizes a sequence within ⫺96 to ⫺60 bp from the start site. Unlike the situation in phloem, however, derepression by itself is not sufficient to allow promoter expression, and TrAP activation is also required (Sunter and Bisaro, 1997; this report). To activate the promoter requires an additional element, at least one of which lies between ⫺125 and ⫺107. Thus we postulate that in the simplest case, derepression involves an interaction between TrAP and a cellular repressor which interacts with element C/R, whereas activation requires a synergistic interaction between this complex and an-

460

SUNTER AND BISARO

other host factor (possibly also in a complex with TrAP) that interacts with element B. Repression is recognized as an important strategy for eukaryotic gene regulation, and there are several examples of plant promoters that are controlled by interactions between negative and positive regulatory elements (Bruce et al., 1991; Guevara-Garcia et al., 1993). TGMV appears to have adopted this strategy for control of coat protein expression, perhaps because it allows for more precise promoter regulation. It will be instructive to learn how TrAP specifically interacts with the multiple elements of the transcription machinery to alternatively activate or derepress gene expression in different tissues. Because these interactions have also been implicated in determining viral tissue tropism (Morra and Petty, 2000; Qin and Petty, 2001), understanding them will not only contribute to our basic knowledge of transcriptional regulatory mechanisms, but will also address an important aspect of viral pathogenesis. In addition to its role in transcription, TrAP (AL2) is also a direct pathogenicity determinant and plays a central role in suppression of RNA silencing (Voinnet et al., 1999) and in the suppression of host stress responses (Sunter et al., 2001; L. Hao, H. Wang, G. Sunter, and D. M. Bisaro, unpublished results). It will be interesting to determine how these different activities are integrated within this small, multifunctional viral protein. MATERIALS AND METHODS DNA techniques The map locations and restriction endonuclease sites cited here refer to the published DNA sequence of TGMV (Hamilton et al., 1984). All restriction endonucleases and DNA-modifying enzymes were used as recommended by the manufacturers. DNA and RNA manipulations, polymerase chain reaction, DNA gel blot hybridization, and RNA gel blot hybridization were performed essentially as described by Ausubel et al. (1987) unless otherwise stated. All sequence alterations were confirmed by DNA sequencing. Promoter-reporter constructs Constructs capable of generating a replicating TGMV genome component (TGMV DNA A; pTGA26), a construct capable of generating a TGMV genome component with the GUS reporter in place of the coat protein gene (TGMV-GUS; pTGA35), a derivative of pTGA35 containing a null mutation in the AL2 gene (TGMV-GUS/al2; pTGA55), and an expression plasmid containing the TGMV AL2 gene (35S-AL2; pTGA79) have been previously described (Sunter and Bisaro, 1991, 1992, 1997). Briefly, the replicating constructs contain a partial tandem dimer of the viral DNA A genome component (or a derivative thereof) within a bacterial plasmid vector. In

plant cells, a monomeric viral genome is released from the plasmid, primarily by a replicative mechanism (Stenger et al., 1991). A series of CP promoter deletions, beginning from ⫺657, was constructed. CP[⫺657]-GUS (pTGA443), which contains the TGMV CP promoter from ⫺657 to ⫹1 fused to GUS and the TGMV CP3⬘ end, was created by cloning the 2932-bp EcoRI-BamHI fragment from pTGA35 into pGem3 (Promega). Deletions corresponding to ⫺214, ⫺184, ⫺163, ⫺107, and ⫺60 were generated by replacing the 1793-bp EcoRI-Csp45I fragment of pTGA443 with the 1351-bp Bsu36I-Csp45I (⫺214; pTGA541), the 1322-bp SspI-Csp45I (⫺184; pTGA543), the 1302-bp PvuI-Csp45I (⫺163; pTGA549), the 1244-bp NdeI-Csp45I (⫺107; pTGA566), and the 1198-bp DraI-Csp45I (⫺60; pTGA567) fragments of pTGA443. Two further deletions were made by PCR using primers with 5⬘ ends corresponding to ⫺147 (5⬘-CCCGAATTCCGCAAATTACGCCGC-3⬘) and ⫺125 (5⬘-CCCGAATTCGTCTAAGTGGTCCCGC-3⬘) with a reverse primer complementary to sequences within the GUS coding sequence (5⬘-AACGCTGATCAATTCCACAG-3⬘). Resulting PCR fragments were cleaved with EcoRI and BglII and used to replace the 665-bp EcoRI-BglII fragment of pTGA443, to generate pTGA569 (⫺147) and pTGA570 (⫺125), respectively. The core sequence of the CLE (GTGGTCCC) was partially deleted by removal of 10 bp (indicated by bold letters) between the AvaII site at ⫺115 and the NdeI site at ⫺107 of CP[-657]-GUS (TTGTCGTCTAAGTGGTCCCGCATATGTGAAGGGCC) to generate CP[⫺657/⌬CLE]GUS (pTGA491). TGMV-GUS/al2/⌬CLE (pTGA493) and TGMV-GUS/⌬CLE (pTGA494) were generated by replacing the 2398-bp BglII-ScaI and 2391-bp BglII-ScaI fragments of pTGA55 and pTGA35, respectively, with the 2247-bp BglII-ScaI fragment from pTGA491, containing the CLE deletion. The CaMV 35S core promoter fragment from ⫺46 to ⫹8 (Benfey and Chua, 1990) was cloned upstream of the GUS gene to generate pMinimal. This clone was used as a heterologous promoter and fragments of the TGMV CP promoter were fused 5⬘ to the minimal promoter sequence. Plasmids pTGA544, pTGA546, pTGA548, pTGA597, pTGA802, pTGA561 were generated by cloning the 597-bp EcoRI-DraI, 550-bp EcoRI-NdeI, 103-bp PvuI-DraI, 87-bp ⫺147 to DraI, 65-bp ⫺125 to DraI, and the 56-bp PvuI-NdeI fragments of the TGMV CP promoter into the pMinimal background at a PmlI site. A plasmid containing the competitor sequence promoter was generated by cloning the 47-bp NdeI to DraI fragment of the TGMV CP promoter into pUC118 at the SmaI site (pTGA920). Protoplasts A suspension cell line was developed from N. benthamiana according to the method of Hall (1991). The cell line was developed from callus tissue derived from

TGMV CP PROMOTER ACTIVATION

seedlings cultured in K3 medium containing MS salts (Gibco-BRL), sucrose, B5 vitamins, and 2,4-D. Cultures were maintained by incubating at 28°C at 89 rpm in K3 media in the dark. Protoplasts were isolated and transfections performed as described (Sunter et al., 1990; Brough et al., 1992). Promoter deletion constructs were used in transfection experiments either with pUC118 DNA to measure basal transcription or with a 35S-AL2 expression construct (pTGA79) to measure TrAP-activated expression (Sunter and Bisaro, 1992). After incubation in the dark for 3 days, protoplasts were harvested and fluorometric GUS assays performed as described (Sunter and Bisaro, 1991), using equivalent amounts of protein as determined by the method of Bradford (Bradford, 1976). ACKNOWLEDGMENTS We thank Janet Sunter for development of the suspension cell line and for assistance with protoplast transfection experiments. This study was supported by an award from United States Department of Agriculture National Research Initiative Competitive Grants Program (USDANRI) to D.M.B. (00-35301-9084).

REFERENCES Argu¨ello-Astorga, G. R., Guevara-Gonzalez, R. G., Herrera-Estrella, L. R., and Rivera-Bustamante, R. F. (1994). Geminivirus replication origins have a group-specific organization of iterative elements: A model for replication. Virology 203, 90–100. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Siedman, J. G., Smith, J. A., and Struhl, K. (1987). “Current Protocols in Molecular Biology.” John Wiley and Sons, New York. Benfey, P. N., and Chua, N.-H. (1990). The cauliflower mosaic virus 35S promoter: Combinatorial regulation of transcription in plants. Science 250, 959–966. Bisaro, D. M. (1996). Geminivirus replication. In “DNA Replication in Eukaryotic Cells” (M. DePamphilis, Ed.), pp. 833–854. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72, 248–254. Brough, C. L., Sunter, G., Gardiner, W. E., and Bisaro, D. M. (1992). Kinetics of tomato golden mosaic virus DNA replication and coat protein promoter activity in Nicotiana tabacum protoplasts. Virology 187, 1–9. Bruce, W. B., Deng, X.-W., and Quail, P. H. (1991). A negatively acting DNA sequence element mediates phytochrome-directed repression of phyA gene transcription. EMBO J. 10, 3015–3024. Eagle, P. A., and Hanley-Bowdoin, L. (1997). Cis-elements that contribute to geminivirus transcriptional regulation and efficient DNA replication. J. Virol. 71, 6947–1170. Gerster, T., and Roeder, R. G. (1988). A herpes trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins. Proc. Natl. Acad. Sci. USA 85, 6347–6351. Guevara-Garcia, A., Mosqueda-Cano, G., Arguello-Astorga, G., Simpson, J., and Herrara-Estrella, L. (1993). Tissue-specific and woundinducible pattern of expression of the mannopine synthase promoter is determined by the interaction between positive and negative cis-regulatory elements. Plant J. 4, 495–505. Gutierrez, C. (1999). Geminivirus DNA replication. Cell. Mol. Life Sci. 56, 313–329. Hall, R. D. (1991). Initiation and maintenance of callus cultures of carrot

461

and tobacco. In “Plant Tissue Culture Manual” (K. Lindsey, Ed.), Vol. A2. Kluwer Academic Publishers, Dordrecht/Norwell, MA. Hamilton, W. D. O., Sanders, R. C., Coutts, R. H. A., and Buck, K. W. (1981). Characterisation of tomato golden mosaic virus as a geminivirus. FEMS Microbiol. Lett. 11, 263–267. Hamilton, W. D. O., Stein, V. E., Coutts, R. H. A., and Buck, K. W. (1984). Complete nucleotide sequence of the infectious cloned DNA components of tomato golden mosaic virus: Potential coding regions and regulatory sequences. EMBO J. 3, 2197–2205. Hanley-Bowdoin, L., Settlage, S., Orozco, B. M., Nagar, S., and Robertson, D. (1999). Geminiviruses: Models for plant DNA replication, transcription, and cell cycle regulation. Crit. Rev. Plant Sci. 18, 71– 106. Hartitz, M. D., Sunter, G., and Bisaro, D. M. (1999). The geminivirus transactivator (TrAP) is a single-stranded DNA and zinc-binding phosphoprotein with an acidic activation domain. Virology 263, 1–14. Hsieh, J. J.-D., and Hayward, S. D. (1995). Masking of the CBF1/RPJk transcriptional repression domain by the Epstein-Barr virus EBNA2. Science 268, 560–563. Hung, H.-C., and Petty, I. T. D. (2001). Functional equivalence of late gene promoters in bean golden mosaic virus with those of tomato golden mosaic virus. J. Gen. Virol. 82, 667–672. Kristie, T. M., LeBowitz, J. H., and Sharp, P. A. (1989). The octamerbinding proteins form multi-protein-DNA complexes with the HSV aTIF regulatory protein. EMBO J. 8, 4229–4238. Lillie, J. W., and Green, M. R. (1989). Transcription activation by the adenovirus E1A protein. Nature 338, 39–44. Liu, F., and Green, M. R. (1994). Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains. Nature 368, 520–525. Morra, M. R., and Petty, I. T. D. (2000). Tissue specificity of geminivirus infection is genetically determined. Plant Cell 12, 2259–2270. Noris, E., Jupin, I., Accotto, G. P., and Gronenborn, B. (1996). DNAbinding activity of the C2 protein of tomato yellow leaf curl virus. Virology 217, 607–612. Petty, I. T. D., Coutts, R. H. A., and Buck, K. W. (1988). Transcriptional mapping of the coat protein gene of tomato golden mosaic virus. J. Gen. Virol. 69, 1359–1365. Qin, Y., and Petty, I. T. D. (2001). Genetic analysis of bipartite geminivirus tissue tropism. Virology 291, 311–323. Ruiz-Medrano, R., Guevara-Gonzalez, R. G., Arguello-Astorga, G. R., Monsalve-Fonnegra, Z., Herrera-Estrella, L. R., and Rivera-Bustamante, R. F. (1999). Identification of a sequence element involved in AC2-mediated transactivation of the pepper hausteco virus coat protein gene. Virology 253, 162–169. Saunders, K., and Stanley, J. (1995). Complementation of African cassava mosaic virus AC2 gene function in a mixed bipartite geminivirus infection. J. Gen. Virol. 76, 2287–2292. Stenger, D. C., Revington, G. N., Stevenson, M. C., and Bisaro, D. M. (1991). Replicational release of geminivirus genomes from tandemly repeated copies: Evidence for rolling circle replication of a plant viral DNA. Proc. Natl. Acad. Sci. USA 88, 8029–8033. Sung, Y. K., and Coutts, R. H. A. (1995). Pseudorecombination and complementation between potato yellow mosaic geminivirus and tomato golden mosaic geminivirus. J. Gen. Virol. 76, 2809–2815. Sung, Y. K., and Coutts, R. H. A. (1996). Potato yellow mosaic virus AC2 protein is a sequence non-specific DNA binding protein. FEBS Lett. 383, 51–54. Sunter, G., and Bisaro, D. M. (1991). Transactivation in a geminivirus: AL2 gene product is needed for coat protein expression. Virology 180, 416–419. Sunter, G., and Bisaro, D. M. (1992). Transactivation of geminivirus AR1 and BR1 gene expression by the viral AL2 gene product occurs at the level of transcription. Plant Cell 4, 1321–1331. Sunter, G., and Bisaro, D. M. (1997). Regulation of a geminivirus coat protein promoter by AL2 protein (TrAP): Evidence for activation and derepression mechanisms. Virology 232, 269–280.

462

SUNTER AND BISARO

Sunter, G., Gardiner, W. E., and Bisaro, D. M. (1989). Identification of tomato golden mosaic virus-specific RNAs in infected plants. Virology 170, 243–250. Sunter, G., Hartitz, M. D., Hormuzdi, S. G., Brough, C. L., and Bisaro, D. M. (1990). Genetic analysis of tomato golden mosaic virus. ORF AL2 is required for coat protein accumulation while ORF AL3 is necessary for efficient DNA replication. Virology 179, 69–77. Sunter, G., Stenger, D. C., and Bisaro, D. M. (1994). Heterologous complementation by geminivirus AL2 and AL3 genes. Virology 203, 203–210. Sunter, G., Sunter, J., and Bisaro, D. M. (2001). Plants expressing tomato

golden mosaic virus AL2 or beet curly top virus L2 transgenes show enhanced susceptibility to infection by DNA and RNA viruses. Virology 285, 59–70. Triezenberg, S. J., LaMarco, K. L., and McKnight, S. L. (1988). Evidence of DNA:protein interactions that mediate HSV-1 immediate early gene activation by VP16. Genes Dev. 2, 730–742. Voinnet, O., Pinto, Y. M., and Baulcombe, D. C. (1999). Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad. Sci. USA 96, 14147– 14152.