- Email: [email protected]
Identification of a novel A2 allele through nt543 substitution
+
MODEL
Journal of the Formosan Medical Association xxx (xxxx) xxx
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.jfma-online.com
Original Article
Identification of a novel A2 allele through nt543 substitution Ying-Hao Wen a,d, Tzong-Shi Chiueh a, Wei-Ting Wang a, Wei-Tzu Lin a, Ding-Ping Chen a,b,c,* a
Department of Laboratory Medicine, Linkou Chang Gung Memorial Hospital, Taoyuan, Taiwan Medical Biotechnology and Laboratory Science, Chang Gung University, Taoyuan, Taiwan c Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan d Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan b
Received 8 April 2019; received in revised form 9 August 2019; accepted 27 August 2019
KEYWORDS A2 phenotype; Blood group; 543 G>C; A1v (ABO*A1.02) allele
Background: ABO blood system has many subgroups. In A group, A1 phenotype and A2 phenotype are more common, and A2 is caused by deletion or substitution in A1 allele (ABO*A1.01). Methods: Based on standard ABO serological test, the subject was identified as A2 phenotype. Direct sequencing and ABO gene cloning were performed to analyze the allele. Results: The subject had one A 1v allele (ABO*A1.02) and one O allele. The haplotype sequencing analysis of each allelic clone demonstrated that allele 1 was A1v (ABO*A1.02) allele with nt543 variation (543 G > C) and allele 2 was O1v allele (ABO*O.01.02) with nt261 deletion and nt220 variation. Conclusion: The 543 G > C nucleotide substitution of the present A1v allele (ABO*A1.02) shares the same sequence variation site with Ax allele (ABO*AW.33) (543 G > T), and both 543 G > C and 543 G > T nucleotide substitutions encode the same amino acid change of tryptophan to cysteine. Mechanism, such as allelic enhancement, has been proposed to explain this controversial phenotypeegenotype relationship. But in present case, there has been no B allele to enhance the expression of Ax to that expected of A2, so there could be another novel underlying mechanism to be investigated. Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).
* Corresponding author. Department of Laboratory Medicine, Linkou Chang Gung Memorial Hospital, Taoyuan City, 333, Taiwan. E-mail address: [email protected] (D.-P. Chen). https://doi.org/10.1016/j.jfma.2019.08.029 0929-6646/Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
2
Y.-H. Wen et al.
Introduction The ABO blood group is the most well-known and important blood group system in transfusion medicine. There are 4 primary types: A, B, AB, and O, and of which contain many subtypes. The ABO phenotype results from various different glycosyltransferase encoded by the ABO alleles.1 The type 2 precursor substances (PS) are derived into H antigen and then to A antigen or B antigen. A alleles encode N-acetylgalactosaminyltransferase to modify H antigen into A antigen; B alleles encode N-galactocyltransferase to modify H antigen into B antigen. A and B alleles have 8 positional difference at nucleotides2 that result in altered enzyme specificity. The O allele differs from A1 allele by a single base (G) deletion at nt2613 that causes frameshift and results in lack of transferase activity.4 There are many subgroups in ABO system caused by different ABO alleles, which coded by ABO gene variation, and most of the variations are single nucleotide substitution.5 The blood type subgroups are belonging to the same blood type, while the composition and numbers of antigen and effective capability of transferase are different. Subgroups of A include A1, A2, A3, Ax, Am, and Ael with an apparently decreasing expression of A antigen,6 in which A1 and A2 phenotypes are common. Compared with A1, A2 has substitution or deletion on some positions at nucleotide (1059delC,7 1054C > T,8 1054C > G,8 539G > C,5 etc). The A2 (ABO*A2.01) allele differs from A1 (ABO*A1.01) allele by
Table 1
467C > T (Pro156Leu) substitution and 1061delC.9 The A2 is characterized by negative agglutination reaction with antiA1 and lectin Dolichos biflorus.10 Numerous A2 alleles are summarized in Table 1. The case with A2 phenotype presented here had one A2 allele and one O allele. In contrast to previous described A2 allele, this case had a novel A2 allele for 543G > C variation, which had also been reported in Ax allele.
Material and methods Blood samples The peripheral blood specimen of the A2 phenotype subject was collected by venipuncture into EDTA (ehylenediaminetetraacetic acid) tubes.
Blood group serology and DNA preparation ABO serology was performed with commercially available kit (Immucor Gamma, Norcross, GA). In addition, the antiA1 (lectin) saline method (Sanquin, Amsterdam, the Netherlands) with a stabilized extract prepared from the seeds of Dolichos Biflorus was used to identify the A2 phenotype. After blood typing, the genomic DNA was extracted from the same blood sample using QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany).
A2 subtypes.
Allele name
Nucleotide change
Exon
Predicted amino acid change
Reference
ABO*A2.01 ABO*A2.02 ABO*A2.03 ABO*A2.04
c.467C > T; c.1061delC c.1054C > T c.1054C > G c.297A > G; c.526C > G; c.657C > T; c.703G > A; c.771C > T; c.829G > A c.467C > T; c.1009A > G c.1061delC
7 7 7 6 7
p.Pro156Leu; p.Pro354Argfs p.Arg352Trp p.Arg352Gly p.Arg176Gly; p.Gly235Ser; p.Val277Met
Yamamoto et al. 19929 Ogasawara et al. 19988 Ogasawara et al. 19988 Ogasawara et al. 199612
7 7
p.Pro156Leu; p.Arg337Gly p.Pro354Argfs
c.539G > C c.467C > T; c.539G > C c.467C > T; c.527G > A; c.1061delC c.268T > C c.467C > T c.266C > T; c.467C > T
7 7 7
p.Arg180Pro p.Pro156Leu; p.Arg180Pro p.Pro156Leu; p.Arg176His; p.Pro354Argfs p.Trp90Arg; p.Pro156Leu
Ogasawara et al. 19988 Olsson et al., 19967; Yip et al. 200010 Chen et al. 20063 CDP et al. 20055
ABO*A2.05 ABO*A2.06
ABO*A2.07 ABO*A2.08 ABO*A2.09 ABO*A2.10 ABO*A2.11 ABO*A2.12 ABO*A2.13 ABO*A2.16
ABO*A2.17 ABO*A2.18 ABO*A2.19 ABO*A2.20
c.190G > A; c.527G > A; c.1061delC c.467C > T; c.742C > T c.106G > T; c.188G > A; c.189C > T; c.467C > T; c.1061delC c.407C > T; c.467C > T c.467C > T; c.722G > A c.467C > T; c.778G > A c.467C > T; c.829G > A
6 7 6 7 4 7 7 3 4 7 7 7 7 7
Yip et al. 200618 Chen et al. 20063
p.Pro89Leu; p.Pro156Leu Hult et al. 201019
p.Val64Ile; p.Arg176His; p.Pro354Argfs p.Pro156Leu; p.Arg248Cys p.Val36Phe; p.Arg63His; p.Pro156Leu; p.Pro354Argfs
Hong et al. 201120
p.Thr136Met; p.Pro156Leu p.Pro156Leu; p.Arg241Gln p.Pro156Leu; p.Glu260Lys p.Pro156Leu; p.Val277Met
Ying et al. 201310 Ying et al. 201310 Ying et al. 201310 Yinget al. 201310
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
A novel A2 allele through nt543 substitution
3
Cloning and sequencing of ABO cDNA transcripts
Results
Total RNA samples were prepared from the peripheral blood cells of the individual with a RNA blood mini kit (QIAamp, Qiagen GmbH). First-strand cDNAs were primed with oligo (dT) primers and synthesized with reverse transcriptase (SuperScript III, Invitrogen, Carlsbad, CA). The cDNA fragment encompassing the region from nucleotide 30 to nucleotide 1187, which encode amino acid residues 10 to 354, were amplified by PCR with primers ABO cDNAF1 and ABO cDNAR1 (Table 2). The amplified cDNA fragments were cloned into the Zero Blunt TOPO PCR cloning kit (Invitrogen, Carlsbad, CA).
Red blood cells (RBCs) of the subject had 3 þ agglutination reaction with anti-A but no agglutination with lectin D. biflorus. Thus, the results indicated Blood Group A2. To delineate the A allele, exons 1e7 of the ABO gene from the individual were PCR amplified and were cloned into the TOPO TA cloning vector for sequencing. In addition, RNA sequencing was applied in this study. The sequencing results demonstrated that there were nucleotide substitutions (106G > T, 188G > A, 189C > T, 220C > T, 261delG, 297A > G, 646T > A, 681G > A, 771C > T, 829G > A). And typical O1v allele (ABO*O.01.02) was indicated. However, it had no 1061delC of A2 (ABO*A2.01) allele. In addition, the non-O allele clones from the individual showed the sequences of exon 6 and 7 harbored a typical A1v allele (ABO*A1.02) with a nucleotide substitution of 543G > C (Figs. 1 and 2) that led to the amino acid change of tryptophan to cysteine. The results of Figs. 1 and 2 were shown in Table 3.
PCR amplification Polymerase chain reaction (PCR) was set up in a volume of 50 ml containing 1X reaction buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl and 1$5 mM MgCl2), 10 nmol of dNTP, 6 pmol of forward and reverse primers (Table 2), 300 ng of genomic DNA, and 1 U AmpliTaq Gold TaqDNA polymerase (Applied Biosystems, Foster City, CA). The reaction was performed in the GeneAmp PCR system 9600 (Applied Biosystems) with the following cycle condition: 1 cycle of 95 C for 10 min, 35 cycles of 94 C for 20 s, 62 C for 30 s, and 72 C for 1 min. The final elongation step was 10 min at 72 C. The primers used for PCR amplification were shown in Table 2.
Direct sequencing of PCR products The PCR products were purified using QIAquick DNA Purification Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instruction. Then the purified PCR products were sequenced using the Big Dye Terminator Cycle Sequencing kit via ABI PRISM 377 Genetic Analyzer (Applied Biosystems, Foster City, CA).
Cloning of PCR product The gel-purified PCR product was cloned into the pCRIITOPO vector by a TOPO TA Cloning kit (Invitrogen, Groningen, the Netherlands). The DNA sequences of the PCR inserts were then determined using the DNA Sequencing Kit.
Table 2
Discussion The present case had one A1v allele (ABO*A1.02) and one O1v allele (ABO*O.01.02). The haplotype sequencing analysis of each allelic clone demonstrated A1v allele with nt543 variation (543G > C) and O1vallele (ABO*O.01.02) with nt220 variation. Because the O1v allele (ABO*O.01.02) also had nt261 deletion and lack of transferase activity,11 the A2 phenotype was mainly resulting from nt543 variation. Moreover, 543G > C nucleotide substitution of the present A1v allele (ABO*A1.02) shared the same sequence variation site with Ax allele (ABO*AW.33) (543G > T),12,13 and both 543G > C and 543G > T nucleotide substitutions encode the same amino acid change of tryptophan to cysteine. However, the expression of A antigen on red blood cells of Ax phenotype is weaker than A2 phenotype. It raises a question that whether there is another important gene determined A antigen expression level. The controversial phenotypeegenotype relationships between A2 and Ax have been reported.14 Moreover, an individual with the Ax/B genotype, but showing as A3/B phenotype has been reported.15 Mechanism, such as allelic enhancement, has been proposed to explain this controversial phenotypeegenotype relationship.16 In addition, A2 to Ax phenotypic change has been observed in the
The primers used for PCR amplification of the coding regions of the ABO gene.
Encompassing Exon 1 Exon 2 / 3 Exon 4 / 5 Exon 6 / 7 ABOcDNAF1 ABOcDNAR1
Fa Ra Fb Rb Fc Rc Fd Rd
Sequence 50 / 30
Location
GGAAGGCGGAGGCCGAGACCAGACGCGGA TCCTCGCGGGCACCCGGGGCCGAGGCCT GCAGGTGAGAGAAGGAGGGTGAGTGATGTG CAGCATGGATGCTCCACCTGCTCTTCCCTG TCCTGCTCCTAGACTAAACTTCATCTCCTGTG AGCCCCTTGAGCTGCGTTCAGTTTCA GGGTGGTCAGAGGAGGCAGAAGCTGAGTGG GACGGGGCCTAGGCTTCAGTTACTCACAAC AAGGCGGAGGCCGAGACCAGACG CCTAGGCTTCAGTTACTCACAAC
3 bp upstream to exon 1 8 bp downstream to exon 1 23 bp upstream to exon 2 7 bp downstream to exon 3 46 bp upstream to exon 4 20 bp downstream to exon 5 92 bp upstream to exon 6 100 bp downstream to stop codon 30 bp upstream to exon 1 128 bp downstream to exon 7
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+ 4
Figure 1
MODEL
Y.-H. Wen et al.
The direct sequencing results of nt220C > T of allele 2 and nt543 G > C of allele 1. The frame is positions of variation.
Figure 2 Partial cDNA sequences of the individual with A2/O1v genotype. The A2 allele has nt467C > T, nt543 G > C and nt 646 T nucleotide substitutions. The frames are positions of nt467, nt543 and 646. Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
A novel A2 allele through nt543 substitution Table 3
Comparison of nucleotide of the ABO alleles identified by DNA sequencing. Exon3
A1.01 A1.02 B.01 O.01.01 O.01.02 Allele 1 Allele 2
5
Exon4
Exon5
Exon6
Exon7
106
188
189
220
261
297
467
526
543
646
657
681
703
771
796
803
829
930
G
G
C
C
G
A
C T
C
G
T
C
G
G
C
C
G
G
G
G
A
C
T C T
G del del G del
C C
G G
T G T
A G A
T C T
G A G
G
T C
C C
T
C G
A T A
C C
A A G A
G G
T C T
A A G A
G G
The results of DNA sequencing for allele 1 and allele 2. There was a nt261 deletion in allele 2 that demonstrated allele 2 is O1v allele and had C > T substitution variation at nt220. There was nt467C > T in allele 1 that demonstrated allele 1 is A1v allele and had G > C substitution variation at nt543.
development of a new-born with the Ax allele.17 But in present case, there has been no B allele to enhance the expression of Ax to that expected of A2, so there could be another novel underlying mechanism to be investigated.
7. 8.
Conflicts of interest The authors have no conflicts of interest relevant to this article.
Acknowledgments The authors acknowledge all participants for their cooperation and sample contributions. The excellent consulting assistance and sample resources from blood bank of ChangGung Memorial Hospital are gratefully acknowledged. This work was supported by the Chang Gung Memorial Hospital grants CMRPG3H1181 and BMRPA81.
9.
10.
11.
12.
Appendix A. Supplementary data
13.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.jfma.2019.08.029.
14. 15.
References 1. Olsson ML, Chester MA. Polymorphism and recombination events at the ABO locus: a major challenge for genomic ABO blood grouping strategies. Transfus Med 2001;11:295e313. 2. Yip SP. Single-tube multiplex PCR-SSCP analysis distinguishes 7 common ABO alleles and readily identifies new alleles. Blood 2000;95:1487e92. 3. Chen YJ, Chen PS, Liu HM, Lyou JY, Hu HY, Lin JS, et al. Novel polymorphisms in exons 6 and 7 of A/B alleles detected by polymerase chain reaction-single strand conformation polymorphism. Vox Sang 2006;90:119e27. 4. Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular genetic basis of the histo-blood group ABO system. Nature 1990;345:229e33. 5. Chen DP, Tseng CP, Wang WT, Sun CF. Identification of a novel A2 allele derived from the A transferase gene through a nucleotide substitution G539C. Vox Sang 2005;88:196e9. 6. Svensson L, Rydberg L, Hellberg A, Gilliver LG, Olsson ML, Henry SM. Novel glycolipid variations revealed by monoclonal
16. 17.
18.
19.
20.
antibody immunochemical analysis of weak ABO subgroups of A. Vox Sang 2005;89:27e38. Olsson ML, Chester MA. Polymorphisms at the ABO locus in subgroup A individuals. Transfusion 1996;36:309e13. Ogasawara K, Yabe R, Uchikawa M, Bannai M, Nakata K, Takenaka M, et al. Different alleles cause an imbalance in A2 and A2B phenotypes of the ABO blood group. Vox Sang 1998;74: 242e7. Yamamoto F, McNeill PD, Hakomori S. Human histo-blood group A2 transferase coded by A2 allele, one of the A subtypes, is characterized by a single base deletion in the coding sequence, which results in an additional domain at the carboxyl terminal. Biochem Biophys Res Commun 1992;187:366e74. Ying Y, Hong X, Xu X, Liu Y, Lan X, Ma K, et al. Serological characteristic and molecular basis of A2 subgroup in the Chinese population. Transfus Apher Sci 2013;48:67e74. Olsson ML, Chester MA. Frequent occurrence of a variant O1 gene at the blood group ABO locus. Vox Sang 1996;70: 26e30. Ogasawara K, Yabe R, Uchikawa M, Saitou N, Bannai M, Nakata K, et al. Molecular genetic analysis of variant phenotype of the ABO blood group system. Blood 1996;88: 2732e7. Deng ZH, Yu Q, Wu GG, Lian YL, Su YQ, Li DC, et al. Molecular genetic analysis for Ax phenotype of the ABO blood group system in Chinese. Vox Sanguinis 2005;89:251e6. Ducos J, Marty Y, Ruffi e J. A case of Ax phenotype transmitted by an A2B parent. Vox Sang 1975;29:390e3. Li L, Yang MH, Chak KF, Lin PH, Lai CH, Lin KT, et al. Three missense variations, including a novel 860C>T transition, and allelic enhancement phenomenon associated with ABO blood subgroups A in Taiwan. Transfusion 2007;47:1014e21. Geoff D. Human blood groups. 3rd ed. Hoboken: Wiley-Blackwell; 2013. p. 40e1. Bird GW, Roberts KD, Wingham J. Change of blood group from A2 to Ax in a child with congenital abnormalities. J Clin Pathol 1975;28:962e3. Yip SP, Choi PS, Lee SY, Leung KH, El-Zawahri MM, Luqmani YA. ABO blood group in Kuwaitis: detailed allele frequency distribution and identification of novel alleles. Transfusion 2006;46: 773e9. Hult AK, Yazer MH, Jørgensen R, Hellberg A, Hustinx H, Peyrard T, et al. Weak A phenotypes associated with novel ABO alleles carrying the A2-related 1061C deletion and various missense substitutions. Transfusiomn 2010;50:1471e86. Hong XZ, Yin YL, Xu XG, Ma KR, Lan XF, Liu Y, et al. C742T mutation of a1, 3 N-acetyl-D-galactosaminyltransferase gene is responsible for A2 subgroup. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2011;19:702e5.
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
MODEL
Journal of the Formosan Medical Association xxx (xxxx) xxx
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.jfma-online.com
Original Article
Identification of a novel A2 allele through nt543 substitution Ying-Hao Wen a,d, Tzong-Shi Chiueh a, Wei-Ting Wang a, Wei-Tzu Lin a, Ding-Ping Chen a,b,c,* a
Department of Laboratory Medicine, Linkou Chang Gung Memorial Hospital, Taoyuan, Taiwan Medical Biotechnology and Laboratory Science, Chang Gung University, Taoyuan, Taiwan c Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan d Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan b
Received 8 April 2019; received in revised form 9 August 2019; accepted 27 August 2019
KEYWORDS A2 phenotype; Blood group; 543 G>C; A1v (ABO*A1.02) allele
Background: ABO blood system has many subgroups. In A group, A1 phenotype and A2 phenotype are more common, and A2 is caused by deletion or substitution in A1 allele (ABO*A1.01). Methods: Based on standard ABO serological test, the subject was identified as A2 phenotype. Direct sequencing and ABO gene cloning were performed to analyze the allele. Results: The subject had one A 1v allele (ABO*A1.02) and one O allele. The haplotype sequencing analysis of each allelic clone demonstrated that allele 1 was A1v (ABO*A1.02) allele with nt543 variation (543 G > C) and allele 2 was O1v allele (ABO*O.01.02) with nt261 deletion and nt220 variation. Conclusion: The 543 G > C nucleotide substitution of the present A1v allele (ABO*A1.02) shares the same sequence variation site with Ax allele (ABO*AW.33) (543 G > T), and both 543 G > C and 543 G > T nucleotide substitutions encode the same amino acid change of tryptophan to cysteine. Mechanism, such as allelic enhancement, has been proposed to explain this controversial phenotypeegenotype relationship. But in present case, there has been no B allele to enhance the expression of Ax to that expected of A2, so there could be another novel underlying mechanism to be investigated. Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).
* Corresponding author. Department of Laboratory Medicine, Linkou Chang Gung Memorial Hospital, Taoyuan City, 333, Taiwan. E-mail address: [email protected] (D.-P. Chen). https://doi.org/10.1016/j.jfma.2019.08.029 0929-6646/Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
2
Y.-H. Wen et al.
Introduction The ABO blood group is the most well-known and important blood group system in transfusion medicine. There are 4 primary types: A, B, AB, and O, and of which contain many subtypes. The ABO phenotype results from various different glycosyltransferase encoded by the ABO alleles.1 The type 2 precursor substances (PS) are derived into H antigen and then to A antigen or B antigen. A alleles encode N-acetylgalactosaminyltransferase to modify H antigen into A antigen; B alleles encode N-galactocyltransferase to modify H antigen into B antigen. A and B alleles have 8 positional difference at nucleotides2 that result in altered enzyme specificity. The O allele differs from A1 allele by a single base (G) deletion at nt2613 that causes frameshift and results in lack of transferase activity.4 There are many subgroups in ABO system caused by different ABO alleles, which coded by ABO gene variation, and most of the variations are single nucleotide substitution.5 The blood type subgroups are belonging to the same blood type, while the composition and numbers of antigen and effective capability of transferase are different. Subgroups of A include A1, A2, A3, Ax, Am, and Ael with an apparently decreasing expression of A antigen,6 in which A1 and A2 phenotypes are common. Compared with A1, A2 has substitution or deletion on some positions at nucleotide (1059delC,7 1054C > T,8 1054C > G,8 539G > C,5 etc). The A2 (ABO*A2.01) allele differs from A1 (ABO*A1.01) allele by
Table 1
467C > T (Pro156Leu) substitution and 1061delC.9 The A2 is characterized by negative agglutination reaction with antiA1 and lectin Dolichos biflorus.10 Numerous A2 alleles are summarized in Table 1. The case with A2 phenotype presented here had one A2 allele and one O allele. In contrast to previous described A2 allele, this case had a novel A2 allele for 543G > C variation, which had also been reported in Ax allele.
Material and methods Blood samples The peripheral blood specimen of the A2 phenotype subject was collected by venipuncture into EDTA (ehylenediaminetetraacetic acid) tubes.
Blood group serology and DNA preparation ABO serology was performed with commercially available kit (Immucor Gamma, Norcross, GA). In addition, the antiA1 (lectin) saline method (Sanquin, Amsterdam, the Netherlands) with a stabilized extract prepared from the seeds of Dolichos Biflorus was used to identify the A2 phenotype. After blood typing, the genomic DNA was extracted from the same blood sample using QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany).
A2 subtypes.
Allele name
Nucleotide change
Exon
Predicted amino acid change
Reference
ABO*A2.01 ABO*A2.02 ABO*A2.03 ABO*A2.04
c.467C > T; c.1061delC c.1054C > T c.1054C > G c.297A > G; c.526C > G; c.657C > T; c.703G > A; c.771C > T; c.829G > A c.467C > T; c.1009A > G c.1061delC
7 7 7 6 7
p.Pro156Leu; p.Pro354Argfs p.Arg352Trp p.Arg352Gly p.Arg176Gly; p.Gly235Ser; p.Val277Met
Yamamoto et al. 19929 Ogasawara et al. 19988 Ogasawara et al. 19988 Ogasawara et al. 199612
7 7
p.Pro156Leu; p.Arg337Gly p.Pro354Argfs
c.539G > C c.467C > T; c.539G > C c.467C > T; c.527G > A; c.1061delC c.268T > C c.467C > T c.266C > T; c.467C > T
7 7 7
p.Arg180Pro p.Pro156Leu; p.Arg180Pro p.Pro156Leu; p.Arg176His; p.Pro354Argfs p.Trp90Arg; p.Pro156Leu
Ogasawara et al. 19988 Olsson et al., 19967; Yip et al. 200010 Chen et al. 20063 CDP et al. 20055
ABO*A2.05 ABO*A2.06
ABO*A2.07 ABO*A2.08 ABO*A2.09 ABO*A2.10 ABO*A2.11 ABO*A2.12 ABO*A2.13 ABO*A2.16
ABO*A2.17 ABO*A2.18 ABO*A2.19 ABO*A2.20
c.190G > A; c.527G > A; c.1061delC c.467C > T; c.742C > T c.106G > T; c.188G > A; c.189C > T; c.467C > T; c.1061delC c.407C > T; c.467C > T c.467C > T; c.722G > A c.467C > T; c.778G > A c.467C > T; c.829G > A
6 7 6 7 4 7 7 3 4 7 7 7 7 7
Yip et al. 200618 Chen et al. 20063
p.Pro89Leu; p.Pro156Leu Hult et al. 201019
p.Val64Ile; p.Arg176His; p.Pro354Argfs p.Pro156Leu; p.Arg248Cys p.Val36Phe; p.Arg63His; p.Pro156Leu; p.Pro354Argfs
Hong et al. 201120
p.Thr136Met; p.Pro156Leu p.Pro156Leu; p.Arg241Gln p.Pro156Leu; p.Glu260Lys p.Pro156Leu; p.Val277Met
Ying et al. 201310 Ying et al. 201310 Ying et al. 201310 Yinget al. 201310
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
A novel A2 allele through nt543 substitution
3
Cloning and sequencing of ABO cDNA transcripts
Results
Total RNA samples were prepared from the peripheral blood cells of the individual with a RNA blood mini kit (QIAamp, Qiagen GmbH). First-strand cDNAs were primed with oligo (dT) primers and synthesized with reverse transcriptase (SuperScript III, Invitrogen, Carlsbad, CA). The cDNA fragment encompassing the region from nucleotide 30 to nucleotide 1187, which encode amino acid residues 10 to 354, were amplified by PCR with primers ABO cDNAF1 and ABO cDNAR1 (Table 2). The amplified cDNA fragments were cloned into the Zero Blunt TOPO PCR cloning kit (Invitrogen, Carlsbad, CA).
Red blood cells (RBCs) of the subject had 3 þ agglutination reaction with anti-A but no agglutination with lectin D. biflorus. Thus, the results indicated Blood Group A2. To delineate the A allele, exons 1e7 of the ABO gene from the individual were PCR amplified and were cloned into the TOPO TA cloning vector for sequencing. In addition, RNA sequencing was applied in this study. The sequencing results demonstrated that there were nucleotide substitutions (106G > T, 188G > A, 189C > T, 220C > T, 261delG, 297A > G, 646T > A, 681G > A, 771C > T, 829G > A). And typical O1v allele (ABO*O.01.02) was indicated. However, it had no 1061delC of A2 (ABO*A2.01) allele. In addition, the non-O allele clones from the individual showed the sequences of exon 6 and 7 harbored a typical A1v allele (ABO*A1.02) with a nucleotide substitution of 543G > C (Figs. 1 and 2) that led to the amino acid change of tryptophan to cysteine. The results of Figs. 1 and 2 were shown in Table 3.
PCR amplification Polymerase chain reaction (PCR) was set up in a volume of 50 ml containing 1X reaction buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl and 1$5 mM MgCl2), 10 nmol of dNTP, 6 pmol of forward and reverse primers (Table 2), 300 ng of genomic DNA, and 1 U AmpliTaq Gold TaqDNA polymerase (Applied Biosystems, Foster City, CA). The reaction was performed in the GeneAmp PCR system 9600 (Applied Biosystems) with the following cycle condition: 1 cycle of 95 C for 10 min, 35 cycles of 94 C for 20 s, 62 C for 30 s, and 72 C for 1 min. The final elongation step was 10 min at 72 C. The primers used for PCR amplification were shown in Table 2.
Direct sequencing of PCR products The PCR products were purified using QIAquick DNA Purification Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instruction. Then the purified PCR products were sequenced using the Big Dye Terminator Cycle Sequencing kit via ABI PRISM 377 Genetic Analyzer (Applied Biosystems, Foster City, CA).
Cloning of PCR product The gel-purified PCR product was cloned into the pCRIITOPO vector by a TOPO TA Cloning kit (Invitrogen, Groningen, the Netherlands). The DNA sequences of the PCR inserts were then determined using the DNA Sequencing Kit.
Table 2
Discussion The present case had one A1v allele (ABO*A1.02) and one O1v allele (ABO*O.01.02). The haplotype sequencing analysis of each allelic clone demonstrated A1v allele with nt543 variation (543G > C) and O1vallele (ABO*O.01.02) with nt220 variation. Because the O1v allele (ABO*O.01.02) also had nt261 deletion and lack of transferase activity,11 the A2 phenotype was mainly resulting from nt543 variation. Moreover, 543G > C nucleotide substitution of the present A1v allele (ABO*A1.02) shared the same sequence variation site with Ax allele (ABO*AW.33) (543G > T),12,13 and both 543G > C and 543G > T nucleotide substitutions encode the same amino acid change of tryptophan to cysteine. However, the expression of A antigen on red blood cells of Ax phenotype is weaker than A2 phenotype. It raises a question that whether there is another important gene determined A antigen expression level. The controversial phenotypeegenotype relationships between A2 and Ax have been reported.14 Moreover, an individual with the Ax/B genotype, but showing as A3/B phenotype has been reported.15 Mechanism, such as allelic enhancement, has been proposed to explain this controversial phenotypeegenotype relationship.16 In addition, A2 to Ax phenotypic change has been observed in the
The primers used for PCR amplification of the coding regions of the ABO gene.
Encompassing Exon 1 Exon 2 / 3 Exon 4 / 5 Exon 6 / 7 ABOcDNAF1 ABOcDNAR1
Fa Ra Fb Rb Fc Rc Fd Rd
Sequence 50 / 30
Location
GGAAGGCGGAGGCCGAGACCAGACGCGGA TCCTCGCGGGCACCCGGGGCCGAGGCCT GCAGGTGAGAGAAGGAGGGTGAGTGATGTG CAGCATGGATGCTCCACCTGCTCTTCCCTG TCCTGCTCCTAGACTAAACTTCATCTCCTGTG AGCCCCTTGAGCTGCGTTCAGTTTCA GGGTGGTCAGAGGAGGCAGAAGCTGAGTGG GACGGGGCCTAGGCTTCAGTTACTCACAAC AAGGCGGAGGCCGAGACCAGACG CCTAGGCTTCAGTTACTCACAAC
3 bp upstream to exon 1 8 bp downstream to exon 1 23 bp upstream to exon 2 7 bp downstream to exon 3 46 bp upstream to exon 4 20 bp downstream to exon 5 92 bp upstream to exon 6 100 bp downstream to stop codon 30 bp upstream to exon 1 128 bp downstream to exon 7
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+ 4
Figure 1
MODEL
Y.-H. Wen et al.
The direct sequencing results of nt220C > T of allele 2 and nt543 G > C of allele 1. The frame is positions of variation.
Figure 2 Partial cDNA sequences of the individual with A2/O1v genotype. The A2 allele has nt467C > T, nt543 G > C and nt 646 T nucleotide substitutions. The frames are positions of nt467, nt543 and 646. Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029
+
MODEL
A novel A2 allele through nt543 substitution Table 3
Comparison of nucleotide of the ABO alleles identified by DNA sequencing. Exon3
A1.01 A1.02 B.01 O.01.01 O.01.02 Allele 1 Allele 2
5
Exon4
Exon5
Exon6
Exon7
106
188
189
220
261
297
467
526
543
646
657
681
703
771
796
803
829
930
G
G
C
C
G
A
C T
C
G
T
C
G
G
C
C
G
G
G
G
A
C
T C T
G del del G del
C C
G G
T G T
A G A
T C T
G A G
G
T C
C C
T
C G
A T A
C C
A A G A
G G
T C T
A A G A
G G
The results of DNA sequencing for allele 1 and allele 2. There was a nt261 deletion in allele 2 that demonstrated allele 2 is O1v allele and had C > T substitution variation at nt220. There was nt467C > T in allele 1 that demonstrated allele 1 is A1v allele and had G > C substitution variation at nt543.
development of a new-born with the Ax allele.17 But in present case, there has been no B allele to enhance the expression of Ax to that expected of A2, so there could be another novel underlying mechanism to be investigated.
7. 8.
Conflicts of interest The authors have no conflicts of interest relevant to this article.
Acknowledgments The authors acknowledge all participants for their cooperation and sample contributions. The excellent consulting assistance and sample resources from blood bank of ChangGung Memorial Hospital are gratefully acknowledged. This work was supported by the Chang Gung Memorial Hospital grants CMRPG3H1181 and BMRPA81.
9.
10.
11.
12.
Appendix A. Supplementary data
13.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.jfma.2019.08.029.
14. 15.
References 1. Olsson ML, Chester MA. Polymorphism and recombination events at the ABO locus: a major challenge for genomic ABO blood grouping strategies. Transfus Med 2001;11:295e313. 2. Yip SP. Single-tube multiplex PCR-SSCP analysis distinguishes 7 common ABO alleles and readily identifies new alleles. Blood 2000;95:1487e92. 3. Chen YJ, Chen PS, Liu HM, Lyou JY, Hu HY, Lin JS, et al. Novel polymorphisms in exons 6 and 7 of A/B alleles detected by polymerase chain reaction-single strand conformation polymorphism. Vox Sang 2006;90:119e27. 4. Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular genetic basis of the histo-blood group ABO system. Nature 1990;345:229e33. 5. Chen DP, Tseng CP, Wang WT, Sun CF. Identification of a novel A2 allele derived from the A transferase gene through a nucleotide substitution G539C. Vox Sang 2005;88:196e9. 6. Svensson L, Rydberg L, Hellberg A, Gilliver LG, Olsson ML, Henry SM. Novel glycolipid variations revealed by monoclonal
16. 17.
18.
19.
20.
antibody immunochemical analysis of weak ABO subgroups of A. Vox Sang 2005;89:27e38. Olsson ML, Chester MA. Polymorphisms at the ABO locus in subgroup A individuals. Transfusion 1996;36:309e13. Ogasawara K, Yabe R, Uchikawa M, Bannai M, Nakata K, Takenaka M, et al. Different alleles cause an imbalance in A2 and A2B phenotypes of the ABO blood group. Vox Sang 1998;74: 242e7. Yamamoto F, McNeill PD, Hakomori S. Human histo-blood group A2 transferase coded by A2 allele, one of the A subtypes, is characterized by a single base deletion in the coding sequence, which results in an additional domain at the carboxyl terminal. Biochem Biophys Res Commun 1992;187:366e74. Ying Y, Hong X, Xu X, Liu Y, Lan X, Ma K, et al. Serological characteristic and molecular basis of A2 subgroup in the Chinese population. Transfus Apher Sci 2013;48:67e74. Olsson ML, Chester MA. Frequent occurrence of a variant O1 gene at the blood group ABO locus. Vox Sang 1996;70: 26e30. Ogasawara K, Yabe R, Uchikawa M, Saitou N, Bannai M, Nakata K, et al. Molecular genetic analysis of variant phenotype of the ABO blood group system. Blood 1996;88: 2732e7. Deng ZH, Yu Q, Wu GG, Lian YL, Su YQ, Li DC, et al. Molecular genetic analysis for Ax phenotype of the ABO blood group system in Chinese. Vox Sanguinis 2005;89:251e6. Ducos J, Marty Y, Ruffi e J. A case of Ax phenotype transmitted by an A2B parent. Vox Sang 1975;29:390e3. Li L, Yang MH, Chak KF, Lin PH, Lai CH, Lin KT, et al. Three missense variations, including a novel 860C>T transition, and allelic enhancement phenomenon associated with ABO blood subgroups A in Taiwan. Transfusion 2007;47:1014e21. Geoff D. Human blood groups. 3rd ed. Hoboken: Wiley-Blackwell; 2013. p. 40e1. Bird GW, Roberts KD, Wingham J. Change of blood group from A2 to Ax in a child with congenital abnormalities. J Clin Pathol 1975;28:962e3. Yip SP, Choi PS, Lee SY, Leung KH, El-Zawahri MM, Luqmani YA. ABO blood group in Kuwaitis: detailed allele frequency distribution and identification of novel alleles. Transfusion 2006;46: 773e9. Hult AK, Yazer MH, Jørgensen R, Hellberg A, Hustinx H, Peyrard T, et al. Weak A phenotypes associated with novel ABO alleles carrying the A2-related 1061C deletion and various missense substitutions. Transfusiomn 2010;50:1471e86. Hong XZ, Yin YL, Xu XG, Ma KR, Lan XF, Liu Y, et al. C742T mutation of a1, 3 N-acetyl-D-galactosaminyltransferase gene is responsible for A2 subgroup. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2011;19:702e5.
Please cite this article as: Wen Y-H et al., Identification of a novel A2 allele through nt543 substitution, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.08.029