- Email: [email protected]
Identification of a translation inhibitory element (TIE) in the 3′ untranslated region of the human interferon-β mRNA
Gene, 72 (1988) 191-200 Elsevier
191
GEN 02475
Identification of a translation inhibitory element (TIE) in the 3’ untranslated region of the human interferon-/? mRNA * (Recombinant DNA; SP6 RNA transcripts; translational efficiency; mRNA stability; inflammatory response)
VCroniqueI. Kruys,Marc G. Wathelet and GeorgesA. Huez Laboratoire de Chimie Biologique. Dkpartement de Biologic ikiolkxlaire, Universitk Libre de Bruxelles. Rhode-St-Gen&e (Belgium) Received 1 March 1988 Accepted 23 March 1988 Received by publisher 18 April 1988
SUMMARY
We have previously reported that the 3’ untranslated region (UTR) of the human interferon-b mRNA has an inhibitory effect on the mRNA translation both in vitro, in a rabbit reticulocyte lysate, and in vivo, in the Xenopus oocyte. In the present study, we identify the sequence in the 3’ UTR which is responsible for this translation inhibition. We show that this sequence is located between the 100th and 161st nucleotides downstream from the translation stop codon. It contains several repeats of the A + U-rich consensus octanucleotide UUAUUUAU, which is also present in the 3’ UTR of several mRNAs involved in the inflammatory response. We also demonstrate here that the inhibitory effect of the sequence on the mRNA translation does not depend on its position in relation to the termination codon. However, no inhibition of translation is observed when this sequence is inserted in the 5’ UTR of the mRNA. The removal of the translation inhibitory sequence not only improves the mRNA translation in Xenopus oocytes but it also strongly decreases the IFN-/‘I mRNA stability in those cells. This suggests that, in this system at least, the mRNA degradation is linked to its translational efficiency.
Post-transcriptional regulation in eukaryotic cells remains one of the less well understood aspects of
genetic expression. Modulation of an mRNA halflife and translational efficiency are two of the many putative steps of this regulation. For a given mRNA, these two parameters may be modified depending on
Correspondenceto: Dr. G.A. Huez, Laboratoire de Chimie Biologique, Departement de Biologic Moltculaire, Universite Libre de Bruxelles, 67 rue des Chevaux, B-1640 RhodeSt-Genese (Belgium) Tel.: 3223583530 Ext. 316. * Presented at the EMBO/INSERM Workshop on ‘Regulation of Gene Expression by RNA Structure and Anti-messengers’, I_es Arcs, Savoie (France) 28 February-4 March 1988.
Abbreviations: bIL-2, bovine interleukin 2; bp, base pair(s); d, deletion; GM-CSF, granulocyte macrophage colony stimulating factor; G, globin; huIFN, human interferon; i, insertion; IF, interferon; IL, interleukin; Ly, lysozyme; nt, nucleotide(s); p, plasmid; PolIk, Klenow (large) fragment of E. cofi DNA polymerase I; SDS, sodium dodecyl sulfate; so, synthetic oligodeoxynucleotide; TIE, translation inhibitory element; UTR, untranslated region; V, vector.
INTRODUCTION
0378-l 119/88/$03.50
0
1988 Elsevier
Science Publishers
B.V. (Biomedical
Division)
192
the cell life conditions. It has been shown that some structural features of mRNAs, like the Cap structure and the poly(A) sequence, have an influence on both the stability and the translation efficiency of these molecules (Marbaix et al., 1975; Huez et al., 1977; 1983; Drummond et al., 1985). Very recently, the involvement of the 5’ and 3’ UTRs in the control of expression of some mRNAs has been unveiled (Pelletier and Sonnenberg, 1985; Owen and Kuhn, 1987). However, the mechanisms by which these post-transcriptional controls are specifically mediated remain to be elucidated. We have previously reported (Kruys et al., 1987) that an in-vitro-transcribed human IFN-/I mRNA, which contains all the sequence of the natural molecule, is poorly translated in a reticulocyte lysate or when injected into Xenopus oocytes. We have also demonstrated that this phenomenon is due to a strong inhibitory effect of the 3’ UTR. Moreover, the addition of this 3’ UTR at the 3’ end of the coding region of a different mRNA (that of chicken lysozyme) also causes a large decrease in its translational capacity in both systems. Notably, no inhibition of the IFN-/I mRNA translation has been observed in a system of vegetable origin, wheat germ extract. In this work, we have identified a 62-m-long sequence in the IFN-B mRNA 3’ UTR which is responsible for the translation inhibitory effect. We also show that this element affects mRNA translation when located anywhere in the 3’ UTR, but not when situated in the 5’ UTR. Finally, we have observed that removal of this TIE, although markedly improving mRNA translation, leads to a rapid degradation of the non-polyadenylated mRNA in Xenopus oocytes.
MATERIALS
AND METHODS
(a) Construction of plasmids for synthesis of chimeric RNAs
All RNAs are synthesized from plasmids where the region to be transcribed is placed downstream from the promoter of the SP6 DNA-dependent RNA polymerase. Linearization of such plasmids with suitable restriction enzymes ensures that transcription ends at a defined site.
The constructions contain either the huIFN-/I coding region (IF) or that of chicken lysozyme (Ly), and various 5’ and 3’ UTRs. The 5’ UTR of the basic IF constructs is either a 19-bp so or the 5’ UTR ofxenopus laevis /I-globin mRNA. The 3’ UTR is either that of the natural IFN-/? mRNA (soIF and GIF) or that of X. laevis fi-globin (G) mRNA (resulting in soIFG). The 5’ UTR of the Ly constructs is composed of a synthetic and a natural part and the 3’ UTR corresponds to part of the SP6 vector (V). The constructions of these basic plasmids, psoIF, psoIFG, pGIF and pLyV, have been previously described under their former denominations: SP65IFN-/? 5’SO, SP65IFN-/I 5’S0 3’G, SP65IFN-/I 5’G and SP64LYS 3’VECT, respectively (Kruys et al., 1987). These basic plasmids have been modified to localize the inhibitory element and to determine its properties. Numbering in the 3’ UTR of the IFN-/? mRNA begins at the UGA stop codon (see Fig. 1). Constructs deleted in the IFN-fi mRNA 3 ’ UTR are noted [ dx-y ] where x and y refer to the 5’ and 3’ borders of the deletion. Constructs containing insertions in the IFN-/I 3’ UTR are noted [i(z)G] or [GV] where z refers to the point of insertion in the 3’ UTR. Constructs where the TIE is inserted in the 5’ UTR are noted [ilOO-2031, 100 and 203 determining the borders of the sequence from the IFN-/3 3’ UTR which is inserted. The psoIF[d8-1001 construct was obtained by digesting the psoIF plasmid with BglII + NdeI to remove the first 100 bp of the IFN-/I 3’ UTR. The extremities were filled in and the vector was ligated onto itself. The psoIF[i( lOO)G] plasmid was constructed by inserting the /I-globin 3’ UTR, a filled-in 194-bp BgZII-Hind111 fragment isolated from the pSP65IFN-/I5’3’G vector (Kruys et al., 1987) in the psoIF construct previously digested by NdeI and filled in. The soIF[dlOO-203/i(lOO)G] mRNA was synthesized by in vitro transcription of the psoIF[i( lOO)G] plasmid linearized by HindIII, which cleaves the plasmid just downstream from the Xenopus /I-globin mRNA 3’ UTR (see Table I). The psoIF[i(lOO)GV] plasmid was constructed by the same procedure used for the psoIF[i(lOO)G] construct except that a longer DNA fragment was inserted. This fragment corresponds to the Xenopus p-globin mRNA 3’ UTR followed by a 230-bp SP65 vector sequence and was obtained by digesting the pSP65IFN-B 5’3’G with PvuII + BgfII and filling in
193
FIGUREI: IFN-BETA MONA3’ UTR SEQUENCE,
1
U~GAUCUCCUAGCCUGUGCCUCUGGGACUGGACA
57
SU~~]~l~-~3~_I AC~GCAGAUGCUGUUUAaGUGACUGAUGGCUAAUGUACUG~UAUG~GGACAC Xl.2
113
169
56
s~IFt~~62-2~~~ _I UA~GAUUU~UUUUUAU~U~U~GUUAUUU~UAUUU~~U~UUUU 1-
168
AUUUUGG~U~~UAUUUU~GGUGC~GUC
203
Fig. 1. Htunan IFN-fl mRNA 3'mtransI&d region (Derymk et al., 1980).The sequence is numbered ffom the first nt ofthe stop C&XI. 3’ end ofthe deleted X~~~A constructs are indicated by arrowheads and short vertical lines placed beyond the last nt. The soIF[dlO@-2031 and the soIF[d162-2031 constructs are deieted from the last 103 nt and 42 nt, respectively, in the 3’ non-coding region? The sequences in horizontal brackets correspond to the A + U-rich consensus octanucleotide described by Caput et al. (1986).
The
the B&II extremity with PolIk. The psoIF[i(203~] plasmid was constructed by inserting the Xentipuf fl-globin mRNA 3’ UTR (a 194bp BgJII-HindIII fragment) in the psoIF vector digested by BumHI + Hind111 which both cleave downstream from the IFN-/?3’ UTR. ThepsoIFfi(203)GVl plasmid was obtained by the same procedure used for the psoIF[i(203~] except that the fragment inserted (a 37%bp Bgn[I-P&I fr~ent) corresponds to the /I-globin 3’ UTR followed by a 183-bp SP65 vector sequence. The p[ilOO-203lsoIFG and p[ilOO-203]LyV plasmids in which the A + U-rich sequence is placed upstream from the coding region were constructed in two steps. First, we constructed a plasmid which contains only the last 103 bp, corresponding to the IFN-/I 3’ UTR. To achieve this, we digested with NdeI -I-EcoRI the pSP65IFN-j? vector, which contains the complete sequence of the human IFN-/I cDNA inserted downstream from the SP6 polymerase promoter (Kruys et al., 1987). The vector fragment was recovered and religated onto itself to generate the pSP65IFN$[ lOO-203f construction. In the second step, we inserted either the
IFN-fl coding sequerrce Banked by the Xenopus /&lob&r mRNA 3’ UTR (a 750-bp EcoRI (filledin)-HindI fragment) or the chicken lysozymecoding sequence (a 530-bp HindIII-Hind111 fragment) in the pSP65IFN$[ loo-2031 plasmid downstream from the translation inhibitory sequence,
All the mRNAs were synthesized by in vitro &anscription of the constructions described above according to Kruys et al. (1987). Prior to transcription, the plasmids were linearized with the appropriate restriction enzymes, that is &z&II for psoff;, psoIF[dg-lOO], psoIF~i(l~)G]~ psoIF[i(i~~V], Ndef for psoIF~dI~O-2~31 and pGIF[dlOO-2031, BraI for psoIFfd161-2031 and pGIF[d161-2031, Hind111 for psoIF[dlOO-203/i(lOO)G], psoIF[i(203)G], psoIFG, p[ilOO-203]SOIFG, Sal1 for psoIF[i(ZOJ)GV], and PvuII for pLyV and p[ilOO-203]LyV.
194 TABLE I Summary of the results obtained for translation of the different IFN-B mRNA constructs in Xenopus oocytes and reticulocyte lysate mRNA”
Structure b
Oocytes c
Reticulocyte lysate’
soIF
1
1
soIF[d162-2031
8
2.5
soIF[dlOO-2031
30
8
soIF[d8-1001
0.8
1
soIF[i( lOO)G]
1.8
1.6
soIF[i(203)G]
1.7
1.1
soIF[i(lOO)GV]
1.4
1.4
soIF[i(203)GV]
1.6
1.4
soIF[dlOO-203/i(lOO)G]
* The nomenclature of the symbols is explained in MATERIALS AND METHODS, section a. b Large boxes, coding regions; small boxes, untranslated regions.-, huIFN-/?;a , vector transcript;-, translation inhibitory element;=, Xenopus /?-globin. c The experimental procedure is described in MATERIALS AND METHODS, section c. The translation efficiencies are expressed in arbitrary units, taking as reference the soIF mRNA. Values were obtained by densitometric scanning of the polyacrylamide gel autoradiographs. The units in the two different translation systems are not related.
(c) Translation assays
20% polyacrylamide gel, followed by gel autoradiography.
Rabbit reticulocyte lysate was prepared and used as described (Pelham and Jackson, 1976). The analysis of the translation products was performed on 0.1% SDS-20% polyacrylamide gels. Oocytes were injected with 50 nl of mRNA dissolved in water and adjusted to a concentration of 0.1 mg/ml. The injection procedure and the incubation of the oocytes have been described (Gurdon et al., 1971). After injection, the oocytes were incubated for 6 h at 18 ’ C in Barth’s medium (0.01 ml per oocyte) containing [35S]methionine (9&i per oocyte), 10% bovine serum albumin and 1% Trasylol. The oocytes were lysed and immunoprecipitated as described (Huez et al., 1983) with a goat anti-human IFN-/l polyclonal antibody or a rabbit anti-chicken lysozyme polyclonal antibody. For each sample, 2.5 x lo6 cpm of 35S-oocyte extract was used for immunoprecipitation. Analysis of the immunoprecipitated proteins was performed on a 0.1% SDS-
(d) Analysis of mRNA stability RNA extraction was performed as described (Marbaix et al., 1975) with some modifications (see legend to Fig. 5).
RESULTS
(a) Identification of the sequence responsible for the inhibition of translation in the IFN-p mRNA 3’ untranslated region In order to determine more precisely the sequence directly responsible for translation inhibition, we synthesized different chimeric IFN-/I mRNAs which were partially deleted in the 3’ UTR.
195
These molecules were obtained by in vitro transcription of the psoIF and pGIF plasmids (see MATERIALS AND METHODS, sections a and b digested either by Me1 or DruI. These enzymes cleave the cDNA at nt 99 and nt 161 downstream from the stop codon, respectively (see Fig. 1). The mRNAs transcribed from these plamids contain, upstream from the complete IFN+coding sequence a short so (soIF) or the 5’ UTR from the Xenopus j?-globin mRNA (GIF). We have deliberately not considered constructs with the natural IFN-/_? mRNA 5’ UTR, since according to our previous observations (Kruys et al., 1987), the presence of this sequence slightly decreases the mRNA translational capacity and may thus make the interpretation of the results more difficult. The translational efficiency of the mRNA molecules described above was compared to that of the corresponding mRNAs containing either the complete IFN-fi 3 ’ UTR or that of Xenopus globin. Fig. 2 illustrates the results of translation assays performed with the different mRNAs in the reticulocyte lysate and Xenopus oocytes. It clearly demonstrates that the removal of the 3’ lOO-203-nt sequence from the IFN-/I mRNA 3’ UTR strongly increases the translation efficiency of the mRNA in
both systems. Actually, the level of translation observed with these deleted mRNAs is similar to that of a chimeric IFN-/.I coding mRNA containing the /I-globin 3’ UTR (Fig. 2, lanes 5 and 6). It is interesting to note here that the mRNA deleted from the last 42 nt also shows a slightly better translation efficiency than the molecule containing the complete IFN-#I 3’ UTR. However, we can conclude from these results that most of the translation inhibition is mediated by the sequence located between nt 100 and 161, since the removal of this segment leads to the most important increase of the mRNA translation (compare lanes 3, 4 and 5 in Fig. 2). (b) The inhibitory effect of the ot 100-161 sequence is observed regardless of its location downstream from the mRNA coding region At this stage, it was interesting to examine whether the inhibitory effect of the nt loo-161 sequence is linked to its position in the 3’ UTR. We therefore synthesized different chimeric mRNAs harboring this sequence at different positions from the stop codon. In one construct, the sequence was located 8 nt from the stop codon by deleting the IFN-/3
Fig. 2. Translationof the partially deleted in vitro transcribed IFN-j mRNAs in comparison with that of the non-deleted molecule in the reticulocyte lysate and Xenopus oocyte (see MATERIALS AND METHODS, section c). Reticulocyte lysate: lane 1, soIF; lane 2, soIF[dlOO-2031. Oocytes: lane 3, soIF; lane 4, soIF[d162-2031; lane 5, soIF[dlOO-2031; lane 6, soIFG; lane 7, GIF; lane 8, GIF[dlOO-2031. The three bands correspond to diierent stages of IFN-1 glycosylation (see arrows, lanes 5 to 8).
196
Ml23456789 Fig. 3. Translation in oocytes of the different IFN-BmRNA constructs where the translation inhibitory sequence is displaced at different distances from the stop codon (see MATERIALS AND METHODS, section e). Lane M, protein molecular weight markers (From bottom to top: lysozyme, 14.3 kDa; carbonic anhydrase, 30 kDa; ovalbumin, 46 kDa; bovine serum~bum~, 69 kDa; and phosphoryIase b, 92.5 kDa). Lane 1, soIF[i(203)G]; lane 2, soIF[i(203)GV]; lane 3, soIF[i(lOO)G]; lane 4, soIF[i(lOO)GV)]; lane 5, soIF[dlOO-203/i(lOO)G]; lane 6, soIF[d&lOO]; lane 7, soIF; lane 8, soIF[d162-2031; lane 9, soIF[dlOO-2031. The three bands correspond to different stages of IFN-8 glycosylation (see Fig. 2).
mRNA 3’ UTR from nt 8-99 downstream from the stop codon. We have also displaced the nt loo-161 ~hibito~ sequence 194 and 378 nt from its natural position. To obtain these chimeric molecules, we have inserted either the complete Xenopus globin mRNA 3’ UTR or the same sequence followed by
a 183~m-long sequence transcribed from SP6 vector (constructs soIF[i(lOO)G] and sorF[i(lOO)GV], respectively). Fig. 3 shows that a strong ambition of translation is obtained, whatever the position of the nt 100-161 sequence from the stop codon and whatever the length of the 3’ UTR. Notably, the removal
TABLE II Translations efficiencies of the mRNA constructs cont~g in Xenopus oocytes and reticulocyte lysate
me nt 100-161 translation i~bito~
mRNA”
Oocytes’
Reticulocyte lysate”
[ilOO-203]soIF
30
8
SOIF
30
8
25
5
25
5
[ilOO-203]LyV LYV
Structure b
<
-
sequence in the 5’ untranslated region
a The nomenclature of the symbols is explained in MATERIALS AND METHODS, section a. b Large boxes, coding regions; small boxes, untranslated regions. 0, chicken lysozyme; other shading as in Table I. E The experimental procedure is described in MATERIALS AND METHODS, section e. The levels of translation are expressed in arbitrary units, as in Table I, and the units in the two translation systems are not related. The values were calculated by densitometric measurements of polyacrylamide gel autoradiographs.
197
of this sequence (in constructs so~F[d~OO-203] and so~F~dlOO-2O3~i(iOO)G]; see MATERIALS AND METHODS, sections a and b) restores the mRNA translational efficiency in all molecules. In control experiments, we have checked that the addition of the heterologous sequences of 194 and 378 nt at the end of the 3’ UTR does not modify the efficiency of trandation of the IFN-8 mRNA (constructs soIF[i(203)G] and soIF[i(203)GV]). The translational efficiencies of the different mRNAs in the reticulocyte lysate and the Xenopus oocytes are summarized in Table I.
synthesized two different chimeric mRNAs containing the nt 100-161 sequence in the 5’ UTR and coding for either IFN-fl or chicken lysozyme ([ilOO-203lsoIFG and [ilOO-203]LyV, Table II). The translational efficiency of these mRNAs was compared to the corresponding molecules without the nt 100-161 sequence (sofFG and Lyv in reticulocyte &sate and oocytes. As shown in Fig. 4 and in Table $1, the presence of the nt 100-161 sequence upstream from the start codon does not affect the translation efficiency of these two mRNAs in both systems. (d) Influenceof the at 100-161sequence on SURNA stability
Since the nt loo-161 sequence exerts its inhibitory effect independently of its position in the 3’ UTR, it was worth determining whether it could also inhibit the mRNA translation when inserted upstream from the coding region of the molecule. Therefore, we
As shown previously (Kruys et al., 1987), the poor translational efficiency of the human IFN-fi mRNA containing the complete 3’ UTR is not due to a degradation of this molecule. Even when it is not polyade~ylat~, the mRNA remains remarkably stable in Xenopus oocytes. Since
5
6,7
8
Fig. 4. Translation of the different chimeric mRNAs with the translation inhibitory element placed in the 5’ WTR of the mRNA. Reticulocyte lysate: lane I, soIFG; lane 2, [ilOO-2OJlsoIFG; lane 3, LyV; lane 4, [ilOO-203]LyV.Oocytes: lane 5, SOIFG; lane 6, [ilOO-203]soIFG, lane 7, LyV;lane 8, filOO-203jLyV.The three bands correspond to diierent stages of~FN-~~ycos~at~on (see Fig, 2).
198
the removal of this nt loo-161 sequence strongly improves mRNA translation, it was interesting to determine ifthe deletion of this sequence also affects in any way the stability of the molecule in those cells. We therefore injected into oocytes two different IFN-fi mRNAs: soIF[d162-2031, which contains the IFN-/I 3’ UTR deleted only from the last 42 nt, and soIF[ dlOO-2031 which also lacks the nt loo-161 sequence. Fig. 5 illustrates the results of a Northern blot analysis of the mRNA remaining in the oocytes at different times after injection. It can be seen that the IFN-/3 mRNA deleted only from the last 42 nt is not significantly degraded after 48 h. In contrast, the mRNA deleted from the nt loo-203 sequence disappears quite rapidly, and only 15% of the mRNA remains in the oocytes after the same period of time. Since the difference between these mRNAs is the loss of the nt loo-161 translation inhibitory sequence, we can assert that the removal of this segment not only improves mRNA translation, but also leads to greater mRNA lability.
0 4
10 24 4th
Fig. 5. Stability of the soIF[d162-2031
mRNA and the soIF[dlOO-2031
DISCUSSION
In the present work, we aimed to identify the sequence in the human IFN-/I 3’ UTR which is responsible for the low level of mRNA translation in Xenopus oocytes and reticulocyte lysate. We show that most of the translation inhibition is mediated by the segment extending from nt loo-161 in the 3’ UTR. Analysis of the translational efficiency of various synthetic chimeric messenger RNAs allows us to define this 62-m-long segment as a TIE with the following properties : (1) It acts independently of the coding region and 5’ UTR to which it is associated (it is effective on both mRNAs we tested: huIFN$ and chicken lysoxyme). (2) It acts independently of the presence or the absence of a poly(A) tail at the 3’ end of the RNA (Kruys et al., 1987). (3) Its effect on translation is not linked to its position within the 3’ UTR. Indeed, the TIE has the
0 4 10 24 mRNA in oocytes. In-vitro-transcribed
2 ng per oocyte. Total RNA was extracted from a batch of 10 oocytes after specified incubation denatured by a glyoxal dimethylsulfoxide was revealed by hybridization
@h RNA was injected at
times and 8 pg of total RNA were
treatment and separated on a 1.4% agarose gel for a Northern blot analysis. The IFN-/?mRNA
of the filter with a IFN-B antisense RNA probe corresponding
of the IFN-B gene (Zirm et al., 1983). First five lanes: soIF[d162-2031;
to the 5’ non-coding and the coding regions
last five lanes: soIF[dlOO-2031.
199
same effect when it is placed at either 8, 100,294 or 478 nt downstream from the coding region. (4) It is no longer effective when inserted into the 5’ UTR. Taken together, these properties suggest that the ~hibition of translation is not due to the fo~ation of a secondary structure between the TIE and another part of the messenger RNA, but is rather mediated by factor(s) interacting with the TIE. How this interaction in turn leads to the inhibition of translation remains to be elucidated. We observed that polyribosome formation is impaired by the presence of the TIE in the 3’ UTR (~pub~sh~ results), suggesting that it is an early step in the translation process which is affected by this element. In this regard, it is especially interesting that the TIE is ineffective when placed upstream from the coding region, a location which could result in steric hindrance by the initiating complex of the binding of the putative factor(s) onto the TIE. Notably, the TIE is rich in A and U (84%) and contains several interleaved copies of the consensus octanucleotide UUAUUUAU, which is also present in the 3’ UTR of several other mRNAs (Caput et al., 1986; Reeves et al., 1987; Cosman et al., 1987). It should be noted that one copy of the octanucleotide is also present 23 nt dossier from nt 161. As pointed out in RESULTS, the removal of the 162-203 nt segment slightly improves the translation efficiency of the mRNA. These observations raise the attractive possibility that the inhibition of translation is ultimately mediated by these A + U-rich octanucleotides and that the extent of the inhibition is related to the number of A + U-rich octarmcleotides present in the 3’ UTR of the mRNA under consideration. It has recently been shown that such A + U-rich sequences seem to be involved in the turnover of bIL-2 mRNA (Reeves et al., 1987). Moreover, the introduction of these A + U-rich sequences in stable mRNAs like those of globin or chlor~phenicol acetyltransferase markedly reduces their stability in somatic cells (Shaw and I&men, 1986; Reeves et al., 1987). On the contrary, we observed that the deletion of the TIE from the 3’ UTR of the IFN-fi mRNA decreases its stability in Xenopus oocytes. This discrepancy could merely be due to differences between the A + U-rich sequences of the GM-CSF and IL-2 mRNAs and that of the IFN-B mRNA, which could
thus be the targets of two distinct posttranscriptional control mechanisms. However, our observation could also reflect the absence from the Xenopus oocyte of the mechanism responsible for the rapid degradation of mRNAs containing A + U-rich sequences in somatic cells. Indeed, the natural IFN-@ mRNA (like those of GM-CSF and bIL-2) seems very unstable in somatic cells (Raj and Pitha, 198 1). It is possible that oocytes contain the factor(s) necessary to mediate translation inhibition but, lack those involved in labilization of the mRNA. In this respect, the oocyte system appears as a unique tool to analyze the m~h~isrn of the IFN-fi posttr~sc~ption~ regulation, making it possible to focus on the translational effect of the TIE. This translation inhibition is likely to be effective in somatic cells as well. For instance, it has been shown that butyrate treatment enhances the production of IFN by Send& virusinduced somatic cells (Shut~ewo~ et al., 1982). This higher level of IFN synthesis cannot be accounted for simply by an increase in the IFN mRNA level, demonstrating the involvement of a translational control step. It is likely that the rapid and potent labilization to which the IFN-BmRNA is subjected in induced somatic cells partially masks its translational regulation.
ACKNOWLEDGEMENTS
We thank Drs. E. De Clercq and A. Billiau for providing goat anti-huIFN-@ antiserum. This work was supported by ULB-Actions de Recherche Concert&es of the Belgian government, and Credit aux Chercheurs from the Belgian National Fund for Scientific Research to G.A.H.; M.G.W. is a research assistant of the Belgian National Fund for Scientific Research.
REFERENCES Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S. and Cerami, A.: Identification of a common nucleotide sequence in the 3’ untranslated region of mRNA molecules specifying ~~a~~ mediators. Proc. Natl. Acad. Sci. USA 83 (1986) 1670-1674.
200
Cosman, D.: Control of messenger RNA stability. Immunology Today 8 (1987) 16-17. Derynck, R., Content, J., De Clercq, E.,Volckaert, G.,Tavernier, J., Devos, R. and Fiers, W.: Isolation and structure of a human fibroblast interferon gene. Nature 285 (1980) 542-547. Drummond, D.R., Armstrong, J. and Colman, A.: The effect of capping and polyadenylation on the stability, movement and translation of synthetic messenger RNAs in Xenopus oocytes. Nucleic Acid Res. 13 (1985) 7375-7393. Gurdon, J.B., Lane, C.D., Woodland, H.R. and Marbaix, G.: Use of frog eggs and oocytes for the study of messeger RNA and its translation in living cells. Nature 233 (1971) 177-182. Huez, G., Marbaix, G., Bumy, A., Hubert, E., Leclercq, M., Cleuter, Y., Chantrenne, H., Soreq, H. and Littauer, U.Z.: Degradation of deadenylated rabbit alpha-globin mRNA in Xenopus oocytes is associated with its translation. Nature 266 (1977) 473-474. Huez, H., Bruck, C. and Cleuter, Y.: Translational stability of native and deadenylated rabbit globin mRNA injected into HeLa cells. Proc. Natl. Acad. Sci. USA 78 (1981) 908-911. Huez, G., Cleuter, Y., Bruck, C., Van-Vloting, L., Goldbach, R. and Verduin, B.: Translational stability of plant viral RNAs microinjected into living cells, influence of a 3’-poly(A) segment. Eur. J. Biochem. 130 (1983) 205-209. Kruys, V., Wathelet, M., Poupart, P., Contreras, R., Fiers, W., Content, J. and Huez, G.: The 3’ untranslated region of the human interferon+ mRNA has an inhibitory effect on translation. Proc. Natl. Acad. Sci. USA 84 (1987) 6030-6034. Marbaix, G., Huez, G., Bumy, A., Cleuter, Y., Hubert, E., Leclercq, M., Chantrenne, H., Soreq, H., Nudel, U. and Littauer, U.Z.: Absence of polyadenylate segment in globin messenger RNA accelerates its degradation in Xenopus oocytes. Proc. Natl. Acad. Sci. USA 72 (1975) 3065-3067.
Meijlink, F., Curran, T., Dusty-Miller, A. and Verma, I.: Removal of a 67-base-pair sequence in the non-coding region of protooncogene fos converts it to a transforming gene. Proc. Natl. Acad. Sci. USA 82 (1985) 4987-4991. Mosca, J.D. and Pitha, P.M.: Transcriptional and posttranscriptional regulation of exogenous human b-interferon gene in simian cells defective in interferon synthesis. Mol. Cell. Biol. 6 (1986) 2279-2283. Owen, D. and Kuhn, L.C.: Noncoding 3’ sequences of the transferrin receptor gene are required for mRNA regulation by iron. EMBO J. 6 (1987) 1287-1293. Pelletier, J. and Sonenberg, N.: Insertion mutagenesis to increase secondary structure within the 5’ noncodiig region of a eukaryotic mRNA reduces translational efficiency. Cell 40 (1985) 515-526. Raj, N.B.K. and Pitha, P.M.: Analysis of interferon mRNA in human fibroblast cells induced to produce interferon. Proc. Natl. Acad. Sci. USA 78 (1981) 7426-7430. Reeves, R., Elton, T.S., Nissen, M.S., Lehn, D. and Johnson, K.R.: Posttranscriptional gene regulation and specific binding of the non-histone protein HMG-I by the 3’ untranslated region of bovine interleukin-2 cDNA. Proc. Natl. Acad. Sci. USA 84 (1987) 6531-6535. Shaw, G., Kamen, R.: A conserved AU sequence from the 3’ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46 (1986) 659-667. Shuttleworth, J., Morser, J. and Burke, DC.: Control of interferon mRNA levels and interferon yields in butyrate and 5’ bromodeoxyuridine-treated Namalwa cells. J. Gen. Virol. 58 (1982) 25-35. Zinn, K., DiMaio, D. and Maniatis, T.: Identification of two distinct regulatory regions adjacent to the human fl-interferon gene. Cell 34 (1983) 865-879. Edited by H.M. Krisch.
191
GEN 02475
Identification of a translation inhibitory element (TIE) in the 3’ untranslated region of the human interferon-/? mRNA * (Recombinant DNA; SP6 RNA transcripts; translational efficiency; mRNA stability; inflammatory response)
VCroniqueI. Kruys,Marc G. Wathelet and GeorgesA. Huez Laboratoire de Chimie Biologique. Dkpartement de Biologic ikiolkxlaire, Universitk Libre de Bruxelles. Rhode-St-Gen&e (Belgium) Received 1 March 1988 Accepted 23 March 1988 Received by publisher 18 April 1988
SUMMARY
We have previously reported that the 3’ untranslated region (UTR) of the human interferon-b mRNA has an inhibitory effect on the mRNA translation both in vitro, in a rabbit reticulocyte lysate, and in vivo, in the Xenopus oocyte. In the present study, we identify the sequence in the 3’ UTR which is responsible for this translation inhibition. We show that this sequence is located between the 100th and 161st nucleotides downstream from the translation stop codon. It contains several repeats of the A + U-rich consensus octanucleotide UUAUUUAU, which is also present in the 3’ UTR of several mRNAs involved in the inflammatory response. We also demonstrate here that the inhibitory effect of the sequence on the mRNA translation does not depend on its position in relation to the termination codon. However, no inhibition of translation is observed when this sequence is inserted in the 5’ UTR of the mRNA. The removal of the translation inhibitory sequence not only improves the mRNA translation in Xenopus oocytes but it also strongly decreases the IFN-/‘I mRNA stability in those cells. This suggests that, in this system at least, the mRNA degradation is linked to its translational efficiency.
Post-transcriptional regulation in eukaryotic cells remains one of the less well understood aspects of
genetic expression. Modulation of an mRNA halflife and translational efficiency are two of the many putative steps of this regulation. For a given mRNA, these two parameters may be modified depending on
Correspondenceto: Dr. G.A. Huez, Laboratoire de Chimie Biologique, Departement de Biologic Moltculaire, Universite Libre de Bruxelles, 67 rue des Chevaux, B-1640 RhodeSt-Genese (Belgium) Tel.: 3223583530 Ext. 316. * Presented at the EMBO/INSERM Workshop on ‘Regulation of Gene Expression by RNA Structure and Anti-messengers’, I_es Arcs, Savoie (France) 28 February-4 March 1988.
Abbreviations: bIL-2, bovine interleukin 2; bp, base pair(s); d, deletion; GM-CSF, granulocyte macrophage colony stimulating factor; G, globin; huIFN, human interferon; i, insertion; IF, interferon; IL, interleukin; Ly, lysozyme; nt, nucleotide(s); p, plasmid; PolIk, Klenow (large) fragment of E. cofi DNA polymerase I; SDS, sodium dodecyl sulfate; so, synthetic oligodeoxynucleotide; TIE, translation inhibitory element; UTR, untranslated region; V, vector.
INTRODUCTION
0378-l 119/88/$03.50
0
1988 Elsevier
Science Publishers
B.V. (Biomedical
Division)
192
the cell life conditions. It has been shown that some structural features of mRNAs, like the Cap structure and the poly(A) sequence, have an influence on both the stability and the translation efficiency of these molecules (Marbaix et al., 1975; Huez et al., 1977; 1983; Drummond et al., 1985). Very recently, the involvement of the 5’ and 3’ UTRs in the control of expression of some mRNAs has been unveiled (Pelletier and Sonnenberg, 1985; Owen and Kuhn, 1987). However, the mechanisms by which these post-transcriptional controls are specifically mediated remain to be elucidated. We have previously reported (Kruys et al., 1987) that an in-vitro-transcribed human IFN-/I mRNA, which contains all the sequence of the natural molecule, is poorly translated in a reticulocyte lysate or when injected into Xenopus oocytes. We have also demonstrated that this phenomenon is due to a strong inhibitory effect of the 3’ UTR. Moreover, the addition of this 3’ UTR at the 3’ end of the coding region of a different mRNA (that of chicken lysozyme) also causes a large decrease in its translational capacity in both systems. Notably, no inhibition of the IFN-/I mRNA translation has been observed in a system of vegetable origin, wheat germ extract. In this work, we have identified a 62-m-long sequence in the IFN-B mRNA 3’ UTR which is responsible for the translation inhibitory effect. We also show that this element affects mRNA translation when located anywhere in the 3’ UTR, but not when situated in the 5’ UTR. Finally, we have observed that removal of this TIE, although markedly improving mRNA translation, leads to a rapid degradation of the non-polyadenylated mRNA in Xenopus oocytes.
MATERIALS
AND METHODS
(a) Construction of plasmids for synthesis of chimeric RNAs
All RNAs are synthesized from plasmids where the region to be transcribed is placed downstream from the promoter of the SP6 DNA-dependent RNA polymerase. Linearization of such plasmids with suitable restriction enzymes ensures that transcription ends at a defined site.
The constructions contain either the huIFN-/I coding region (IF) or that of chicken lysozyme (Ly), and various 5’ and 3’ UTRs. The 5’ UTR of the basic IF constructs is either a 19-bp so or the 5’ UTR ofxenopus laevis /I-globin mRNA. The 3’ UTR is either that of the natural IFN-/? mRNA (soIF and GIF) or that of X. laevis fi-globin (G) mRNA (resulting in soIFG). The 5’ UTR of the Ly constructs is composed of a synthetic and a natural part and the 3’ UTR corresponds to part of the SP6 vector (V). The constructions of these basic plasmids, psoIF, psoIFG, pGIF and pLyV, have been previously described under their former denominations: SP65IFN-/? 5’SO, SP65IFN-/I 5’S0 3’G, SP65IFN-/I 5’G and SP64LYS 3’VECT, respectively (Kruys et al., 1987). These basic plasmids have been modified to localize the inhibitory element and to determine its properties. Numbering in the 3’ UTR of the IFN-/? mRNA begins at the UGA stop codon (see Fig. 1). Constructs deleted in the IFN-fi mRNA 3 ’ UTR are noted [ dx-y ] where x and y refer to the 5’ and 3’ borders of the deletion. Constructs containing insertions in the IFN-/I 3’ UTR are noted [i(z)G] or [GV] where z refers to the point of insertion in the 3’ UTR. Constructs where the TIE is inserted in the 5’ UTR are noted [ilOO-2031, 100 and 203 determining the borders of the sequence from the IFN-/3 3’ UTR which is inserted. The psoIF[d8-1001 construct was obtained by digesting the psoIF plasmid with BglII + NdeI to remove the first 100 bp of the IFN-/I 3’ UTR. The extremities were filled in and the vector was ligated onto itself. The psoIF[i( lOO)G] plasmid was constructed by inserting the /I-globin 3’ UTR, a filled-in 194-bp BgZII-Hind111 fragment isolated from the pSP65IFN-/I5’3’G vector (Kruys et al., 1987) in the psoIF construct previously digested by NdeI and filled in. The soIF[dlOO-203/i(lOO)G] mRNA was synthesized by in vitro transcription of the psoIF[i( lOO)G] plasmid linearized by HindIII, which cleaves the plasmid just downstream from the Xenopus /I-globin mRNA 3’ UTR (see Table I). The psoIF[i(lOO)GV] plasmid was constructed by the same procedure used for the psoIF[i(lOO)G] construct except that a longer DNA fragment was inserted. This fragment corresponds to the Xenopus p-globin mRNA 3’ UTR followed by a 230-bp SP65 vector sequence and was obtained by digesting the pSP65IFN-B 5’3’G with PvuII + BgfII and filling in
193
FIGUREI: IFN-BETA MONA3’ UTR SEQUENCE,
1
U~GAUCUCCUAGCCUGUGCCUCUGGGACUGGACA
57
SU~~]~l~-~3~_I AC~GCAGAUGCUGUUUAaGUGACUGAUGGCUAAUGUACUG~UAUG~GGACAC Xl.2
113
169
56
s~IFt~~62-2~~~ _I UA~GAUUU~UUUUUAU~U~U~GUUAUUU~UAUUU~~U~UUUU 1-
168
AUUUUGG~U~~UAUUUU~GGUGC~GUC
203
Fig. 1. Htunan IFN-fl mRNA 3'mtransI&d region (Derymk et al., 1980).The sequence is numbered ffom the first nt ofthe stop C&XI. 3’ end ofthe deleted X~~~A constructs are indicated by arrowheads and short vertical lines placed beyond the last nt. The soIF[dlO@-2031 and the soIF[d162-2031 constructs are deieted from the last 103 nt and 42 nt, respectively, in the 3’ non-coding region? The sequences in horizontal brackets correspond to the A + U-rich consensus octanucleotide described by Caput et al. (1986).
The
the B&II extremity with PolIk. The psoIF[i(203~] plasmid was constructed by inserting the Xentipuf fl-globin mRNA 3’ UTR (a 194bp BgJII-HindIII fragment) in the psoIF vector digested by BumHI + Hind111 which both cleave downstream from the IFN-/?3’ UTR. ThepsoIFfi(203)GVl plasmid was obtained by the same procedure used for the psoIF[i(203~] except that the fragment inserted (a 37%bp Bgn[I-P&I fr~ent) corresponds to the /I-globin 3’ UTR followed by a 183-bp SP65 vector sequence. The p[ilOO-203lsoIFG and p[ilOO-203]LyV plasmids in which the A + U-rich sequence is placed upstream from the coding region were constructed in two steps. First, we constructed a plasmid which contains only the last 103 bp, corresponding to the IFN-/I 3’ UTR. To achieve this, we digested with NdeI -I-EcoRI the pSP65IFN-j? vector, which contains the complete sequence of the human IFN-/I cDNA inserted downstream from the SP6 polymerase promoter (Kruys et al., 1987). The vector fragment was recovered and religated onto itself to generate the pSP65IFN$[ lOO-203f construction. In the second step, we inserted either the
IFN-fl coding sequerrce Banked by the Xenopus /&lob&r mRNA 3’ UTR (a 750-bp EcoRI (filledin)-HindI fragment) or the chicken lysozymecoding sequence (a 530-bp HindIII-Hind111 fragment) in the pSP65IFN$[ loo-2031 plasmid downstream from the translation inhibitory sequence,
All the mRNAs were synthesized by in vitro &anscription of the constructions described above according to Kruys et al. (1987). Prior to transcription, the plasmids were linearized with the appropriate restriction enzymes, that is &z&II for psoff;, psoIF[dg-lOO], psoIF~i(l~)G]~ psoIF[i(i~~V], Ndef for psoIF~dI~O-2~31 and pGIF[dlOO-2031, BraI for psoIFfd161-2031 and pGIF[d161-2031, Hind111 for psoIF[dlOO-203/i(lOO)G], psoIF[i(203)G], psoIFG, p[ilOO-203]SOIFG, Sal1 for psoIF[i(ZOJ)GV], and PvuII for pLyV and p[ilOO-203]LyV.
194 TABLE I Summary of the results obtained for translation of the different IFN-B mRNA constructs in Xenopus oocytes and reticulocyte lysate mRNA”
Structure b
Oocytes c
Reticulocyte lysate’
soIF
1
1
soIF[d162-2031
8
2.5
soIF[dlOO-2031
30
8
soIF[d8-1001
0.8
1
soIF[i( lOO)G]
1.8
1.6
soIF[i(203)G]
1.7
1.1
soIF[i(lOO)GV]
1.4
1.4
soIF[i(203)GV]
1.6
1.4
soIF[dlOO-203/i(lOO)G]
* The nomenclature of the symbols is explained in MATERIALS AND METHODS, section a. b Large boxes, coding regions; small boxes, untranslated regions.-, huIFN-/?;a , vector transcript;-, translation inhibitory element;=, Xenopus /?-globin. c The experimental procedure is described in MATERIALS AND METHODS, section c. The translation efficiencies are expressed in arbitrary units, taking as reference the soIF mRNA. Values were obtained by densitometric scanning of the polyacrylamide gel autoradiographs. The units in the two different translation systems are not related.
(c) Translation assays
20% polyacrylamide gel, followed by gel autoradiography.
Rabbit reticulocyte lysate was prepared and used as described (Pelham and Jackson, 1976). The analysis of the translation products was performed on 0.1% SDS-20% polyacrylamide gels. Oocytes were injected with 50 nl of mRNA dissolved in water and adjusted to a concentration of 0.1 mg/ml. The injection procedure and the incubation of the oocytes have been described (Gurdon et al., 1971). After injection, the oocytes were incubated for 6 h at 18 ’ C in Barth’s medium (0.01 ml per oocyte) containing [35S]methionine (9&i per oocyte), 10% bovine serum albumin and 1% Trasylol. The oocytes were lysed and immunoprecipitated as described (Huez et al., 1983) with a goat anti-human IFN-/l polyclonal antibody or a rabbit anti-chicken lysozyme polyclonal antibody. For each sample, 2.5 x lo6 cpm of 35S-oocyte extract was used for immunoprecipitation. Analysis of the immunoprecipitated proteins was performed on a 0.1% SDS-
(d) Analysis of mRNA stability RNA extraction was performed as described (Marbaix et al., 1975) with some modifications (see legend to Fig. 5).
RESULTS
(a) Identification of the sequence responsible for the inhibition of translation in the IFN-p mRNA 3’ untranslated region In order to determine more precisely the sequence directly responsible for translation inhibition, we synthesized different chimeric IFN-/I mRNAs which were partially deleted in the 3’ UTR.
195
These molecules were obtained by in vitro transcription of the psoIF and pGIF plasmids (see MATERIALS AND METHODS, sections a and b digested either by Me1 or DruI. These enzymes cleave the cDNA at nt 99 and nt 161 downstream from the stop codon, respectively (see Fig. 1). The mRNAs transcribed from these plamids contain, upstream from the complete IFN+coding sequence a short so (soIF) or the 5’ UTR from the Xenopus j?-globin mRNA (GIF). We have deliberately not considered constructs with the natural IFN-/_? mRNA 5’ UTR, since according to our previous observations (Kruys et al., 1987), the presence of this sequence slightly decreases the mRNA translational capacity and may thus make the interpretation of the results more difficult. The translational efficiency of the mRNA molecules described above was compared to that of the corresponding mRNAs containing either the complete IFN-fi 3 ’ UTR or that of Xenopus globin. Fig. 2 illustrates the results of translation assays performed with the different mRNAs in the reticulocyte lysate and Xenopus oocytes. It clearly demonstrates that the removal of the 3’ lOO-203-nt sequence from the IFN-/I mRNA 3’ UTR strongly increases the translation efficiency of the mRNA in
both systems. Actually, the level of translation observed with these deleted mRNAs is similar to that of a chimeric IFN-/.I coding mRNA containing the /I-globin 3’ UTR (Fig. 2, lanes 5 and 6). It is interesting to note here that the mRNA deleted from the last 42 nt also shows a slightly better translation efficiency than the molecule containing the complete IFN-#I 3’ UTR. However, we can conclude from these results that most of the translation inhibition is mediated by the sequence located between nt 100 and 161, since the removal of this segment leads to the most important increase of the mRNA translation (compare lanes 3, 4 and 5 in Fig. 2). (b) The inhibitory effect of the ot 100-161 sequence is observed regardless of its location downstream from the mRNA coding region At this stage, it was interesting to examine whether the inhibitory effect of the nt loo-161 sequence is linked to its position in the 3’ UTR. We therefore synthesized different chimeric mRNAs harboring this sequence at different positions from the stop codon. In one construct, the sequence was located 8 nt from the stop codon by deleting the IFN-/3
Fig. 2. Translationof the partially deleted in vitro transcribed IFN-j mRNAs in comparison with that of the non-deleted molecule in the reticulocyte lysate and Xenopus oocyte (see MATERIALS AND METHODS, section c). Reticulocyte lysate: lane 1, soIF; lane 2, soIF[dlOO-2031. Oocytes: lane 3, soIF; lane 4, soIF[d162-2031; lane 5, soIF[dlOO-2031; lane 6, soIFG; lane 7, GIF; lane 8, GIF[dlOO-2031. The three bands correspond to diierent stages of IFN-1 glycosylation (see arrows, lanes 5 to 8).
196
Ml23456789 Fig. 3. Translation in oocytes of the different IFN-BmRNA constructs where the translation inhibitory sequence is displaced at different distances from the stop codon (see MATERIALS AND METHODS, section e). Lane M, protein molecular weight markers (From bottom to top: lysozyme, 14.3 kDa; carbonic anhydrase, 30 kDa; ovalbumin, 46 kDa; bovine serum~bum~, 69 kDa; and phosphoryIase b, 92.5 kDa). Lane 1, soIF[i(203)G]; lane 2, soIF[i(203)GV]; lane 3, soIF[i(lOO)G]; lane 4, soIF[i(lOO)GV)]; lane 5, soIF[dlOO-203/i(lOO)G]; lane 6, soIF[d&lOO]; lane 7, soIF; lane 8, soIF[d162-2031; lane 9, soIF[dlOO-2031. The three bands correspond to different stages of IFN-8 glycosylation (see Fig. 2).
mRNA 3’ UTR from nt 8-99 downstream from the stop codon. We have also displaced the nt loo-161 ~hibito~ sequence 194 and 378 nt from its natural position. To obtain these chimeric molecules, we have inserted either the complete Xenopus globin mRNA 3’ UTR or the same sequence followed by
a 183~m-long sequence transcribed from SP6 vector (constructs soIF[i(lOO)G] and sorF[i(lOO)GV], respectively). Fig. 3 shows that a strong ambition of translation is obtained, whatever the position of the nt 100-161 sequence from the stop codon and whatever the length of the 3’ UTR. Notably, the removal
TABLE II Translations efficiencies of the mRNA constructs cont~g in Xenopus oocytes and reticulocyte lysate
me nt 100-161 translation i~bito~
mRNA”
Oocytes’
Reticulocyte lysate”
[ilOO-203]soIF
30
8
SOIF
30
8
25
5
25
5
[ilOO-203]LyV LYV
Structure b
<
-
sequence in the 5’ untranslated region
a The nomenclature of the symbols is explained in MATERIALS AND METHODS, section a. b Large boxes, coding regions; small boxes, untranslated regions. 0, chicken lysozyme; other shading as in Table I. E The experimental procedure is described in MATERIALS AND METHODS, section e. The levels of translation are expressed in arbitrary units, as in Table I, and the units in the two translation systems are not related. The values were calculated by densitometric measurements of polyacrylamide gel autoradiographs.
197
of this sequence (in constructs so~F[d~OO-203] and so~F~dlOO-2O3~i(iOO)G]; see MATERIALS AND METHODS, sections a and b) restores the mRNA translational efficiency in all molecules. In control experiments, we have checked that the addition of the heterologous sequences of 194 and 378 nt at the end of the 3’ UTR does not modify the efficiency of trandation of the IFN-8 mRNA (constructs soIF[i(203)G] and soIF[i(203)GV]). The translational efficiencies of the different mRNAs in the reticulocyte lysate and the Xenopus oocytes are summarized in Table I.
synthesized two different chimeric mRNAs containing the nt 100-161 sequence in the 5’ UTR and coding for either IFN-fl or chicken lysozyme ([ilOO-203lsoIFG and [ilOO-203]LyV, Table II). The translational efficiency of these mRNAs was compared to the corresponding molecules without the nt 100-161 sequence (sofFG and Lyv in reticulocyte &sate and oocytes. As shown in Fig. 4 and in Table $1, the presence of the nt 100-161 sequence upstream from the start codon does not affect the translation efficiency of these two mRNAs in both systems. (d) Influenceof the at 100-161sequence on SURNA stability
Since the nt loo-161 sequence exerts its inhibitory effect independently of its position in the 3’ UTR, it was worth determining whether it could also inhibit the mRNA translation when inserted upstream from the coding region of the molecule. Therefore, we
As shown previously (Kruys et al., 1987), the poor translational efficiency of the human IFN-fi mRNA containing the complete 3’ UTR is not due to a degradation of this molecule. Even when it is not polyade~ylat~, the mRNA remains remarkably stable in Xenopus oocytes. Since
5
6,7
8
Fig. 4. Translation of the different chimeric mRNAs with the translation inhibitory element placed in the 5’ WTR of the mRNA. Reticulocyte lysate: lane I, soIFG; lane 2, [ilOO-2OJlsoIFG; lane 3, LyV; lane 4, [ilOO-203]LyV.Oocytes: lane 5, SOIFG; lane 6, [ilOO-203]soIFG, lane 7, LyV;lane 8, filOO-203jLyV.The three bands correspond to diierent stages of~FN-~~ycos~at~on (see Fig, 2).
198
the removal of this nt loo-161 sequence strongly improves mRNA translation, it was interesting to determine ifthe deletion of this sequence also affects in any way the stability of the molecule in those cells. We therefore injected into oocytes two different IFN-fi mRNAs: soIF[d162-2031, which contains the IFN-/I 3’ UTR deleted only from the last 42 nt, and soIF[ dlOO-2031 which also lacks the nt loo-161 sequence. Fig. 5 illustrates the results of a Northern blot analysis of the mRNA remaining in the oocytes at different times after injection. It can be seen that the IFN-/3 mRNA deleted only from the last 42 nt is not significantly degraded after 48 h. In contrast, the mRNA deleted from the nt loo-203 sequence disappears quite rapidly, and only 15% of the mRNA remains in the oocytes after the same period of time. Since the difference between these mRNAs is the loss of the nt loo-161 translation inhibitory sequence, we can assert that the removal of this segment not only improves mRNA translation, but also leads to greater mRNA lability.
0 4
10 24 4th
Fig. 5. Stability of the soIF[d162-2031
mRNA and the soIF[dlOO-2031
DISCUSSION
In the present work, we aimed to identify the sequence in the human IFN-/I 3’ UTR which is responsible for the low level of mRNA translation in Xenopus oocytes and reticulocyte lysate. We show that most of the translation inhibition is mediated by the segment extending from nt loo-161 in the 3’ UTR. Analysis of the translational efficiency of various synthetic chimeric messenger RNAs allows us to define this 62-m-long segment as a TIE with the following properties : (1) It acts independently of the coding region and 5’ UTR to which it is associated (it is effective on both mRNAs we tested: huIFN$ and chicken lysoxyme). (2) It acts independently of the presence or the absence of a poly(A) tail at the 3’ end of the RNA (Kruys et al., 1987). (3) Its effect on translation is not linked to its position within the 3’ UTR. Indeed, the TIE has the
0 4 10 24 mRNA in oocytes. In-vitro-transcribed
2 ng per oocyte. Total RNA was extracted from a batch of 10 oocytes after specified incubation denatured by a glyoxal dimethylsulfoxide was revealed by hybridization
@h RNA was injected at
times and 8 pg of total RNA were
treatment and separated on a 1.4% agarose gel for a Northern blot analysis. The IFN-/?mRNA
of the filter with a IFN-B antisense RNA probe corresponding
of the IFN-B gene (Zirm et al., 1983). First five lanes: soIF[d162-2031;
to the 5’ non-coding and the coding regions
last five lanes: soIF[dlOO-2031.
199
same effect when it is placed at either 8, 100,294 or 478 nt downstream from the coding region. (4) It is no longer effective when inserted into the 5’ UTR. Taken together, these properties suggest that the ~hibition of translation is not due to the fo~ation of a secondary structure between the TIE and another part of the messenger RNA, but is rather mediated by factor(s) interacting with the TIE. How this interaction in turn leads to the inhibition of translation remains to be elucidated. We observed that polyribosome formation is impaired by the presence of the TIE in the 3’ UTR (~pub~sh~ results), suggesting that it is an early step in the translation process which is affected by this element. In this regard, it is especially interesting that the TIE is ineffective when placed upstream from the coding region, a location which could result in steric hindrance by the initiating complex of the binding of the putative factor(s) onto the TIE. Notably, the TIE is rich in A and U (84%) and contains several interleaved copies of the consensus octanucleotide UUAUUUAU, which is also present in the 3’ UTR of several other mRNAs (Caput et al., 1986; Reeves et al., 1987; Cosman et al., 1987). It should be noted that one copy of the octanucleotide is also present 23 nt dossier from nt 161. As pointed out in RESULTS, the removal of the 162-203 nt segment slightly improves the translation efficiency of the mRNA. These observations raise the attractive possibility that the inhibition of translation is ultimately mediated by these A + U-rich octanucleotides and that the extent of the inhibition is related to the number of A + U-rich octarmcleotides present in the 3’ UTR of the mRNA under consideration. It has recently been shown that such A + U-rich sequences seem to be involved in the turnover of bIL-2 mRNA (Reeves et al., 1987). Moreover, the introduction of these A + U-rich sequences in stable mRNAs like those of globin or chlor~phenicol acetyltransferase markedly reduces their stability in somatic cells (Shaw and I&men, 1986; Reeves et al., 1987). On the contrary, we observed that the deletion of the TIE from the 3’ UTR of the IFN-fi mRNA decreases its stability in Xenopus oocytes. This discrepancy could merely be due to differences between the A + U-rich sequences of the GM-CSF and IL-2 mRNAs and that of the IFN-B mRNA, which could
thus be the targets of two distinct posttranscriptional control mechanisms. However, our observation could also reflect the absence from the Xenopus oocyte of the mechanism responsible for the rapid degradation of mRNAs containing A + U-rich sequences in somatic cells. Indeed, the natural IFN-@ mRNA (like those of GM-CSF and bIL-2) seems very unstable in somatic cells (Raj and Pitha, 198 1). It is possible that oocytes contain the factor(s) necessary to mediate translation inhibition but, lack those involved in labilization of the mRNA. In this respect, the oocyte system appears as a unique tool to analyze the m~h~isrn of the IFN-fi posttr~sc~ption~ regulation, making it possible to focus on the translational effect of the TIE. This translation inhibition is likely to be effective in somatic cells as well. For instance, it has been shown that butyrate treatment enhances the production of IFN by Send& virusinduced somatic cells (Shut~ewo~ et al., 1982). This higher level of IFN synthesis cannot be accounted for simply by an increase in the IFN mRNA level, demonstrating the involvement of a translational control step. It is likely that the rapid and potent labilization to which the IFN-BmRNA is subjected in induced somatic cells partially masks its translational regulation.
ACKNOWLEDGEMENTS
We thank Drs. E. De Clercq and A. Billiau for providing goat anti-huIFN-@ antiserum. This work was supported by ULB-Actions de Recherche Concert&es of the Belgian government, and Credit aux Chercheurs from the Belgian National Fund for Scientific Research to G.A.H.; M.G.W. is a research assistant of the Belgian National Fund for Scientific Research.
REFERENCES Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S. and Cerami, A.: Identification of a common nucleotide sequence in the 3’ untranslated region of mRNA molecules specifying ~~a~~ mediators. Proc. Natl. Acad. Sci. USA 83 (1986) 1670-1674.
200
Cosman, D.: Control of messenger RNA stability. Immunology Today 8 (1987) 16-17. Derynck, R., Content, J., De Clercq, E.,Volckaert, G.,Tavernier, J., Devos, R. and Fiers, W.: Isolation and structure of a human fibroblast interferon gene. Nature 285 (1980) 542-547. Drummond, D.R., Armstrong, J. and Colman, A.: The effect of capping and polyadenylation on the stability, movement and translation of synthetic messenger RNAs in Xenopus oocytes. Nucleic Acid Res. 13 (1985) 7375-7393. Gurdon, J.B., Lane, C.D., Woodland, H.R. and Marbaix, G.: Use of frog eggs and oocytes for the study of messeger RNA and its translation in living cells. Nature 233 (1971) 177-182. Huez, G., Marbaix, G., Bumy, A., Hubert, E., Leclercq, M., Cleuter, Y., Chantrenne, H., Soreq, H. and Littauer, U.Z.: Degradation of deadenylated rabbit alpha-globin mRNA in Xenopus oocytes is associated with its translation. Nature 266 (1977) 473-474. Huez, H., Bruck, C. and Cleuter, Y.: Translational stability of native and deadenylated rabbit globin mRNA injected into HeLa cells. Proc. Natl. Acad. Sci. USA 78 (1981) 908-911. Huez, G., Cleuter, Y., Bruck, C., Van-Vloting, L., Goldbach, R. and Verduin, B.: Translational stability of plant viral RNAs microinjected into living cells, influence of a 3’-poly(A) segment. Eur. J. Biochem. 130 (1983) 205-209. Kruys, V., Wathelet, M., Poupart, P., Contreras, R., Fiers, W., Content, J. and Huez, G.: The 3’ untranslated region of the human interferon+ mRNA has an inhibitory effect on translation. Proc. Natl. Acad. Sci. USA 84 (1987) 6030-6034. Marbaix, G., Huez, G., Bumy, A., Cleuter, Y., Hubert, E., Leclercq, M., Chantrenne, H., Soreq, H., Nudel, U. and Littauer, U.Z.: Absence of polyadenylate segment in globin messenger RNA accelerates its degradation in Xenopus oocytes. Proc. Natl. Acad. Sci. USA 72 (1975) 3065-3067.
Meijlink, F., Curran, T., Dusty-Miller, A. and Verma, I.: Removal of a 67-base-pair sequence in the non-coding region of protooncogene fos converts it to a transforming gene. Proc. Natl. Acad. Sci. USA 82 (1985) 4987-4991. Mosca, J.D. and Pitha, P.M.: Transcriptional and posttranscriptional regulation of exogenous human b-interferon gene in simian cells defective in interferon synthesis. Mol. Cell. Biol. 6 (1986) 2279-2283. Owen, D. and Kuhn, L.C.: Noncoding 3’ sequences of the transferrin receptor gene are required for mRNA regulation by iron. EMBO J. 6 (1987) 1287-1293. Pelletier, J. and Sonenberg, N.: Insertion mutagenesis to increase secondary structure within the 5’ noncodiig region of a eukaryotic mRNA reduces translational efficiency. Cell 40 (1985) 515-526. Raj, N.B.K. and Pitha, P.M.: Analysis of interferon mRNA in human fibroblast cells induced to produce interferon. Proc. Natl. Acad. Sci. USA 78 (1981) 7426-7430. Reeves, R., Elton, T.S., Nissen, M.S., Lehn, D. and Johnson, K.R.: Posttranscriptional gene regulation and specific binding of the non-histone protein HMG-I by the 3’ untranslated region of bovine interleukin-2 cDNA. Proc. Natl. Acad. Sci. USA 84 (1987) 6531-6535. Shaw, G., Kamen, R.: A conserved AU sequence from the 3’ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46 (1986) 659-667. Shuttleworth, J., Morser, J. and Burke, DC.: Control of interferon mRNA levels and interferon yields in butyrate and 5’ bromodeoxyuridine-treated Namalwa cells. J. Gen. Virol. 58 (1982) 25-35. Zinn, K., DiMaio, D. and Maniatis, T.: Identification of two distinct regulatory regions adjacent to the human fl-interferon gene. Cell 34 (1983) 865-879. Edited by H.M. Krisch.