Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YFSIM3281_proof ■ 22 January 2015 ■ 1/9

Fish & Shellfish Immunology xxx (2015) 1e9

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix Q3

Linhu Zou a, b, Baozhong Liu a, * a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 October 2014 Received in revised form 7 January 2015 Accepted 8 January 2015 Available online xxx

Serum amyloid A (SAA), an acute response protein as well as an apolipoprotein, is considered to play crucial roles in both innate immunity and lipid metabolism. In this study, a SAA gene (MmSAA) was identified in the clam Meretrix meretrix. The full length DNA of MmSAA was 1407 bp, consisting of three exons and two introns. The distribution of MmSAA in clam tissues was examined with the highest expression in hepatopancreas. In response to the Vibrio parahaemolyticus challenge, MmSAA mRNA showed significantly higher expression at 24 h post-challenge in experimental clams (P < 0.05). Fortyeight single nucleotide polymorphisms (SNPs) in the DNA partial sequence of MmSAA were discovered and examined for their association with Vibrio-resistance and growth traits, respectively. The single SNP association analysis indicated that five single SNPs (g.42, g.72, g.82, g.147 and g.165) were significantly associated with Vibrio-resistance (P < 0.05). Haplotype analysis produced additional support for association with the Chi-square values 6.393 (P ¼ 0.012). Among the five selected SNPs, the effect of a missense mutation (g.82, A / G) was detected by site-directed mutagenesis with fusion expression of protein assay, and the result showed that the recombinant plasmids containing wild-type pET30aMmSAA had more inhibition effect than the mutant ones on the growth rate of the host bacteria. In addition, four growth traits of the clams in 09G3SPSB population were recorded and the SNP g.176 was found to be significantly associated with the growth traits with the Global score value 0.790 (P ¼ 0.015). Our findings suggested that common genetic variation in MmSAA might contribute to the risk of susceptibility to Vibrio infection and might be associated with the growth traits in the clams M. meretrix, and more works are still needed to validate these SNPs as potential markers for actual selective breeding. © 2015 Published by Elsevier Ltd.

Keywords: Meretrix meretrix Serum amyloid A Single nucleotide polymorphism Vibrio-resistance Growth trait

1. Introduction The clam Meretrix meretrix is an important economic species of marine bivalve, mainly distributed in the shallow seas of South and Southeast Asia [1]. With the success of artificial breeding, M. meretrix has become one of the widely cultured bivalves in China [2]. In recent years, clam diseases caused by bacteria and virus are becoming more and more common and serious, which inflicted huge financial losses [3]. Hence, it is urgent and crucial to carry out genetic breeding for the selection of high Vibrio-resistance strains of the clam M. meretrix. Marker-assisted selection (MAS) is a powerful method with which breeders can select animals with desirable combination of

* Corresponding author. Tel.: þ86 532 82898696; fax: þ86 532 82898578. E-mail address: [email protected] (B. Liu).

genes. Particularly, previous studies have shown that the genetic improvement is more significant and effective for less domesticated aquatic animals than terrestrial farm animals through MAS methods [4]. Up to now, several successful cases have been reported in breeding programs for disease control and fast-growing in several species of fishes and protostome invertebrates with MAS method [5e9]. Screening of molecular markers associated with certain traits is the first step for MAS [10,11]. Among the molecular markers, single nucleotide polymorphisms (SNPs) are co-dominant, biallelic and distributed widely with high density. Up to now, discovery of SNPs by candidate gene approach is still one of the efficient ways for non-model organisms [12,13]. Serum amyloid A (SAA), one of the main acute proteins in vertebrates, has been reported involving the animals innate immune [14e17], which is often observed to increase markedly within the first 48 h after the triggering event and has a rapid decline due to their short half-life [18,19]. Further study showed that SAA can bind

http://dx.doi.org/10.1016/j.fsi.2015.01.007 1050-4648/© 2015 Published by Elsevier Ltd.

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 2/9

2

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

to many Gram-negative bacteria through outer membrane protein A (OmpA) family members [20]. And at the same time, it is involved in up-regulating PMN antimicrobial activities and yet high circulating concentrations of SAA as seen in the acute phase responses may constitute a potential host defense mechanism against fungal infection [21]. Besides of its immune roles, SAA is found to be expressed in human adipose tissue during the non-acute-phase reaction condition [22e24]. As apolipoprotein, SAA is determined to be able to affect lipid metabolism through regulation of the expression of multiple genes related to lipid metabolism [19,25e27]. Recent reports indicated that SAA is a growth factor for 3T3-L1 adipocytes, which can inhibit differentiation and promote insulin response [28]. Though SAA, a highly conserved gene in mammals, has been reported in many vertebrates, the first and the only article about SAA in mollusc was published in 2014 which suggest that ChSAA is likely to constitute a member of the A-SAA family involved in anti-pathogen responses in oyster Crassostrea hongkongensis [29]. In the present study, we cloned the cDNA sequence of SAA (MmSAA) and detected its tissue distribution in M. meretrix. The mRNA variation of MmSAA was also analyzed after the clams challenged by Vibrio parahaemolyticus. Furthermore, considering the possible roles of SAA in immune system and lipid metabolism, we choose MmSAA as a candidate gene to detect SNPs associated with Vibrio-resistance and growth traits in the clam M. meretrix. The recombinant plasmids of pET30a-MmSAA (wild-type and mutant) were constructed and the effect were tested by comparing the growth rate of the host bacteria. To our knowledge, this study was the first time to identify a SAA gene and analyze SNPs associated with resistance and growth traits in clams. We hope the results would be helpful for genetic selection of the excellent varieties which have the features of fast-growing and/or high-resistance against pathogens in clam M. meretrix. 2. Materials and methods 2.1. Experimental clams The clams (46.51 ± 0.32 mm in shell length) from Shandong population were bought from aquatic market in Qingdao, China. Twenty calms were selected for RNA isolation, DNA isolation, cDNA synthesis and DNA synthesis, and then used for the detection of SNPs distribution in the DNA sequence of MmSAA. One hundred clams were acclimated for one week in our laboratory and then used for the challenge experiment. Clams were maintained at 25e26  C, fed with condensed microalgae and kept in continuous aeration during the acclimation period. Clam samples from three groups (11-C, 11-S and 11-R) [30,31] were applied to evaluate the SNP makers and identify SNPs associated with Vibrio-resistance. In brief, in year 2011, 50 clams randomly collected from Shandong natural population formed the control group (11-C) to evaluate the candidate SNP markers. At the same time, about 1000 clams from the same population were challenged with V. parahaemolyticus, the clams from which were divided into the Vibrio-resistant group (11-R) and the susceptive group (11-S) according to their survived time. An independent clam population with significant growth variances (09G3SPSB) [32], generated in the year 2009, was used to identify SNPs associated with the growth traits (shell length, shell width, shell height, and shell weight). 2.2. Vibrio challenge and sample collection Before the challenge test, five tissues (hepatopancreas, mantle, foot, gill and adductor muscle) were collected from four healthy

clams for the tissue distribution analysis. Sixty clams after acclimation were randomly separated into Vibrio-challenged and control groups. A V. parahaemolyticus strain (MM21), isolated from clams and characterized to be pathogenic to M. meretrix [3], was used to the challenge test. Briefly, 30 clams were injected with 50 mle5  106 CFU ml1 of MM21 in PBS (MM21-injected group) and 30 clams were injected with 50 ml PBS (control group). Then the clams were reared in tanks and sampled at the 0 h, 6 h, 12 h, 24 h and 48 h post-challenge, respectively. The hepatopancreas were dissected and preserved in liquid nitrogen for RNA extraction. There were four replicates for each time point. 2.3. RNA and DNA extraction and cDNA synthesis RNA of the different samples were extracted by Unizol Total RNA Isolation Reagent (Promega, USA) according to the manufacturer's protocol. cDNA was systhesized from total RNA with M-MLV reverse transcriptase (Promega, USA), oligo (dT) primer and BDA oligo according to the manufacturer's protocol of SMART RACE cDNA Amplification Kit (Clontech, USA). Totol genomic DNA (gDNA) was extracted from foot tissue of each clam using DNA extraction kit special for marine animals (Tiangen, China) following the manufacturer's protocol. DNA stocks were diluted to 100 ng/ml and used as templates in PCR reactions for sequencing. 2.4. Cloning of full length cDNA and DNA of MmSAA The full-length cDNA sequence of MmSAA was obtained by 50 and 30 Rapid Amplification of cDNA Ends (RACE) using SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA). Cloning primers of MmSAA50 GSP, MmSAA50 NGSP, MmSAA30 GSP and MmSAA30 NGSP were designed according to the contig21074 which is similar to SAA genes from the transcriptome sequencing data of clam M. meretrix analyzed using the NGS [33]. The PCR products were purified, inserted into the pMD19-T vector using TA cloning kit (TakaRa), respectively. Clones with confirmed recombinant plasmids were sequenced by Beijing Genomics Institute (BGI). The full-length cDNA of MmSAA was assembled by alignment of the partial cDNA fragment, 50 - and 30 -RACE fragments with the aid of SeqMan program of Larsergene software. In order to confirm the full length cDNA of MmSAA, a pair of primers (cMmSAAF and

Table 1 PCR primers in this study. Primers

Sequences (50 e30 )

Usage

MmSAA50 GSP MmSAA50 NGSP MmSAA30 GSP MmSAA30 NGSP cMmSAAF

CAATCGCCCGTTGAGACCAT AGTTCCCCTCTGTGCTGCCT CGTGGTCTTGACAGGCGTTACTA TACTTACTTCACTAAAGCACAGGACACT CAGAACATACAGAGCGATGAAGC

cMmSAAR

ATTTAGTGTCCTGTGCTTTAGTGAA

MmSAA-RT-F MmSAA-RT-R actin-F actin-R ESAA-F

GACGCTGACCAAGAAGCCAAC GAAGCATGTCTTAGTAACGCCTGTC TTGTCTGGTGGTTCAACTATG TCCACATCTGCTGGAAGGTG CGGGATCCAACGTTTTCCAACGA GCTAGGA CGGGATCCAACGTTTTCCAACGA GCTGGGA ATAAGAATGCGGCCGCGTAACG CCTGTCAAGACCACG

50 -Race PCR 50 -Race PCR 30 -Race PCR 30 -Race PCR Sequence verify and SNP genotyping Sequence verify and SNP genotyping Quantitative RT-PCR Quantitative RT-PCR Quantitative RT-PCR Quantitative RT-PCR Point mutation and prokaryotic expression Point mutation and prokaryotic expression Point mutation and prokaryotic expression

ESAA-F0 ESAA-R

The positions of SNP g.82 were shown in bold and italics letters. Tails added to primers are shown in bold, italic letters.

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 3/9

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

cMmSAAR) were designed and used for PCR amplification. All the sequences of primers were list in Table 1. The MmSAA cDNA sequence was analyzed using the BLASTX search program (http://www.ncbi.nlm.nih.gov/blast/). The ORF of MmSAA was obtained through the ORF finder (http://www.ncbi. nlm.nih.gov/gorf/gorf.html) and the amino acid sequence deduced from the cDNA of MmSAA was analyzed using ExPASy server (http://www.expasy.org/tools/) for signal peptide prediction, secondary structure prediction, molecular weight prediction and isoelectric point (pI) prediction etc. To obtain the MmSAA DNA sequence, the prepared genomic DNA was used as template for PCR with the primer pair of cMmSAAF and cMmSAAR. The intron sequences were characterized using BioEdit version 7.0.5.2. 2.5. MmSAA mRNA expression in different tissues and in hepatopancreas after Vibrio challenge The mRNA expressions of MmSAA in different tissues or in hepatopancreas after Vibrio challenge were measured by SYBR Green quantitative RT-PCR using specific primer pair of MmSAART-F and MmSAA-RT-R. b-actin gene was amplified by specific primers actin-F and actin-R, which was set as the internal reference to normalize the expression levels between samples. Serial twofold dilutions of every sample (1, 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128 and 1/256) were amplified to determine both pairs of primer had similar efficiency using the formula E ¼ 101/slope. Three repeats of each sample were analyzed and the analysis was carried out on a quantitative thermal cycler (Mastercycler ep realplex, Eppendorf, Gemany) in a 10 ml reaction volume containing 20 ng template, 0.3 mM of each primers, and SuperReal qPCR PreMix (Tiangen, China). PCR parameters were 95  C for 15 min, then 40 cycle of 95  C for 15 s, 56.5  C for 15 s and 72  C for 20 s followed by the fluorescence melting curve analysis. Relative gene expression level was analyzed using the 2△△CT method [34]. 2.6. SNPs detection and genotyping The mix of genomic DNAs isolated from 20 clams were used as template to amplify the DNA of MmSAA with primers cMmSAAF and cMmSAAR and then sequenced to scan for sequence variation. The causative SNP sites were initially identified by aligning the sequences of different samples. The genotype of individual at each SNP site was determined by reading the sequence map using BioEdit version 7.0.5.2. Fifty individuals from 11-C, 40 from 11-S and 42 from 11-R were genotyped by PCR and sequencing with primer cMmSAAF and cMmSAAR to determine the SNPs associated with Vibrio-resistance. Eighty-six clams from 09G3SPSB were genotyped by PCR and sequenced with the primer cMmSAAF to detect SNPs related to the growth traits. 2.7. Site-directed mutagenesis and construction of the recombinant expression plasmids Sequences of the signal peptide were removed and three specific primers (ESAA-F for the upstream primer of wild-type (g.82A), ESAA-F0 for the upstream primer of the mutant (g.82-G) and ESAA-R for the downstream primer of both wild-type and mutant) were designed according to the full length cDNA of MmSAA to acquire the ORF sequences. The primers ESAA-F and ESAA-F0, combined with ESAA-R respectively, were used to amplify the DNA fragments encoding the wild-type and mutant peptides of MmSAA. The target PCR products were then digested with BamH I and Not I (Takara) respectively in 37  C for 4 h and then sub-cloned into the BamH I/Not I sits of expression vector pET30a (Novagen, Germany)

3

66 67 68 69 70 71 72 73 74 2.8. The effect detection of recombinant proteins to E. coli 75 76 The effects of the MmSAA proteins (wild-type and mutant) on 77 the growth of the strain E. coli BL21 (DE3) were detected in LB78 kanamycin medium containing kanamycin 30 mg/ml, with a 79 macrophage migration inhibitory factor (MmMIF) (Accession: 80 KP221196) protein isolated from M. meretrix as control. The MmMIF Q1 81 had the closer molecular weight with MmSAA and had no direct 82 effect on the growth rate of E. coli. The IPTG (1 mmol/L) was added 83 into the three cultures when their absorbance at 600 nm (OD600) 84 reached 0.5e0.7 to induce the hosts expressing its corresponding 85 recombinant proteins. The OD600 of the cultures were measured a 86 total of eight time points before and after adding IPTG (1 mmol/L) 87 and repeated for three times. The growth curves of the three kinds 88 of bacteria were constructed according to the OD600 and the cor89 responding time points. The discrepancy of the OD value in 90 different strains was analyzed by one-way ANOVA using Tukey's 91 test with PROC ANOVA in SAS (version 9.3). A significant level of 92 0.05 was used for the test. 93 94 95 2.9. Statistical analysis 96 97 One-way ANOVA with Tukey's test was used to analyze MmSAA 98 mRNA expression in different samples, which was performed using 99 PROC ANOVA command in SAS software (version 9.3). A signifi100 cance level of 0.05 was used for all tests. 101 Allele frequencies of each SNP locus from different clam 102 populations were calculated. The SNP loci with minor allele 103 frequency (MAF) less than 5% in all clam populations were dis104 carded and not applied to the association analysis. Har105 dyeWeinberg equilibrium (HWE) of each SNP locus among 106 individuals in control 11-C and 09G3SPSB group was tested by 107 Fisher's exact-test using software SAS 9.3 genetic package. The 108 SNP loci deviating from HWE (P < 0.05) in 11-C were discarded 109 and not further studied. 110 Marker-trait association analysis between the SNPs and Vibrio111 resistance were performed by the Chi-square and Fisher's exact 112 tests using SAS genetics package. The odds ratio (OR) was calcu113 lated. A P value less than 0.05 was considered significant to the 114 SNPs and Vibro-resistance association analysis. Linkage disequilib115 rium (LD) pattern and haplotype structure of MmSAA were char116 acterized using Haploview software package 4.2. Haplotypes and 117 their frequencies were established and analyzed by SAS 9.3 118 software. 119 Multivariate analysis of variance analysis and Multiple linear 120 regression methods was undertaken to test for associations be121 tween SNP genotypes and growth traits under an additive model 122 with PROC GLM in SAS 9.3 software package according to the ad123 ditive model (common allele homozygotes coded as1, heterozy124 gotes as 2, and recessive allele homozygotes as 3). 125 The web-based tools of NetGene2 (http://www.cbs.dtu.dk/ 126 services/GetGene2) and RegRNA 2.0 (http://regrna2.mbc.nctu.edu. 127 tw/detection.html) were used to identify functional RNA motifs 128 and sites [35], which play essential roles in transcriptional and 129 post-transcriptional regulation of gene expression, via scanning the 130 sequences near the SNPs associated with specific traits in MmSAA. by T4 DNA ligase (Takara). The recombinant plasmids (pET30aMmSAA) were then transformed into Escherichia coli BL21 (DE3), and cultured on LuriaeBertani (LB) plates containing kanamycin 30 mg/ml. The positive recombinant cells were picked and cultured in LB medium with 30 mg/ml kanamycin. Then the recombinant cells were subjected to DNA sequencing to confirm identity of recombinant plasmids by Beijing Genomics Institute (BGI).

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 4/9

4

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

3. Results 3.1. Sequence analysis of the MmSAA gene The full-length cDNA of MmSAA was 674 bp (Gebank accession no. KM850989) containing a 384 bp open reading frame (ORF), a 18 bp of 50 -UTR and a 272 bp of 30 -UTR including a putative polydenylation consensus signal (AATAA) and a poly (A) tail. The full length DNA of MmSAA was 1407 bp, consisting of three exons and two introns (Supplementary 1S). A protein with 127 amino acid residues was encoded by the ORF with a molecular mass of 14.39 kDa and a pI of 10.61. MmSAA has a potential signal peptide with 21 amino acid residues in N-terminal. Second structure predictions indicated that the MmSAA is likely to contain a hydrophobic region in the N-end, a neutrophil and GAG binding region in the C-end, two regions of a-helix and two b-strands (Fig. 1). The multiple alignment indicated that MmSAA showed significant similarity to various known SAAs; overall, MmSAA had similarity to Serum amyloid A protein-like of Oncorhynchus mykiss (77%), Danio rerio (67%), Gallus gallus (66%), C. hongkongensis (68%), Homo sapiens (64%) and Strongylocentrotus purpuratus (51%).

Fig. 2. Relative quantity of MmSAA mRNA in different tissues of M. meretrix. Values are normalized to b-actin (mean ± SE, n ¼ 4). Error bars represent standard deviation of four replicates.

3.2. Tissue distribution of MmSAA The expression of MmSAA mRNA was detected in five tissues, i.e hepatopancreas, mantle, foot, gill and adductor muscle (Fig. 2). The hepatopancreas exhibited the highest mRNA expression, yet the mRNA expression of mantle, foot, and adductor muscle was at moderate level. The gill showed relatively low mRNA expression in comparison with the other tissues. 3.3. MmSAA expression in response to Vibrio challenge The expression of MmSAA mRNA in hepatopancreas of both the PBS-injected clams and the MM21-injected clams was shown in Fig. 3. The mRNA expression of MmSAA had no significant variation in control group during the experimental period (P > 0.05). Whereas, its expressions in MM21-injected group increased and reached the peak at 24 h, showed significant difference compared with that in other time points (P < 0.05). At 24 h, there was a

significant difference expression between the MM21-injected group and control group (P < 0.05). 3.4. SNP detection in Vibrio-resistance population and growth related population Forty-seven SNPs were discovered in the DNA partial sequence spanned 196 bp of the 50 terminus of MmSAA. A total of 28 SNPs in MmSAA have been genotyped in 50 individuals of 11-C group. After general statistical analysis and Chi-square test, of these SNPs, 20 SNPs were common (MAF > 5%), and only 11 SNPs were applied to the association analysis after HWE analysis (Table 2). The location of each SNP was relative to the transcriptional start (ATG). A total of 13 SNPs in the MmSAA were genotyped in 86 individuals of 09G3SPSB. Eight of these 13 SNPs were common (MAF > 0.05) spanned 196 bp of the 50 terminus of MmSAA. Allele frequencies of these SNPs were shown in Table 3.

Fig. 1. Multiple alignment of the amino acid sequences of MmSAA with other known SAAs. GenBank accession numbers for these SAA protein sequences used are as follows: M. meretrix (KM850989), Holothuria glaberrima (AAG24633.1), Lates calarifer (ADE05545.1), Danio rerio (NP_001005599.1), Oncorhynchus mykiss (NP_001117908.1), Gallus gallus (ADF56353.1), Mus musculus (NP_033143.1), Panthera tigris altaica (AGU01750.1); Homo sapiens (AAH07022.1); Felis silvestris catus (BAE93428.1).

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 5/9

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

5

(Fig. 4). Four haplotypes developed from the five significant SNPs had frequencies above 1% in controls, with a cumulative frequency above 100% (Table 5). The overall association between the haplotypes and Vibrio-resistance was significant with the global score value 6.393 (P ¼ 0.012). Hap1 (TCACT) was significantly underrepresented in 11-S group and could be protective, the haplotypespecific score value was 5.656 (P ¼ 0.017); Hap3 (CTGTC) was significantly underrepresented in 11-R group and could increase the risk of Vibiro infection, with the haplotype-specific score value 3.864 (P ¼ 0.049). To find possible risk haplotypes and evaluate the effect of each haplotype, haplo.glm model was further performed, in which hap1 (TCACT), the putatively protective, was chosen as the baseline. Hap2 (TCGTT) was found to significantly increase the risk of susceptibility to Vibrio infection with the adjusted odds ratio 2.11 (95% CI 1.10e4.05, P < 0.05) (Table 5). 3.6. SNP associated with the growth traits

Fig. 3. Expression of MmSAA mRNA after Vibrio injection. Error bars represent standard deviation of four repeats. “*” Represents a significantly higher expression of MmSAA mRNA in MM21-injected clams compared to that in PBS-injected clams at the same time post-challenge.

3.5. SNPs associated with Vibrio-resistance Eighty two individuals from two groups with different Vibrioresistance (11S: n ¼ 40; 11R: n ¼ 42) were genotyped with the 11 selected SNPs. The genotypes and allele frequencies of the locis showed in Table 4. Single SNP analyses indicated that SNPs g.42, g.72, g.82, g.147 and g.165 were significantly associated with Vibrioresistance. Then the five SNPs were used to characterize the linkage disequilibrium (LD) pattern and haplotype structure in the 50 terminus of MmSAA. Pairwise LD was measured by D0 (a disequilibrium parameter) among these five SNPs, with value of 0 indicating the absence of linkage disequilibrium and value of 1 indicating the linkage disequilibrium is complete (rarity of recombination between a pair of SNPs). The LD decreased between g.82 and g.147

Table 2 Polymorphism of SNPs in genomic DNA of MmSAA in 11-C population of M. meretrix. Code Location

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

g.42T > C g.72C > T g.82A > G g.91 G > T g.111T > A g.117T > A g.139T > G g.141A > T g.147C > T g.150C > T g.161C > T g.165T > C g.180C > T g.956G > A g.1020G > A g.1062C > T g.1089T > A g.1110T > A g.1167A > T g.1181A > G

MmSAA Number MAF (%) Test for HWE region of individuals Chi-Square DF Pr > ChiSq exon1 exon1 exon1 exon1 exon1 exon1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1 intron1

49 50 50 50 50 50 50 50 50 50 50 48 47 48 48 48 48 47 47 47

8.2 9 41 5 43 36 5 36 40 39 23 7.3 33 8.3 8.3 35.4 6.3 5.3 6.4 6.4

1.647 1.056 2.302 0.139 4.694 4.668 0.139 7.697 3.125 4.073 3.537 2.529 3.633 1.587 1.587 48 19.935 6.306 19.489 19.489

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

0.199 0.304 0.129 0.71 0.030* 0.031* 0.71 0.006* 0.077 0.044* 0.06 0.112 0.057 0.208 0.208 <0.001* <0.001* 0.012* <0.001* <0.001*

MAF: minor allele frequency; Superscript (*) indicate significant difference at the P < 0.05 level; HWE: HardyeWeinberg equilibrium.

After HWE and MAF analysis, eight SNPs were applied to the association analysis. Four associated growth traits of the individuals in 09G3SPSB population were recorded when the clams reached 12 month [36]. Results showed that among the eight analyzed SNPs, only genotypes of g.176 (T > A) are significantly associated with the four growth traits of clams, and the Global Wilks' Lambda value was 0.790 (P ¼ 0.015) (Table 6). At this locus, clams with genotype AA reached a higher growth index than those with genotype TT (P ¼ 0.007). The growth index with genotype AA has a tendency to increase compared with that with genotype AT, though the difference was not statistically significant (P ¼ 0.473). The result of the computational prediction indicated that the SNP (g.176) was located in the sequence of an intron splicing enhancer (ISE). 3.7. The effect of recombinant proteins to E. coli The recombinant plasmids pET30a-MmSAAs (wild-type and mutant) as well as pET30a-MIF (control) were constructed and then transformed into E. coli BL21 (DE3), respectively. The OD600 of the bacteria were measured and the growth curves of the three kinds of bacteria were constructed according to the OD600 and the corresponding time points. As shown in Fig. 5, the growth rate of the bacteria containing the pET30a-MmSAA (wild-type and mutant) was similar to that containing the pET30a-MIF (control) before adding the IPTG. The two strains with the pET30a-MmSAA grow more slowly than the control strain after adding the IPTG, and the growth rate of the host strain carrying pET30a-MmSAA (wild-type) was significantly suppressed compared with the one carrying pET30a-MmSAA (mutant), which indicates that the missense mutation in recombinant pET30a-MmSAA decreased the inhibition on the growth of host bacteria.

Table 3 Polymorphism of SNPs in genomic DNA of MmSAA in 09 G3SPSB of M. meretrix. Code Location

3 5 6 8 9 10 11 21

g.82A > G g.111T > A g.117T > A g.141A > T g.147C > T g.150C > T g.161C > T g.176T > A

MmSAA Number MAF (%) Test for HWE region of individuals Chi-Square DF Pr > ChiSq exon1 exon1 exon1 intron1 intron1 intron1 intron1 intron1

85 86 86 86 83 83 83 85

23 19 18 17 16 16 13 1

1.913 14.702 12.795 10.777 14.991 14.991 9.815 14.412

1 1 1 1 1 1 1 1

0.167 <0.001* <0.003* 0.001* <0.001* <0.001* 0.002* <0.001*

MAF: minor allele frequency; Superscript (*) indicate significant difference at the P < 0.05 level; HWE: HardyeWeinberg equilibrium.

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 6/9

6

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

Table 4 Association analysis of single SNPs associated with Vibrio-resistance. Code Location

Effect

MAF (%)

Table 5 Association between MmSAA haplotypes and Vibrio-resistance.

ChiSqAllele P value OR (95% CI)

Variables Haplotype Frequencies (%)

11-S 11-R 1 2 3 4 7 9 11 12 13 14 15

g.42T > C g.72C > T g.82A > G g.91 G > T g.139T > G g.147C > T g.161C > T g.165T > C g.180C > T g.956 G > A g.1020G > A

Nonsense Nonsense R>G Nonsense Intron Intron Intron Intron Intron Intron Intron

12.8 11.3 47.5 6.3 5.0 45 27.5 10.3 34.3 7.1 7.1

2.6 0.0 34.2 3.7 3.4 27.4 20.2 1.3 30.8 9.8 9.6

All 5.778 7.034 4.931 0.579 0.797 5.523 0.832 5.076 0.208 0.367 0.367

0.017* 0.008* 0.026* 0.447 0.372 0.019* 0.362 0.024* 0.648 0.545 0.545

5.59 þ∞ 2.06 1.76 2.16 2.17 1.49 9.07 1.17 0.71 0.71

(1.18, 26.41) (1.08, (0.41, (0.38, (1.13, (0.72, (1.09, (0.59, (0.24, (0.24,

3.92) 7.60) 12.12) 4.16) 3.08) 75.66) 2.34) 2.15) 2.15)

MAF: minor allele frequency; OR: odds ratio; CI: 95% percent confidence interval; Superscript (*) indicate significant difference at the P < 0.05 level.

4. Discussion Serum amyloid A, described as an acute response protein as well as an apolipoprotein, is considered to play crucial roles in both innate immunity and lipid metabolism of vertebrate animals. However, relatively few SAA genes have been identified so far in mollusks. In the present study, we inferred that SAA may be associated with the anti-bacterial response and growth of clam, so it was selected as a candidate gene to detect SNPs associated with disease-resistance and growth traits in clam M. meretrix. The MmSAA has a genomic sequence of 1407 nucleotides, containing three exons and two introns, an organization that is similar to some other species [16]. Multiple sequence alignments for the amino acid sequences revealed that SAA was conserved from both invertebrates and vertebrates. The highly conserved nature of SAA implies its crucial roles in controlling fundamental physiological processes [27,37e41]. In MmSAA protein, sequence analysis showed conservation of all amino acid residues mediating SAA functions in other known species. The hydrophobic N-terminal portion of the molecular has been shown to be a major determinant for amyloid formation [42] and C-terminal portion is the proposed neutrophil and GAG binding region. These similarities in primary

Fig. 4. Pair-wise LD among the five MmSAA SNPs in Vibrio-resistance population of clam. Linkage disequilibrum (LD) blocks across the locus in the study population clams was derived by solid spline method in Haploview 4.2. The D0 (a disequilibrium parameter) is a measure of LD which is the correlation coefficient between pairs of loci. Numbers in the red square boxes show the value of the D0 and numbers are absent when the value ¼ 1. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Hap1 Hap2 Hap3 Hap4

TCACT TCGTT CTGTC TCGCT

11-S 11-R

60.5 51.2 30.2 33.8 4.3 7.5 3.1 3.8

69.5 26.8 1.2 2.4

Chi P value OR (95%CI) Square 5.656 0.919 3.864 0.235

0.017 0.338 0.049 0.628

Reference 2.11 (1.10, 4.05) 7.75 (0.90, 66.49) 2.37 (0.82, 6.86)

Haplotypes with frequencies <0.01 were not included in the table; Hap1eHap4 cover 100% of existing haplotypes; Loci are arranged in the order g.42, g.72, g.82, g.147, g.165; Hap1 (TCACT) was chosen to be the baseline haplotype.

sequences and secondary structure lead us to believe MmSAA can be a functionally conversed protein. Many studies have shown that acute-phase proteins (APPs) are inductors of a proin-flammatory reaction and fever, their overexpression can lead to an anti-inflammatory response. Thus, APPs are used today as potential biological markers for monitoring animal welfare and health status [17,43e45]. As a major positive APP, SAA has been demonstrated to play important roles in the host defense against pathogens in vetebrates and invetebrates [29,46,47]. In the present study, the MmSAA was widely expressed in all tested tissues and showed the highest expression level in hepatopancreas. After Vibrio challenge, the mRNA expression of MmSAA up-regulated in hepatopancreas and showed significant difference at 24 h. It is agreement with the view that major APPs are often observed to increase markedly with the first 48 h after the triggering event and have a rapid decline due to their short half-life [18,46e48]. The up-regulation of MmSAA in response to pathogenic stimuli suggested that it might have a shared protective biological function among vetebrates and invetebrates. In the clam M. meretrix, populations with different resistance against Vibrio have been established in our laboratory [30]. Our previous results suggested that there was a genetic basis of Vibrioresistance for this clam, which made us believe that the improvements of clam resistance to Vibrio could be viable through selective breeding [30]. As Serum amyloid A plays an important role in animals' innate immune system, it may be involved in the resistance to Vibrio infection. Recent studies suggested that the genetic polymorphisms of Serum amyloid A were linked to carotid intimamedia thickness, high-density lipoproteins and total cardiovascular disease in human [49]. Another report indicated that, polymorphisms in SAA1 gene are associated with ankle-to-brachial index in Han Chinese healthy subjects [50]. What's more, SAA has been selected as a prognostic marker with various diseases [17,45]. In the present study, 48 SNPs were discovered in MmSAA and the markeretrait association analysis was conducted in groups with different Vibrio-resistance. Five functional SNP markers were deduced to be significantly associated with Vibrio-resistance and the frequencies of the alleles showed significant difference between 11-R and 11-S group (P < 0.05). Among the five SNPs, only g.82 (Arginine > Glycine) produced amino acid variation. Haplotype analysis produced additional support for the association (c2 ¼ 6.393, P ¼ 0.012). Based on the current results, amyloid A is a proteolytic product of SAA, which incorporates 76 residues from the protein N terminus [51]. The amyloidogenic core reside in the first 12 amino acids of SAA [42]. Any change in peptide sequence and chemistry, even a point mutation, may induce a change in the protofilament structure that is reflected in the fiber suprastructure [52]. Besides, the Nterminal region of SAA is important for lipid interaction and the deletion of or substitution in the most N-terminal region (residues 1e11) markedly decreased the binding to lipid [53]. What's more, some research identified that at least some of the amyloid peptides

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 7/9

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

7

Table 6 Mean (±SE) growth traits of genotypes of SNPs in 86 individuals of the 09G3SPSB population of M. meretrix. Code

Location

1

g.82A > G

2

g.111T > A

3

g.117T > A

4

g.141A > T

5

g.147C > T

6

g.150C > T

7

g.161C > T

8

g.176T > A

Genotype

AA AG GG AA AT TT AA AT TT AA AT TT CC CT TT CC CT TT CC CT TT AA AT TT

(n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n (n

¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼

52) 26) 7) 9) 16) 61) 8) 16) 62) 63) 16) 7) 63) 13) 7) 62) 13) 7) 65) 13) 5) 4) 9) 72)

Shell length (mm)

13.52 12.63 14.18 14.12 12.44 13.32 14.05 12.40 13.42 13.27 12.81 13.79 13.27 11.95 13.79 13.27 11.95 13.79 13.35 12.25 12.23 18.45 15.56 12.611

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

4.74 3.03 3.06 2.54 2.96 4.59 2.70 2.92 4.56 4.53 2.93 2.83 4.53 2.49 2.83 4.53 2.49 2.83 4.50 2.57 2.63 6.60 4.95 3.63

Shell height (mm)

11.58 10.99 12.11 12.10 10.95 11.41 12.06 10.89 11.50 11.37 11.26 11.85 11.37 10.35 11.85 11.37 10.35 11.85 11.45 10.55 10.55 15.55 13.26 10.850

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

3.86 2.80 2.61 2.19 2.86 3.75 2.34 2.82 3.73 3.70 2.84 2.47 3.70 2.07 2.47 3.70 2.076 2.47 3.68 2.13 2.24 4.95 4.08 3.01

Shell width (mm)

6.43 6.06 6.72 6.71 5.95 6.34 6.69 5.92 6.38 6.31 6.18 6.55 6.31 5.74 6.55 6.31 5.74 6.55 6.35 5.88 5.700 8.87 7.49 5.99

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

2.32 1.57 1.47 1.23 1.51 2.25 1.3 1.49 2.24 2.22 1.52 1.36 2.22 1.31 1.36 2.22 1.31 1.36 2.21 1.32 1.11 3.38 2.39 1.78

Q2

Shell weight (mm)

0.78 0.54 0.70 0.69 0.50 0.74 0.70 0.50 0.75 0.73 0.56 0.66 0.73 0.44 0.66 0.73 0.44 0.66 0.74 0.46 0.47 1.76 1.14 0.57

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.81 0.38 0.39 0.33 0.34 0.78 0.35 0.34 0.77 0.77 0.36 0.37 0.77 0.27 0.37 0.77 0.27 0.37 0.76 0.27 0.29 1.51 1.11 0.46

MANOVA

Test-Wilks'

Lambda

(P value)

Global

V1eV2

V1eV3

V2eV3

0.284

0.147

0.484

0.601

0.198

0.465

0.361

0.126

0.406

0.697

0.570

0.214

0.295

0.109

0.647

0.691

0.642

0.423

0.655

0.792

0.642

0.423

0.655

0.792

0.641

0.374

0.768

0.689

0.015*

0.473

0.007*

0.148

V1, V2 and V3 represent the growth traits corresponding to each of the genotype in turn. Superscript (*) indicates significant differences between g.176 genotypes in 09G3SPSB (P < 0.05).

have the antimicrobial properties [54e56]. Hirakura et al. reported that the expression of human SAA1.1 in bacteria induces lysis of bacterial cells while expression of the constitutive isoform (human SAA4) does not [57]. Secondary structural analysis of the SAA isoforms indicates a strong hydrophobicity of the N-terminal of the acute phase isoform relative to the constitutive SAA4 isoform. The N-terminal portion of the acute phase isoform could have been responsible for targeting the cell membrane. In clam M. meretrix, the mutation we screened was right in the sixth amino acid which was just located in the hydrophobicity of the N-terminal of MmSAA and related to secondary systemic amyloidosis [42,52,58] and the property of targeting the cell membrane [53]. This change of the amino acid may affect the function of the protein, that is, organisms carrying the wild-type g.82 (A) might have stronger resistance than that with the mutant g.82 (G) to bacteria. The hypothesis about the SNP.82 was verified via prokaryotic expression and the effects of the two recombinant plasmids to E. coli were tested by constructing the growth curves of the corresponding cultures. Four nonsense mutations were also considered to be associated with the Vibrioresistance which might influence the gene transcription, but their possible mechanism of action need further studies. Recent studies showed that Serum amyloid A protein can regulate the expression of genes related to lipid metabolism [27], accelerate the growth of adipocytes, inhibits differentiation and promotes insulin response [28]. Therefore, SAA may also contribute to the growth traits of vertebrate animals. In this study, SNPs were detected and genotyped from 09G3SPSB population. A functional SNP (g.176) was found to be significantly associated with the four growth traits of clams. The computational prediction indicated that the SNP (g.176) was located in an intron splicing enhancer (ISE) which might function by recruiting trans-acting splicing factors that activate or suppress splice site recognition or spliceosome [59]. The SNP g.176 might affect the efficiency of transcription of MmSAA and then influence the growth of clam. In commercial settings, fast-growing animals are usually more profitable. However, several reports suggest that productivity and immune function were negatively associated in sheep, chicken and

pigs because the selection for growth is achieved at the expense of immune function [60e62]. While recent study have found that it is possible to select for enhanced immune function without a reduction of growth rate [63]. Hence, in this study, using association analysis, we developed five SNPs associated with Vibrioresistance and one SNP related to growth traits in clams, respectively. It's important to note that there's no overlap or association between the SNPs linked to Vibrio-resistance and the growth of clam. Therefore, the results may be useful for the selection of clam strains with high Vibrio-resistance and fast growth traits. However, more works need to be done before the appropriate markers actually used for marker assisted selection of this clam.

Fig. 5. Effects of expressed SAA variant sequences following IPTG induction of expression at t ¼ 0. The time “0” indicates the time adding IPTG (1 mmol/L); superscripts with different letters are significantly different from each other (P < 0.05).

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3281_proof ■ 22 January 2015 ■ 8/9

8

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9

Acknowledgments This work was financially supported by the Chinese National High-Tech R & D Program (2012AA10A410) and the Zhejiang Science and Technology Project of Agricultural Breeding (2012C12907-4).

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.01.007.

References [1] Li H, Zhu D, Gao X, Li Y, Wang J, He C. Mining single nucleotide polymorphisms from EST data of hard clam Meretrix meretrix. Conserv Genet Resour 2010;2: 69e72. [2] Tang B, Liu B, Wang G, Zhang T, Xiang J. Effects of various algal diets and starvation on larval growth and survival of Meretrix meretrix. Aquaculture 2006;254:526e33. [3] Yue X, Liu B, Xiang J, Jia J. Identification and characterization of the pathogenic effect of a Vibrio parahaemolyticus-related bacterium isolated from clam Meretrix meretrix with mass mortality. J Invertebr Pathol 2010;103:109e15. [4] Presti RL, Lisa C, Di Stasio L. Molecular genetics in aquaculture. Ital J Anim Sci 2009;8:299e314. [5] Kirpichnikov VS, Ilyasov JI, Shart LA, Vikhman AA, Ganchenko MV, Ostashevsky AL, et al. Selection of Krasnodar common carp (Cyprinus carpio L.) for resistance to dropsy: principal results and prospects. Aquaculture 1993;111:7e20. [6] Okamoto N, Tayama T, Kawanobe M, Fujiki N, Yasuda Y, Sano T. Resistance of a rainbow trout strain to infectious pancreatic necrosis. Aquaculture 1993;117: 71e6. [7] Argue BJ, Arce SM, Lotz JM, Moss SM. Selective breeding of Pacific white shrimp (Litopenaeus vannamei) for growth and resistance to Taura Syndrome Virus. Aquaculture 2002;204:447e60. [8] Nell J. Evaluation of the progeny of second-generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines for resistance to QX disease Marteilia sydneyi. Aquaculture 2003;228:27e35. [9] Henryon M, Berg P, Olesen NJ, Kjær TE, Slierendrecht WJ, Jokumsen A, et al. Selective breeding provides an approach to increase resistance of rainbow trout (Onchorhynchus mykiss) to the diseases, enteric redmouth disease, rainbow trout fry syndrome, and viral haemorrhagic septicaemia. Aquaculture 2005;250:621e36. [10] Piyasatian N, Fernando RL, Dekkers JC. Genomic selection for marker-assisted improvement in line crosses. TAG Theor Appl Genet Theoretische und angewandte Genetik 2007;115:665e74. [11] Lande R, Thompson R. Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics 1990;124:743e56. [12] Moen T, Hayes B, Nilsen F, Delghandi M, Fjalestad KT, Fevolden SE, et al. Identification and characterisation of novel SNP markers in Atlantic cod: evidence for directional selection. BMC Genet 2008;9:18. [13] Wang Y, Shu D, Li L, Qu H, Yang C, Zhu Q. Identification of single nucleotide polymorphism of H-FABP gene and its association with fatness traits in chickens. Asian-Aust J Anim Sci 2007;20. [14] Marhaug G, Hackett B, Dowton SB. Serum amyloid A gene expression in rabbit, mink and mouse. Clin Exp Immunol 1997;107:425e34. [15] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Mol Immunol 2007;44:295e301. [16] Rebl A, Goldammer T, Fischer U, Kollner B, Seyfert HM. Characterization of two key molecules of teleost innate immunity from rainbow trout (Oncorhynchus mykiss): MyD88 and SAA. Vet Immunol Immunopathol 2009;131: 122e6. [17] Caliendo V, McKinney P, Bailey T, Kinne J, Wernery U. Serum amyloid A as an indicator of health status in falcons. J Avian Med Surg 2013;27:83e9. [18] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comp Med 2009;59:517e26. [19] Ding ST, Schinckel AP, Weber TE, Mersmann HJ. Expression of porcine transcription factors and genes related to fatty acid metabolism in different tissues and genetic populations. J Anim Sci 2000;78:2127e34. [20] Hari-Dass R, Shah C, Meyer DJ, Raynes JG. Serum amyloid A protein binds to outer membrane protein A of gram-negative bacteria. J Biol Chem 2005;280: 18562e7. [21] Badolato R, Wang JM, Stornello S, Ponzi AN, Duse M, Musso T. Serum amyloid A is an activator of PMN antimicrobial functions: induction of degranulation, phagocytosis, and enhancement of anti-Candida activity. J Leukoc Biol 2000;67:381e6.

[22] Poitou C, Viguerie N, Cancello R, De Matteis R, Cinti S, Stich V, et al. Serum amyloid A: production by human white adipocyte and regulation by obesity and nutrition. Diabetologia 2005;48:519e28. [23] Jernas M, Palming J, Sjoholm K, Jennische E, Svensson PA, Gabrielsson BG, et al. Separation of human adipocytes by size: hypertrophic fat cells display distinct gene expression. FASEB J Off Publ Fed Am Soc Exp Biol 2006;20: 1540e2. [24] Poitou C, Coussieu C, Rouault C, Coupaye M, Cancello R, Bedel JF, et al. Serum amyloid A: a marker of adiposity-induced low-grade inflammation but not of metabolic status. Obesity 2006;14:309e18. [25] Yoshikawa T, Shimano H, Yahagi N, Ide T, Amemiya-Kudo M, Matsuzaka T, et al. Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c promoter activity by inhibition of liver X receptor (LXR) binding to LXR response elements. J Biol Chem 2002;277:1705e11. [26] Hsu JM, Ding ST. Effect of polyunsaturated fatty acids on the expression of transcription factor adipocyte determination and differentiation-dependent factor 1 and of lipogenic and fatty acid oxidation enzymes in porcine differentiating adipocytes. Br J Nutr 2007;90:507. [27] Faty A, Ferre P, Commans S. The acute phase protein serum amyloid a induces lipolysis and inflammation in human adipocytes through distinct pathways. PLoS One 2012;7:e34031. [28] Filippin-Monteiro FB, De Oliveira EM, Sandri S, Knebel FH, Albuquerque RC, Campa A. Serum amyloid A is a growth factor for 3T3-L1 adipocytes, inhibits differentiation and promotes insulin resistance. Int J Obes 2012;36: 1032e9. [29] Qu F, Xiang Z, Yu Z. The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: molecular cloning and functional characterization. Fish Shellfish Immunol 2014;39:145e51. [30] Yue X, Wang H, Huang X, Wang C, Chai X, Wang C, et al. Single nucleotide polymorphisms in i-type lysozyme gene and their correlation with Vibrioresistance and growth of clam Meretrix meretrix based on the selected resistance stocks. Fish Shellfish Immunol 2012;33:559e68. [31] Nie Q, Yue X, Chai X, Wang H, Liu B. Three Vibrio-resistance related EST-SSR markers revealed by selective genotyping in the clam Meretrix meretrix. Fish Shellfish Immunol 2013;35:421e8. [32] Lu X, Wang H, Liu B, Xiang J. Three EST-SSR markers associated with QTL for the growth of the clam Meretrix meretrix revealed by selective genotyping. Mar Biotechnol 2013;15:16e25. [33] Huan P, Wang H, Liu B. Transcriptomic analysis of the clam Meretrix meretrix on different larval stages. Mar Biotechnol (NY) 2012;14:69e78. [34] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. [35] Huang HY, Chien CH, Jen KH, Huang HD. RegRNA: an integrated web server for identifying regulatory RNA motifs and elements. Nucleic Acids Res 2006;34: W429e34. [36] Wang H, Chai X, Liu B. Estimation of genetic parameters for growth traits in cultured clam Meretrix meretrix (Bivalvia: Veneridae) using the Bayesian method based on Gibbs sampling. Aquac Res 2011;42:240e7. [37] Olsson N, Siegbahn A, Nilsson G. Serum amyloid A induces chemotaxis of human mast cells by activating a pertussis toxin-sensitive signal transduction pathway. Biochem Biophys Res Commun 1999;254:143e6. [38] Furlaneto CJ, Campa A. A novel function of serum amyloid A: a potent stimulus for the release of tumor necrosis factor-a, interleukin-1b, and interleukin-8 by human blood neutrophil. Biochem Biophys Res Commun 2000;268:405e8. [39] Michaeli A, Finci-Yeheskel Z, Dishon S, Linke RP, Levin M, Urieli-Shoval S. Serum amyloid A enhances plasminogen activation: implication for a role in colon cancer. Biochem Biophys Res Commun 2008;368:368e73. [40] Mullan RH, Bresnihan B, Golden-Mason L, Markham T, O'Hara R, FitzGerald O, et al. Acute-phase serum amyloid A stimulation of angiogenesis, leukocyte recruitment, and matrix degradation in rheumatoid arthritis through an NFkBedependent signal transduction pathway. Arthritis Rheum 2006;54: 105e14. [41] Urieli-Shoval S, Linke RP, Matzner Y. Expression and function of serum amyloid A, a major acute-phase protein, in normal and disease states. Curr Opin Hematol 2000;7:64e9. € m U, Westermark P. The N-terminal segment of [42] Westermark GT, Engstro protein AA determines its fibrillogenic property. Biochem Biophys Res Commun 1992;182:27e33. [43] Chan DC, Chen CJ, Chu HC, Chang WK, Yu JC, Chen YJ, et al. Evaluation of serum amyloid A as a biomarker for gastric cancer. Ann Surg Oncol 2007;14: 84e93. [44] Cocco E, Bellone S, El-Sahwi K, Cargnelutti M, Casagrande F, Buza N, et al. Serum amyloid A (SAA): a novel biomarker for uterine serous papillary cancer. Br J Cancer 2009;101:335e41. [45] Tamamoto T, Ohno K, Takahashi M, Nakashima K, Fujino Y, Tsujimoto H. Serum amyloid A as a prognostic marker in cats with various diseases. J Vet Diagn Invest 2013;25:428e32. [46] Gonzalez SF, Buchmann K, Nielsen ME. Ichthyophthirius multifiliis infection induces massive up-regulation of serum amyloid A in carp (Cyprinus carpio). Vet Immunol Immunopathol 2007;115:172e8. n JJ, Eckersall PD, Martínez-Subiela S. Acute phase proteins in dogs and [47] Cero cats: current knowledge and future perspectives. Vet Clin Pathol 2005;34: 85e99.

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

YFSIM3281_proof ■ 22 January 2015 ■ 9/9

L. Zou, B. Liu / Fish & Shellfish Immunology xxx (2015) 1e9 [48] Wei J, Guo M, Ji H, Qin Q. Molecular cloning, characterization of one key molecule of teleost innate immunity from orange-spotted grouper (Epinephelus coioides): serum amyloid A. Fish Shellfish Immunol 2013;34: 296e304. [49] Carty CL, Heagerty P, Heckbert SR, Enquobahrie DA, Jarvik GP, Davis S, et al. Association of genetic variation in serum amyloid-A with cardiovascular disease and interactions with the IL6, IL1RN, IL1b and TNF genes in the cardiovascular health study. J Atheroscler Thromb 2009;16:419. [50] Xie X, Ma YT, Yang YN, Fu ZY, Li X-M, Zheng YY, et al. Polymorphisms in the SAA1 gene are associated with ankle-to-brachial index in Han Chinese healthy subjects. Blood Press 2011;20:232e8. [51] Yamada T, Liepnieks JJ, Kluve-Beckerman B, Benson MD. Cathepsin B generates the most common form of amyloid a (76 residues) as a degradation product from serum amyloid A. Scand J Immunol 1995;41:94e7. [52] Rubin N, Perugia E, Wolf SG, Klein E, Fridkin M, Addadi L. Relation between serum amyloid A truncated peptides and their suprastructure chirality. J Am Chem Soc 2010;132:4242e8. [53] Ohta S, Tanaka M, Sakakura K, Kawakami T, Aimoto S, Saito H. Defining lipidbinding regions of human serum amyloid A using its fragment peptides. Chem Phys Lipids 2009;162:62e8. [54] Kagan BL, Jang H, Capone R, Teran Arce F, Ramachandran S, Lal R, et al. Antimicrobial properties of amyloid peptides. Mol Pharm 2011;9:708e17. [55] Soscia SJ, Kirby JE, Washicosky KJ, Tucker SM, Ingelsson M, Hyman B, et al. The Alzheimer's disease-associated amyloid b-protein is an antimicrobial peptide. PLoS One 2010;5:e9505.

9

[56] Eckhardt ER, Witta J, Zhong J, Arsenescu R, Arsenescu V, Wang Y, et al. Intestinal epithelial serum amyloid A modulates bacterial growth in vitro and pro-inflammatory responses in mouse experimental colitis. BMC Gastroenterol 2010;10:133. [57] Hirakura Y, Carreras I, Sipe JD, Kagan BL. Channel formation by serum amyloid A: a potential mechanism for amyloid pathogenesis and host defense. Amyloid 2002;9:13e23. €hne T, Sletten K, Raynes J, Roessner A, Ro €cken C. Proteolysis of AA [58] Stix B, Ka amyloid fibril proteins by matrix metalloproteinases-1,-2, and-3. Am J Pathol 2001;159:561e70. [59] Nissim-Rafinia M, Kerem B. The splicing machinery is a genetic modifier of disease severity. Trends Genet 2005;21:480e3. [60] Clapperton M, Glass EJ, Bishop SC. Pig peripheral blood mononuclear leucocyte subsets are heritable and genetically correlated with performance. Anim Int J Anim Biosci 2008;2:1575e84. [61] Greer AW. Trade-offs and benefits: implications of promoting a strong immunity to gastrointestinal parasites in sheep. Parasite Immunol 2008;30: 123e32. [62] Mauck RA, Matson KD, Philipsborn J, Ricklefs RE. Increase in the constitutive innate humoral immune system in Leach's Storm-Petrel (Oceanodroma leucorhoa) chicks is negatively correlated with growth rate. Funct Ecol 2005;19: 1001e7. [63] Van der Most PJ, De Jong B, Parmentier HK, Verhulst S. Trade-off between growth and immune function: a meta-analysis of selection experiments. Funct Ecol 2011;25:74e80.

Please cite this article in press as: Zou L, Liu B, Identification of a Serum amyloid A gene and the association of SNPs with Vibrio-resistance and growth traits in the clam Meretrix meretrix, Fish & Shellfish Immunology (2015), http://dx.doi.org/10.1016/j.fsi.2015.01.007

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42