- Email: [email protected]
0 myeloma cells
Veterinary Parasitology 194 (2013) 183–185
Contents lists available at SciVerse ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Identification of a novel gene product expressed by Trichinella spiralis that binds antiserum to Sp2/0 myeloma cells Lingxin Duan a , Jianhua Li a,∗ , Boqi Cheng b , Qiang Lv a , Peng-tao Gong a , Li-bo Su a , Yanan Cai a , Xichen Zhang a,∗ a b
College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun 130062, China College of Life Science, Jilin University, 2699 Qianjin Street, Changchun 130012, China
a r t i c l e Keywords: Bioinformatics cDNA library Sp2/0 myeloma cell Trichinella spiralis
i n f o
a b s t r a c t To obtain novel antigen genes for use as an anti-tumor vaccine, a Trichinella spiralis cDNA expression library was constructed from muscle larvae RNA and screened with sera from Balb/C mice injected with Sp2/0 myeloma cells. One positive clone was obtained after three rounds of immunoscreening of the cDNA expression library and was subsequently excised in vivo using the ExAssist helper phage with SOLR strain. A full-length gene was amplified using 5 -RACE technology and analyzed by BLAST, Protein Analysis System of ELM, and DNAStar Software. The sequencing results showed that the fragment was 569 bp in length and contained an open reading frame. It was predicted that the full-length gene encoded 136 amino acids. This gene, TS2, contained four putative N-Arg dibasic convertase (nardilysine) cleavage sites, one peptide C-terminal amidation site, and one glycosaminoglycan attachment site. Six antibody epitopes were predicted by bioinformatic analysis. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The landmark discovery of tumor antigens suggests that stimulating tumor-suppressive cellular and/or humoral immune responses is one method to fight cancer. However, most tumor antigens derived from tumor cells are only weakly immunogenic which limits their effectiveness (Rosenberg, 2000; Wei et al., 2000). Xenogeneic homologs, antigens which differ by only a small amount, provide one means to combat immune tolerance, increase immunogenicity, and more strongly induce anti-tumor immune responses against autologous tumor cells (Wei and Tian, 2002). Because intracellular parasitism by Trichinella spiralis has been shown to suppress certain kinds of tumors, we were interested in identifying Trichinella antigens induced by myelomas. Previously, ELISAs and Western
∗ Corresponding authors. Tel.: +86 431 7981351; fax: +86 431 7981351. E-mail addresses: [email protected] (J. Li), [email protected] (X. Zhang). 0304-4017/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetpar.2013.01.051
blots have been used to identify shared antigens between T. spiralis and Sp2/0 tumor cells (Gong et al., 2011); however, the genes encoding these shared antigens have not been reported. Herein we immunoscreened a T. spiralis cDNA expression library to identify candidate genes encoding tumor-suppressing antigens.
2. Materials and methods 2.1. cDNA expression library construction A cDNA library was constructed from muscle larva (ML) of T. spiralis using the ZAP Express cDNA Synthesis Kit and ZAP Express cDNA Gigapack III Gold Cloning Kit (Stratagene) according to manufacturer protocols. To evaluate the transformation efficiency and the insert length of the cDNA library, the sizes of the cloned inserts were analyzed by restriction enzyme digestion. The primers were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Table 1).
184
L. Duan et al. / Veterinary Parasitology 194 (2013) 183–185
Table 1 Primer sequences. Primer name
Sequence (5 → 3 direction)
Usage
T3 T7
AATTAACCCTCACTAAAGGG GTAATACGACTCACTATAGGGC
cDNA amplification
AAP AUAP UAP
GGCCACGCGTCGACTAGTACGGGGGGGGGG GGCCACGCGTCGACTAGTAC CUACUACUACUAGGCCACGCGTCGACTAGTAC
5 end amplification
Tri-Mye1 Tri-Mye2 Tri-Mye3
TCGTACAAAACTACGCCGGA CGTGTGAGCAAACCTTTCCT TCATTTTTCTTTTTTAGCAGCTTGTC
Nested PCR for TS2
2.2. Polyclonal antibodies against Sp2/0 myeloma cells and immunological screening of the library
3. Results and discussion 3.1. Screening of the cDNA library
Sp2/0 myeloma cells were cultured in RPMI-1640 supplemented with 2 mM l-glutamine, 10% fetal calf serum and 400 U/ml penicillin. Crude antigen was prepared from log phase cells by freezing and thawing 5 times. Anti-serum was obtained by multiple immunizations of Balb/C mice with this crude antigen preparation and subsequent ELISA testing of the serum until positive. The cDNA expression library in Escherchia coli XL1-Blue was immunoscreened using previously described methods (Maldonado et al., 2005; Lam Kin, 2006; Liu et al., 2005; Hayashi et al., 2004) and a picoBlue Immunoscreening Kit (Stratagene) according to the manufacturer’s instructions. 2.3. Identification and sequencing of positive clones Plasmids containing inserts were excised from recombinant phage and sub-cloned into the E. coli XLOLR. Inserts were also analyzed by restriction enzyme digestion with EcoRI–XhoI. Sequencing of plasmid DNA was performed at TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa Dalian). Based upon the preliminary sequence information, the fulllength sequence was cloned by 5 RACE (Invitrogen, Version 2.0). Oligo-RNA primers were ligated to T. spiralis mRNA followed by cDNA synthesis and PCR amplification using Tri-Mye1, Tri-Mye2, Tri-Mye3 primers, and T3/T7 universal primers. PCR products were ligated into the pMD18-T vector, transformed into E. coli DH5␣ and clones containing inserts were sequenced. DNA sequences were examined for homology in GenBankTM , and the consensus amino acid sequence of one gene was analyzed by DNAStar Software to predict protein structure and function.
In an initial library screening, 450,000 pfu were plated and screened with mouse anti-Sp2/0 myeloma cell sera at a dilution of 1:5000. One positive clone was identified which harbored an insert approximately 400 bp in length, as verified by PCR using vector derived forward and reverse primers i.e. T3/T7 primer sequences. This gene fragment was sequenced and identified, by BLAST, as a T. spiralis ML sequence. After 5 -RACE, a fragment of 569 bp was obtained which included a complete coding sequence with an open reading frame (ORF) of 411 bp and both start and stop codons. BLAST analysis (www.blast.ncbi.nlm.nih.gov/Blast) showed that the gene exhibited 99.0% identity to ribosomal protein S24 from T. spiralis. The ORF, encoding 136 amino acids (aa) with a predicted molecular weight of 15.6 kDa, was named TS2. Compared with the previously reported ribosomal protein S24 of T. spiralis, two base differences were observed (135 C → A and 327 A → G) resulting in one mutation (aa45 Asp → Glu) and one synonymous change (aa109). 3.2. Predictions of protein structure and function Analysis using InterProScan (www.ebi.ac.uk/ InterProScan/) further characterized the protein as 40S ribosomal protein S24e, containing a nucleotide binding site located between aa 13 and 114. ELM analysis (http://elm.eu.org/) predicted four N-Arg cleavage sites of binary transferase (N-Arg dibasic convertase cleavage site) located at aa 34–36, 45–47, 48–50 and 51–53; a carboxyl peptide amidation site (peptide C-terminal amidation) at aa 44–47, and a glycosaminoglycan attachment site at
Table 2 Results of ELM motif search after globular domain filtering, structural filtering and context filtering. Name
Match
Positions
Description
Cell compartment
Pattern
CLV NDR 1
VRK GRK QRK ERK
34–36 45–47 48–50 51–53
N-Arg dibasic convertase (nardilysine) cleavage site (Xaa-|-Arg-Lys or Arg-|-Arg-Xaa
Extracellular, Golgi apparatus, cell surface
.RK|RR ˆ [KR]
MOD-Cter Amidation
TGRK
44–47
Peptide C-termial amidation
Extracellular, secretory granule
(.)G[RK] [RK]
MOD ClcNHglycan
SSGF
11–14
Glycosaminoglycan attachment site
Extracellular, Golgi apparatus
[ED] {0,3}.(S) [GA]
L. Duan et al. / Veterinary Parasitology 194 (2013) 183–185
aa 11–14 (Table 2). Six linear epitopes were predicted by DNAStar, at aa 10–28, 30–40, 47–56, 66–75, 83–96 and 98–136. Modification of amidation is reported to be essential to peptide function. Further, glycosaminoglycans are polysaccharides involved in adhesion of angiogenesis regulatory factors and play important roles in tumor formation, transfer and blocking (Eipper et al., 1992; Zhu and Zhao, 2000). Thus, we have identified a ribosomal protein of T. spiralis that is recognized by anti-serum derived from mice exposed to Sp2/0 myeloma cells. It remains to be determined whether immunization with this protein might influence the progression of cancer in this system. Conflict of interest statement The authors declare no conflicts of interest. Acknowledgments This study was supported by grants from Jilin Provincial Science and Technology Department (Grant Nos. 20106044 and 2003055025) and the Ministry of Chinese Science and Technology Department (Grant Nos. 2006CB910505 and 2010CB530004).
185
References Eipper, B.A., Stoffers, D.A., Mains, R.E., 1992. The biosynthesis of neuropeptides: peptide alpha-amidation. Annu. Rev. Neurosci. 15, 57–85. Gong, P., Zhang, J., Cao, L., Nan, Z., Li, J., Yang, J., Fang, H., Jiao, H., Jiang, T., Su, L., Zhang, X., 2011. Identification and characterization of myeloma-associated antigens in Trichinella spiralis. Exp. Parasitol. 127, 784–788. Hayashi, H., Matsumoto, H., Akiyama, K., 2004. New insecticidal compounds, communesins C, D and E, from Penicillium expansum link MK-57. Biosci. Biotechnol. Biochem. 68, 753–756. Lam Kin, S., 2006. Discovery of novel metabolites from marine actinomycetes. Curr. Opin. Microbiol. 9, 245–251. Liu, S., Gu, W., Lo, D., Ding, X.Z., Ujiki, M., Adrian, T.E., Soff, G.A., Silverman, R.B., 2005. N-methylsansalvamide a peptide analogues. Potent new antitumor agents. J. Med. Chem. 48, 3630–3638. Maldonado, L.A., Fenical, W., Jensen, P.R., Kauffman, C.A., Mincer, T.J., Ward, A.C., Bull, A.T., Goodfellow, M., 2005. Salinispora arenicola gen. nov., sp. nov. and Salinispora tropica sp. nov., obligate marine actinomycetes belonging to the family Micromonosporaceae. Int. J. Syst. Evol. Microbiol. 55, 1759–1766. Rosenberg, S.A., 2000. Principles and Practice of the Biologic Therapy of Cancer. Lippincott Williams & Wilkins, Philadelphia, pp. 601–615. Wei, Y.Q., Tian, L., 2002. Xenogeneic homologous genes, molecular evolution and cancer therapy. Prog. Nat. Sci. 2, 140–143. Wei, Y.Q., Wang, Q.R., Zhao, X., 2000. Immunotherapy of tumor with xenogeneic endothelial cells as vaccine. Nat. Med. 6, 1160–1166. Zhu, G.F., Zhao, L.H., 2000. The progress about study of N-acetyl-chitooligosaccharides and chito-oligosaccharides. Chin. J. Mar. Drugs 1, 43–46.
Contents lists available at SciVerse ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Identification of a novel gene product expressed by Trichinella spiralis that binds antiserum to Sp2/0 myeloma cells Lingxin Duan a , Jianhua Li a,∗ , Boqi Cheng b , Qiang Lv a , Peng-tao Gong a , Li-bo Su a , Yanan Cai a , Xichen Zhang a,∗ a b
College of Animal Science and Veterinary Medicine, Jilin University, 5333 Xi’an Road, Changchun 130062, China College of Life Science, Jilin University, 2699 Qianjin Street, Changchun 130012, China
a r t i c l e Keywords: Bioinformatics cDNA library Sp2/0 myeloma cell Trichinella spiralis
i n f o
a b s t r a c t To obtain novel antigen genes for use as an anti-tumor vaccine, a Trichinella spiralis cDNA expression library was constructed from muscle larvae RNA and screened with sera from Balb/C mice injected with Sp2/0 myeloma cells. One positive clone was obtained after three rounds of immunoscreening of the cDNA expression library and was subsequently excised in vivo using the ExAssist helper phage with SOLR strain. A full-length gene was amplified using 5 -RACE technology and analyzed by BLAST, Protein Analysis System of ELM, and DNAStar Software. The sequencing results showed that the fragment was 569 bp in length and contained an open reading frame. It was predicted that the full-length gene encoded 136 amino acids. This gene, TS2, contained four putative N-Arg dibasic convertase (nardilysine) cleavage sites, one peptide C-terminal amidation site, and one glycosaminoglycan attachment site. Six antibody epitopes were predicted by bioinformatic analysis. © 2013 Elsevier B.V. All rights reserved.
1. Introduction The landmark discovery of tumor antigens suggests that stimulating tumor-suppressive cellular and/or humoral immune responses is one method to fight cancer. However, most tumor antigens derived from tumor cells are only weakly immunogenic which limits their effectiveness (Rosenberg, 2000; Wei et al., 2000). Xenogeneic homologs, antigens which differ by only a small amount, provide one means to combat immune tolerance, increase immunogenicity, and more strongly induce anti-tumor immune responses against autologous tumor cells (Wei and Tian, 2002). Because intracellular parasitism by Trichinella spiralis has been shown to suppress certain kinds of tumors, we were interested in identifying Trichinella antigens induced by myelomas. Previously, ELISAs and Western
∗ Corresponding authors. Tel.: +86 431 7981351; fax: +86 431 7981351. E-mail addresses: [email protected] (J. Li), [email protected] (X. Zhang). 0304-4017/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetpar.2013.01.051
blots have been used to identify shared antigens between T. spiralis and Sp2/0 tumor cells (Gong et al., 2011); however, the genes encoding these shared antigens have not been reported. Herein we immunoscreened a T. spiralis cDNA expression library to identify candidate genes encoding tumor-suppressing antigens.
2. Materials and methods 2.1. cDNA expression library construction A cDNA library was constructed from muscle larva (ML) of T. spiralis using the ZAP Express cDNA Synthesis Kit and ZAP Express cDNA Gigapack III Gold Cloning Kit (Stratagene) according to manufacturer protocols. To evaluate the transformation efficiency and the insert length of the cDNA library, the sizes of the cloned inserts were analyzed by restriction enzyme digestion. The primers were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Table 1).
184
L. Duan et al. / Veterinary Parasitology 194 (2013) 183–185
Table 1 Primer sequences. Primer name
Sequence (5 → 3 direction)
Usage
T3 T7
AATTAACCCTCACTAAAGGG GTAATACGACTCACTATAGGGC
cDNA amplification
AAP AUAP UAP
GGCCACGCGTCGACTAGTACGGGGGGGGGG GGCCACGCGTCGACTAGTAC CUACUACUACUAGGCCACGCGTCGACTAGTAC
5 end amplification
Tri-Mye1 Tri-Mye2 Tri-Mye3
TCGTACAAAACTACGCCGGA CGTGTGAGCAAACCTTTCCT TCATTTTTCTTTTTTAGCAGCTTGTC
Nested PCR for TS2
2.2. Polyclonal antibodies against Sp2/0 myeloma cells and immunological screening of the library
3. Results and discussion 3.1. Screening of the cDNA library
Sp2/0 myeloma cells were cultured in RPMI-1640 supplemented with 2 mM l-glutamine, 10% fetal calf serum and 400 U/ml penicillin. Crude antigen was prepared from log phase cells by freezing and thawing 5 times. Anti-serum was obtained by multiple immunizations of Balb/C mice with this crude antigen preparation and subsequent ELISA testing of the serum until positive. The cDNA expression library in Escherchia coli XL1-Blue was immunoscreened using previously described methods (Maldonado et al., 2005; Lam Kin, 2006; Liu et al., 2005; Hayashi et al., 2004) and a picoBlue Immunoscreening Kit (Stratagene) according to the manufacturer’s instructions. 2.3. Identification and sequencing of positive clones Plasmids containing inserts were excised from recombinant phage and sub-cloned into the E. coli XLOLR. Inserts were also analyzed by restriction enzyme digestion with EcoRI–XhoI. Sequencing of plasmid DNA was performed at TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa Dalian). Based upon the preliminary sequence information, the fulllength sequence was cloned by 5 RACE (Invitrogen, Version 2.0). Oligo-RNA primers were ligated to T. spiralis mRNA followed by cDNA synthesis and PCR amplification using Tri-Mye1, Tri-Mye2, Tri-Mye3 primers, and T3/T7 universal primers. PCR products were ligated into the pMD18-T vector, transformed into E. coli DH5␣ and clones containing inserts were sequenced. DNA sequences were examined for homology in GenBankTM , and the consensus amino acid sequence of one gene was analyzed by DNAStar Software to predict protein structure and function.
In an initial library screening, 450,000 pfu were plated and screened with mouse anti-Sp2/0 myeloma cell sera at a dilution of 1:5000. One positive clone was identified which harbored an insert approximately 400 bp in length, as verified by PCR using vector derived forward and reverse primers i.e. T3/T7 primer sequences. This gene fragment was sequenced and identified, by BLAST, as a T. spiralis ML sequence. After 5 -RACE, a fragment of 569 bp was obtained which included a complete coding sequence with an open reading frame (ORF) of 411 bp and both start and stop codons. BLAST analysis (www.blast.ncbi.nlm.nih.gov/Blast) showed that the gene exhibited 99.0% identity to ribosomal protein S24 from T. spiralis. The ORF, encoding 136 amino acids (aa) with a predicted molecular weight of 15.6 kDa, was named TS2. Compared with the previously reported ribosomal protein S24 of T. spiralis, two base differences were observed (135 C → A and 327 A → G) resulting in one mutation (aa45 Asp → Glu) and one synonymous change (aa109). 3.2. Predictions of protein structure and function Analysis using InterProScan (www.ebi.ac.uk/ InterProScan/) further characterized the protein as 40S ribosomal protein S24e, containing a nucleotide binding site located between aa 13 and 114. ELM analysis (http://elm.eu.org/) predicted four N-Arg cleavage sites of binary transferase (N-Arg dibasic convertase cleavage site) located at aa 34–36, 45–47, 48–50 and 51–53; a carboxyl peptide amidation site (peptide C-terminal amidation) at aa 44–47, and a glycosaminoglycan attachment site at
Table 2 Results of ELM motif search after globular domain filtering, structural filtering and context filtering. Name
Match
Positions
Description
Cell compartment
Pattern
CLV NDR 1
VRK GRK QRK ERK
34–36 45–47 48–50 51–53
N-Arg dibasic convertase (nardilysine) cleavage site (Xaa-|-Arg-Lys or Arg-|-Arg-Xaa
Extracellular, Golgi apparatus, cell surface
.RK|RR ˆ [KR]
MOD-Cter Amidation
TGRK
44–47
Peptide C-termial amidation
Extracellular, secretory granule
(.)G[RK] [RK]
MOD ClcNHglycan
SSGF
11–14
Glycosaminoglycan attachment site
Extracellular, Golgi apparatus
[ED] {0,3}.(S) [GA]
L. Duan et al. / Veterinary Parasitology 194 (2013) 183–185
aa 11–14 (Table 2). Six linear epitopes were predicted by DNAStar, at aa 10–28, 30–40, 47–56, 66–75, 83–96 and 98–136. Modification of amidation is reported to be essential to peptide function. Further, glycosaminoglycans are polysaccharides involved in adhesion of angiogenesis regulatory factors and play important roles in tumor formation, transfer and blocking (Eipper et al., 1992; Zhu and Zhao, 2000). Thus, we have identified a ribosomal protein of T. spiralis that is recognized by anti-serum derived from mice exposed to Sp2/0 myeloma cells. It remains to be determined whether immunization with this protein might influence the progression of cancer in this system. Conflict of interest statement The authors declare no conflicts of interest. Acknowledgments This study was supported by grants from Jilin Provincial Science and Technology Department (Grant Nos. 20106044 and 2003055025) and the Ministry of Chinese Science and Technology Department (Grant Nos. 2006CB910505 and 2010CB530004).
185
References Eipper, B.A., Stoffers, D.A., Mains, R.E., 1992. The biosynthesis of neuropeptides: peptide alpha-amidation. Annu. Rev. Neurosci. 15, 57–85. Gong, P., Zhang, J., Cao, L., Nan, Z., Li, J., Yang, J., Fang, H., Jiao, H., Jiang, T., Su, L., Zhang, X., 2011. Identification and characterization of myeloma-associated antigens in Trichinella spiralis. Exp. Parasitol. 127, 784–788. Hayashi, H., Matsumoto, H., Akiyama, K., 2004. New insecticidal compounds, communesins C, D and E, from Penicillium expansum link MK-57. Biosci. Biotechnol. Biochem. 68, 753–756. Lam Kin, S., 2006. Discovery of novel metabolites from marine actinomycetes. Curr. Opin. Microbiol. 9, 245–251. Liu, S., Gu, W., Lo, D., Ding, X.Z., Ujiki, M., Adrian, T.E., Soff, G.A., Silverman, R.B., 2005. N-methylsansalvamide a peptide analogues. Potent new antitumor agents. J. Med. Chem. 48, 3630–3638. Maldonado, L.A., Fenical, W., Jensen, P.R., Kauffman, C.A., Mincer, T.J., Ward, A.C., Bull, A.T., Goodfellow, M., 2005. Salinispora arenicola gen. nov., sp. nov. and Salinispora tropica sp. nov., obligate marine actinomycetes belonging to the family Micromonosporaceae. Int. J. Syst. Evol. Microbiol. 55, 1759–1766. Rosenberg, S.A., 2000. Principles and Practice of the Biologic Therapy of Cancer. Lippincott Williams & Wilkins, Philadelphia, pp. 601–615. Wei, Y.Q., Tian, L., 2002. Xenogeneic homologous genes, molecular evolution and cancer therapy. Prog. Nat. Sci. 2, 140–143. Wei, Y.Q., Wang, Q.R., Zhao, X., 2000. Immunotherapy of tumor with xenogeneic endothelial cells as vaccine. Nat. Med. 6, 1160–1166. Zhu, G.F., Zhao, L.H., 2000. The progress about study of N-acetyl-chitooligosaccharides and chito-oligosaccharides. Chin. J. Mar. Drugs 1, 43–46.