- Email: [email protected]
Identification of a tyrosinase gene and its functional analysis in melanin synthesis of Pteria penguin
Gene 656 (2018) 1–8
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Identification of a tyrosinase gene and its functional analysis in melanin synthesis of Pteria penguin
T
⁎
Feifei Yua, Zhenni Pana, Bingliang Qua, , Xiangyong Yub, Kaihang Xua, Yuewen Denga, Feilong Lianga a b
Fishery College, Guangdong Ocean University, 40 East Jiefang Road, Xiashan District, Zhanjiang 524025, China Ocean College, South China Agriculture University, 483 Wushan Road, Tianhe District, Guangzhou 510642, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Tyrosinase Pteria penguin Melanin RNA interference LC-MS/MS
Tyrosinase is a key rate-limiting enzyme in melanin synthesis. In this study, a new tyrosinase gene (Tyr) was identified from Pteria penguin and its effect on melanin synthesis was deliberated by RNA interference (RNAi). The cDNA of PpTyr was 1728 bp long, containing a 5′untranslated region (UTR) of 11 bp, a 3′UTR of 295 bp, and an open reading fragment of 1422 bp encoding 473 amino acids. Amino acid alignment showed PpTyr had the highest (50%) identity to tyrosinase-like protein 1 from Pinctada fucata. Phylogenetic tree analysis classified PpTyr into α-subclass of type-3 copper protein. Tissue expression analysis indicated that PpTyr was highly expressed in mantle, a nacre formation related tissue. After PpTyr RNA interference, PpTyr mRNA was significantly inhibited by 71.0% (P < 0.05). For other melanin-related genes, PpCreb2 and PpPax3 expression showed no significant change, but PpBcl2 was obviously increased. By liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis, the total content of PDCA (pyrrole-2, 3-dicarboxylic acid) and PTCA (pyrrole-2,3,5-tricarboxylic acid), as main markers for eumelanin, was sharply decreased by 66.6% after PpTyr RNAi (P < 0.05). The percentage of PDCA was also obviously decreased from 20.1% to 13.9%. This indicated that tyrosinase played a key role in melanin synthesis and color formation of P. penguin.
1. Introduction Pteria penguin (P. penguin) is an important marine bivalve to produce high quality seawater pearls in aquaculture of China. The color of pearl is the most important indicator to evaluate the pearl value. The nacre, secreted by mantle, is regarded as “mother of pearl”, whose color decides the color of pearl (Chen et al., 2017). The melanin is the major pigment in nacre of P. penguin and significantly affects the color of nacre (Yu et al., 2016). Inhibiting the synthesis and secretion of melanin in mantle could weaken the color of nacre and pearl in P. penguin. Melanin has attracted considerable interest because of their involvement in pigmentation and protection against ultraviolet (Ito et al., 2013). There is a complex pathway to regulate the melanin synthesis in vertebrates (Cheli et al., 2009). Tyrosinase (TYR) is a key rate-limiting enzyme for melanogenesis in this pathway (Hofreiter and Schoneberg, 2010; Cieslak et al., 2011), because tyrosinase catalyzes three different reactions in biosynthetic pathway of melanin: 1) the hydroxylation of tyrosine to L-DOPA; 2) the oxidation of L-DOPA to L-dopaquinone; and
3) the oxidation of 5, 6-dihydroxyindole (DHI) to indole-quinone (Inoue et al., 2013). The abnormality of TYR inhibited melanin production and caused oculocutaneous albinism type I (Bennett and Lamoreux, 2003). Recently, tyrosinases from several shellfish were characterized and studied (Chen et al., 2017; Feng et al., 2015; Takgi and Miyashita, 2014; Nagai et al., 2007). TYR was considered to play an important role in melanin synthesis, formation of shell matrix, and pigmentation of prismatic layer in Pinctada fucata (Takgi and Miyashita, 2014; Nagai et al., 2007), Hyriopsis cumingii (Chen et al., 2017) and Crassostrea gigas (Feng et al., 2015). We speculated that tyrosinase also worked as an important regulator to affect the melanin synthesis in Pteria penguin. Besides tyrosinase, some important factors were involved in melanin synthesis in mammalian (Rzepka et al., 2016; Lang et al., 2005; Kunwar et al., 2012). The cyclic-AMP responsive element-binding protein (CREB) was well known to regulate the expression of microphthalmia-associated transcription factor (MITF) (Rzepka et al., 2016), which regulated tyrosinase expression by phosphorylation (Cheli et al., 2009). The paired-box 3 (PAX3) was a transcription factor containing a
Abbreviations: RNAi, RNA interference; UTR, untranslated region; LC-MS/MS, liquid chromatograph-tandem mass spectrometer; PDCA, pyrrole-2, 3-dicarboxylic acid; PTCA, pyrrole2,3,5-tricarboxylic acid; DHI, 5,6-dihydroxyindole; DHICA, 5,6-dihydroxyindole-2-carboxylic acid; CREB, cyclic-AMP responsive element-binding protein; MITF, microphthalmia-associated transcription factor; Tyr, tyrosinase; PAX3, paired-box 3; BCL-2, B-cell lymphoma 2 ⁎ Corresponding author. E-mail address: [email protected] (B. Qu). https://doi.org/10.1016/j.gene.2018.02.060 Received 20 December 2017; Received in revised form 10 February 2018; Accepted 23 February 2018 Available online 26 February 2018 0378-1119/ © 2018 Published by Elsevier B.V.
Gene 656 (2018) 1–8
F. Yu et al.
Table 1 Primers used in the study. Primer
Sequence(5′–3′)
Application
Pptyr-outer-F Pptyr-inner-F Pptyr-outer-R Pptyr-inner-R UPM NUP Pptyr-test-F Pptyr-test-R Pptyr-qPCR-F Pptyr -qPCR-R PpCreb2-qPCR-F PpCreb2-qPCR-R PpPax3-qPCR-F PpPax3-qPCR-R PpBcl2-qPCR-F PpBcl2-qPCR-F 18S rRNA-F 18S rRNA-R Pptyr-siRNA1-F Pptyr- siRNA1-R Pptyr-siRNA2-F Pptyr- siRNA2-R GFP-siRNA-F GFP-siRNA-R
TGGATCTCCAGGCAGCAGTTTAATGAG GATGCCATTATGTACGAT GACTCCACCAACCCAGACATGAGG GATTACGCCAAGCTTGGGATTCTGCTGACTGGTG TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT AAGCAGTGGTATCAACGCAGAGT AGATGGGTCTCATGTGGGGAT CAATAACGTTTACGGAGCATTC GTTTGGTAATGGCAGAGGGTC TCGATAAAGGTATGGTGGAACC AACTCCCAGTGAAGCAGACA GCTCCCCAACAGTAGCCAAT TCCGTGCGTCATCAGTAGAC CCCTTGGTTTACTTCCGCCA TGAGGCACAGTTCCAGGATT ACTCTCCACACACCGTACAG CGTTCTTAGTTGGTGGAGCG AACGCCACTTGTCCCTCTAA GCGTAATACGACTCACTATAGGGCTGGCAATCCTATCGAGTG GCGTAATACGACTCACTATAGGGATGACAGACCCTCTGCCA GCGTAATACGACTCACTATAGGGGGGATCAGCTTATGTTATTGGGACT GCGTAATACGACTCACTATAGGGATCTCTTGGGGACTGAGCAATGTTA GATCACTAATACGACTCACTATAGGGATGGTGAGCAAGGGCGAGGA GATCACTAATACGACTCACTATAGGGTTACTTGTACAGCTCGTCCA
3′RACE Nest-3′RACE 5′RACE Nest-5′RACE RACE universal primer Nest-RACE universal primer cDNA test cDNA test qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR RNAi RNAi RNAi RNAi RNAi RNAi
subcordiformis were main food of these experimental animals.
homeodomain and a paired domain. PAX3 combined with the promoter of Mitf gene and activated the expression of Mitf, while at the same time, it competed with MITF for occupancy of the enhancer of dopachrome tautomerase (DCT), an downstream enzyme that functioned in melanin synthesis, thus preventing the expression of terminal markers of melanin synthesis (Lang et al., 2005). So PAX3 was shown to both promote and inhibit melanin synthesis. The B-cell lymphoma 2 (BCL-2), an oncoprotein involved in the regulation of apoptosis, had been shown to influence the melanin synthesis in mammal (Kunwar et al., 2012). However, there were few reports showing that these proteins above had participated in melanin synthesis in bivalves. There are two major chemically distinct melanin pigments, brownblack eumelanin and red-yellow pheomelanin (Szekely-Klepser et al., 2005). The shell color of P. penguin is deep black, therefore eumelanin is considered to be the main pigment in P. penguin. Eumelanin is mainly composed of the monomer units 5,6-dihydroxyindole (DHI) and 5,6dihydroxyindole-2-carboxylic acid (DHICA), which are insoluble in both acidic and alkaline solutions (Szekely-Klepser et al., 2005). However, the alkaline hydrogen peroxide oxidation products of DHI and DHICA, respectively named as pyrrole-2, 3-dicarboxylic acid (PDCA) and pyrrole-2,3,5-tricarboxylic acid (PTCA), could be detected by high-performance liquid chromatography (HPLC). PDCA and PTCA, as main markers for eumelanin, were identified and extensively used to evaluate the amount of eumelanin in sample using LC-MS/MS (Ito et al., 2011). In this study, we obtained a partial sequence of tyrosinase gene from the transcriptome data of P. penguin. A new Tyr gene from P. penguin was identified and its expression profile was analyzed. The exact effect of tyrosinase on melanin synthesis was deliberated by RNA interference (RNAi) technology and liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis.
2.2. RNA isolation and cDNA synthesis Total RNA from mantle (pallial zone), gill, adductor muscle, digestive diverticulum, foot, testis and ovary of P. penguin were isolated using RNeasyMini Kit according to the manufacturer's instructions (Qiagen, Gaithersburg, MD, USA). The quality of RNA was measured by electrophoresis on 1% agarose gels. The quantity of RNA was determined by measuring OD260/OD280 with NanoDrop ND1000 Spectrophotometer. The single strand cDNA was prepared from total RNA of mantle with M-MLV reverse transcriptase (Promega, Madison, WI, USA) and random primer. The transcriptome of P. penguin was constructed using RNA.
2.3. Cloning of Tyr cDNA and sequence analysis 5′RACE (Rapid Amplification of cDNA Ends) and 3′RACE reactions were conducted using SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) and Advantage 2 cDNA Polymerase Mix (Clontech, Mountain View, CA, USA) according to the manufacturer's instructions. The specific primers (Pptyr-outer-F and Pptyr-outer-R) were designed based on the partial sequence from the transcriptome of P. penguin. To increase the specificity of the amplification, nested-PCR was applied using Pptyr-inner-F and Pptyr-inner-R. All PCR products with expected size were subcloned into the PMD18-T vector (Takara, Dalian, China) and sequenced. The Pptyr-test-F and Pptyr-test-R were designed according to the linked nucleotide sequence to detect the correctness of sequence. All PCR primers were listed in the Table 1. The full-length cDNA of PpTyr was analyzed using the BLAST program available from (http://www.ncbi.nlm.nih.gov/). ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/) was used to characterize the open reading fragment (ORF). Signal 4.1 program (http://www.cbs. dtu.dk/services/SignalP/) was used to predict signal peptide of PpTyr. Transmembrane prediction was created by TMHMM program (http:// www.cbs.dtu.dk/services/TMHMM/). Multiple sequence alignments were created using the Clustal W program, and phylogenetic tree was constructed using MEGA 6.
2. Materials and methods 2.1. Experimental animals The Pteria penguin (about 350–400 g, shell length ranging between 10 and 12 cm) were obtained from Weizhou Island in Beihai, Guangxi Province, China. They were cultivated with the recirculating seawater at 25–26 °C in lab. Isochrysis zhanjiangensis and Platymonas 2
Gene 656 (2018) 1–8
F. Yu et al.
mobile phase A and B at start of the analysis was 90% A and 10% B. After 3 min, a linear gradient was then used to increase the fraction of mobile phase B to 100% and followed by an isocratic period. After 5 min, a linear gradient was used to restore the mobile phase ration to initial conditions. The cycle time was 7 min per injection. Analyses were performed at 40 °C at a flow rate of 0.3 mL/min. MS/MS detection was performed using a Xevo TQ triple quadrupole mass spectrometer operated in positive electrospray ionization (ESI) mode. The source temperature was 150 °C, desolvation temperature 550 °C, cone gas flow 50 L/h, desolvation gas flow 1100 L/h, and collision gas flow 0.14 mL/min (argon). The analytes were monitored in multireaction monitoring mode (MRM). Specific parameters are given in Table 2.
Table 2 Details of mass spectrometric detection. Compound
Parent ion (m/z)
Product ion (m/z)
Conc voltage (V)
Collision energy (eV)
Retention time (min)
PDCA PTCA
155.98 199.99
138.01 182.09
30 30
8 8
2.97 4.15
2.4. Quantitative real-time PCR (qRT-PCR) analysis of Tyr gene expression The cDNA was synthesized using a Superscript II polymerase kit (TransGen, Beijing, China) as a template. The qRT-PCR assays were performed using Thermo Scientific DyNAmo Flash SYBR Green qPCR Kit (Thermo scientific, Waltham, MA, USA) and were done with the Applied Biosystems 7500/7500 Fast Real-time System. Each sample was run in triplicate, along with the internal control gene 18SrRNA. The specific primers were listed in the Table 1.
2.8. Statistical analysis ANOVA in SPSS 19.0 (IBM, USA) was conducted to detect the differences in the relative expression levels of PpTyr, PpCreb2, PpPax3 and PpBcl2 from different samples. P < 0.05 was considered statistically significant.
2.5. RNA interference experiment
3. Results
RNAi experiment was performed to test the effect of PpTyr on melanin synthesis. Two PpTyr-specific small interfering RNAs (siRNA), Tyr-siRNA1 and Tyr-siRNA2, were designed and synthesized by T7 High Efficiency Transcription Kit (TransGen, Beijing, China). The green fluorescent protein (GFP) was cloned from pEGFP-N3 plasmid and GFPdsRNA was generated as a negative control (NC). The used primers were as Table 1. The integrity and quantity of dsRNA were verified as previously described (Suzuki et al., 2009). The 100 μL dsRNA was injected into adductor muscle of P. penguin at a final concentration of 1 μg/μL at the first time, and was injected with the same dose for the second time 4 days later (Yan et al., 2014). The 100 μL RNase-free water was injected as blank. Five individuals were used in each treatment group. Total RNA was extracted from the mantle at the 7th day after the first injection to detect the expression of relative genes.
3.1. Cloning and sequence analysis of Tyr cDNA in P. penguin Based on the part Tyr cDNA sequence from transcriptome database of P. penguin, the complete cDNA sequence of Tyr gene from P. penguin (Genbank accession no. KY799107) was cloned using RACE-PCR and named as PpTyr. The PpTyr cDNA, with a full length of 1728 bp, contained a 1422-bp open reading frame (12–1433), an 11-bp 5′-untranslated region (UTR), a 295-bp 3’-UTR with a typical polyadenylation signal sequence (AATAAA) and a 30 bp poly (A) tail (Fig. 1). The deduced amino acid sequence was 473 amino acids long, and contained an 18-residue signal peptide with a predicted cleavage site located between residues 18 and 19. The deduced molecular mass of PpTyr protein was 52.8 kDa with a theoretical pI of 6.23.
2.6. Isolation of total melanin
3.2. Multiple sequence alignment
The total melanin was isolated from mantle of P. penguin following a reported procedure (Panzella et al., 2006) with some modifications. Briefly, 1 g samples from mantle was finely homogenized in 1 mL phosphate buffer (pH 7.4) and incubated in 15 mL phosphate buffer with 2% (m/V) papain at 55 °C for 20 h. The mixture was centrifuged at 10000g/min for 10 min at room temperature. The precipitate was successively washed with 2 mL mineral ether, ethanol and water. The resulted black precipitate, as raw melanin, was dried and measured.
Amino acid sequence alignments of Tyr gene from P. penguin and other bivalves were performed. The PpTyr shared the highest (50%) identity with tyrosinase-like protein 1 of Pinctada fucata, 46% with tyrosinase 1 of Pinctada margaritifera, 45% with tyrosinase B2 of Pinctada maxima, and 36% with tyrosinase-like protein 1 of Mytilus coruscus. The sequence comparison revealed a conserved copperbinding domain (Cu(A)/Cu(B)), in which six histidine residues were highly conserved (Fig. 1 and Fig. 2A). As previous reports (Aguilera et al., 2013; Chen and Chan, 2012), the PpTyr gene owned an Nterminal signal peptide in addition to a conserved CuA/CuB domain, no cysteine-rich region and C-terminal transmembrane domain, and was classified to α-subclass of type-3 copper proteins (Fig. 2B).
2.7. LC-MS/MS assay of melanin component The content and component of melanin were analyzed using methods previously described by Ito and Wakamatsu (1998) with some modification. Briefly, a solution of 10 mg of melanin in 8.6 mL of 1 mol/ L K2CO3 was oxidized with 0.8 mL of 30% H2O2 by heating under reflux at 100 °C for 20 min. After cooling, 0.4 mL of 10% Na2SO3 was added to end the reaction. The mixture was acidified to pH 1.0 with 5 mL of 6 mol/L HCl and extracted twice with 70 mL of ether. The ether extract was dried in vacuo. The crystalline residue was redissolved by mobile phase and filtered by 0.45 μm organic membrane for HPLC analysis. The oxidation products were analyzed with liquid chromatographtandem mass spectrometer (LC-MS/MS). The chromatographic separation was performed using an Acquity ultraperformance liquid chromatography (UPLC) system consisting of a Waters ACQUITY UPLC HSS T3 (2.1 × 50 mm, 1.7 μm particle size). The mobile phase A was 0.1% (v/v) of formic acid in deionized water and 0.1%(v/v)of formic acid in methanol, respectively. The ratio of
3.3. Phylogenetic analyses The phylogenetic tree analysis was performed to indicate the evolutionary relationships of tyrosinases from different species. As shown in Fig. 2C, PpTyr was close to tyrosinase-like protein of Pinctada fucata and tyrosinase 1 of Pinctada margaritifera with a support of 99%. All tyrosinases of bivalves referred, including Pteria penguin, were grouped into a close cluster, named as α-subclass. The tyrosinases from Homo sapiens, Mus musculus, Xenopus laevis and Suberites domuncula were classified to a clade, γ-subclass. The α-subclass and γ-subclass were split from a same node, suggesting that they had a common ancestor. Similar to phylogenetic tree analysis, there was higher identity between αsubclass and γ-subclass based on alignment of the Cu(A)/Cu(B) domain (data not shown). The tyrosinases from Drosophila melanogaster and 3
Gene 656 (2018) 1–8
F. Yu et al.
80 23 161 50 242 77 323 104 404 131 485 158 566 185 647 212 728 239 809 266 890 293 971 320 1052 347 1133 374 1214 401 1295 428 1376 455 1456 474 1537 1618 1699 1728 Fig. 1. Nucleotide and deduced amino acid sequences of PpTyr. Two copper-binding domains (CuA/CuB) were grey, six highly conserved histidine residues inside them were circled. The initiation codon (ATG) and the stop codon (TAA) were boxed. The putative amino acid sequence of signal peptide was bold. The putative polyadenylation signal (aataaa) was underlined.
Amphimedon queenslandica belonged to another clade, β-subclass, which exhibited farther distances to α-subclass and γ-subclass tyrosinases.
profile of PpTyr with 18SrRNA as an internal control. As shown in Fig. 3, the PpTyr was constitutively expressed in all examined tissues, including mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. The expression level of PpTyr in mantle, which was responsible for nacre secretion, was significantly higher than that in other tissues (P < 0.05). The result suggested that PpTyr gene might
3.4. PpTyr mRNA expression profile in different tissues The qRT-PCR was employed to determine the tissue expression 4
Gene 656 (2018) 1–8
F. Yu et al.
PmarTyr1
A PfTyr-like1 PpTyr
McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2
PmarTyr1 PfTyr-like1 PpTyr McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2 PmarTyr1 PfTyr-like1 PpTyr McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2
B
C
Fig. 2. Sequence alignment and phylogenetic analysis. (A) Multiple sequence comparison of Tyr copper-binding domain among bivalves including Pteria penguin (PpTyr, KY799107), Pinctada margaritifera (PmarTyr1, H2A0L0.1), Pinctada maxima (PmaxTyrB2, AHZ34292.1), Pinctada fucata (PfTyr-like1, BAF42771.1), Mytilus coruscus (McTyr-like1, AKI87982.1), Mizuhopecten yessoensis (MyTyr, AKE79095.1), Hyriopsis cumingii (HcTyr, APC92581.1) and Crassostrea gigas (CgTyr, XP_011422333.1). The conserved amino acids were written in black background, and similar amino acids were shaded in green and pink. The highly conserved histidine residues were signed with *. (B) A scheme depicting the structure of TYR protein in P. penguin, compared with γ-subclass and β-subclass protein. A signal peptide (SP) was shown in orange box. The Cu(A)/Cu(B) domain with six conserved histidine residues was shown in blue box. The cysteine-rich region (CYS) and transmembrane domain (TM) were shown in green box. (C) Phylogenetic tree of tyrosinase genes. Xenopus laevis (XlTyr, XP_018124324.1), Homo sapiens (HsTyr, AAB60319.1), Mus musculus (MmTyr, NP_035791.1), Suberites domuncula (SdTyr-like, CAE01389.1), Drosophila melanogaster (DmTyr, Q9W1V6.1) and Amphimedon queenslandica (AqTyr, XP_019858846.1). Numbers in the branches represented the bootstrap values (as a percentage). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
5
Gene 656 (2018) 1–8
F. Yu et al.
the content and composition of melanin in mantle from each group after RNA interference using LC-MS/MS. The most sensitive and specific MS/MS transitions for PDCA and PTCA, the alkaline hydrogen peroxide oxidation product of eumelanin, were obtained by examining their product ion spectra. The mass-to-charge ratio value of PDCA was 156, and that of PTCA was 199, consistent with their molecular weight (Fig. 5A and B). The quantity of PDCA and PTCA was calculated according to the special area of peak, which appeared at 2.97 min and 4.15 min, respectively. As shown in Fig. 5C and D, the total amount of PDCA and PTCA was sharply decreased by 66.6% in Tyr-siRNA2 group compared with the negative control groups (P < 0.05). The content of PDCA was inhibited by 75.7% and PTCA was inhibited by 64.4%. The percentage of PDCA in total oxidation products was obviously decreased from 20.1% to 13.9%.
4. Discussion The copper-binding proteins, which could obtain copper ions to achieve their active form, were divided into three groups based on their geometric structure of the active site: type-1, type-2 and type-3 (Aguilera et al., 2013; Chen and Chan, 2012). All type-3 copper proteins possessed a conserved pair of copper-binding sites, called as Cu(A)/Cu (B), and could be further classified into three subclasses based on the possession of other domain or motifs in addition to the Cu(A)/Cu(B) (Decker et al., 2007). The α-subclass had a signal peptide in N-terminal. The β-subclass lacked other domain except copper-binding domain. The γ-subclass possessed an N-terminal signal peptide, a cysteine-rich region and a transmembrane domain at C-terminal end (Chen and Chan, 2012; Lim et al., 2009). According to the classification above, this tyrosinase from P. penguin belonged to type-3 copper protein superfamily because of the existence of Cu(A)/Cu(B) domain, and was further classified to α-subclass due to the presence of an N-terminal signal peptide and the absence of cysteine-rich region and transmembrane domain at C-terminal end. As reported, tyrosinase participated in various physiological processes, including pigment synthesis, wound healing, oxygen transport, innate immunity and insect cuticle sclerotization (Cerenius et al., 2008; Andersen, 2010). That might explain why there was a constitutively expression of PpTyr in all examined tissues, such as mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. Most physiological processes above, especially pigment synthesis and immunity response, mainly happened in mantle (Lin et al., 2015). That might explain why there was the highest expression of PpTyr in mantle. Melanin synthesis is an enzymatic process that converts tyrosine to melanin pigment. > 40 relative genes form a complex network to regulate the melanin synthesis in mammals (Busca and Ballotti, 2000). Tyrosinase catalyzes two initial reactions and is the key rate-limiting enzyme. There are other transcription factors involved in regulation in the network, such as CREB and PAX3. They work, in single factor or complex of factors, to directly activate the MITF and indirectly regulate the expression of tyrosinase (Tyr), dopachrome tautomerase (Dct), and
Fig. 3. Expression profile of PpTyr in various tissues of P. penguin. The qRT-PCR was done with RNA samples from mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. The 18SrRNA gene of P. penguin was used as an internal control. Each bar was a mean of 5 pearl oysters. Significant difference (P < 0.05) was indicated by different letters through one-way ANOVA and Duncan's multiple comparisons. Bars sharing the same letter are not significantly different (P > 0.05). The bar represented standard deviation.
participate in nacre formation of P. penguin. 3.5. RNAi-mediated Tyr knockdown in P. penguin To investigate the function of Tyr in melanin synthesis of P. penguin, RNAi was performed to inhibit the expression of PpTyr. To evaluate the silencing effects of RNAi, the qRT-PCR was employed to detect the PpTyr expression at 7th day after the first siRNA injection. As shown in Fig. 4A, the PpTyr expression was reduced by 59.1% in the Tyr-siRNA1 group (P < 0.05) and 71.0% in the Tyr-siRNA2 group (P < 0.05) compared with the negative control group. 3.6. Effects of PpTyr silencing on the expression of Creb2, Pax3 and Bcl2 in P. penguin After RNAi, the transcripts of PpCreb2, PpPax3 and PpBcl2 genes were analyzed. As shown in Fig. 4B, the transcript of PpBcl2 gene, an apoptosis-related gene, was highly raised > 2.5 fold (P < 0.05). No significant difference in expression level of PpCreb2 and PpPax3, known as regulatory factors in melanin synthesis, was observed after PpTyr knockdown (P > 0.05). 3.7. Changes of melanin quantity and component after RNA interference To further investigate the function of TYR in P. penguin, we detected
Fig. 4. Expression of PpTyr, PpCreb2, PpPax3 and PpBcl2 after RNAi. (A) Expression of PpTyr. (B) Expression of PpCreb2, PpPax3 and PpBcl2. The qRTPCR was done with RNA samples from blank group (RNase-free water), negative control group (GFPsiRNA) and two RNAi groups (Tyr-siRNA1 and TyrsiRNA2) at the seventh days after first injection. The 18SrRNA of P. penguin was used as an internal control. Each bar was a mean of 5 individuals. Significant difference was indicated by different letters (P < 0.05) through one-way ANOVA and Duncan's multiple comparisons. Bars sharing the same letter are not significantly different (P > 0.05). The bar represented standard deviation. The comparisons were just taken among different groups of each gene.
6
Gene 656 (2018) 1–8
F. Yu et al.
A
B
Fig. 5. LC-MS/MS analysis of oxidation products of melanin in P. penguin. (A) The negative ion product spectra of PDCA at m/z 156 (B) The negative ion product spectra of PTCA at m/z 199 (C) HPLC chromatograms of oxidation products of melanin from negative group and Tyr-siRNA2 group. (D) The quantity of PDCA and PTCA in negative group and Tyr-siRNA2 group. Bars sharing the same letter are not significantly different (P > 0.05).
ion transitions could be established by mass spectrometer (Simon et al., 2009). In this study, the total content of eumelanin was significantly decreased by PpTyr silencing, which indicated that tyrosinase was a determinant of melanin synthesis in P. penguin, consistent with mammals. The melanin production mainly depended on the expression and activation of tyrosinase. After PpTyr RNA interfering, there was more obvious decrease in the percentage of PDCA (from 20.1% to 13.9%), which indicated that tyrosinase silencing showed more inhibition effect on degradation of DHI to PDCA, compared to DHICA to PTCA, in eumelanin synthesis process of P. penguin.
tyrosinase-related protein 1 (Tyrp1) (Busca and Ballotti, 2000). Both Creb and Pax3 were upstream genes of Mitf, and no feedback regulation among them was found. In this report, we analyzed the influence of tyrosinase knockdown on expression of relative genes in P. penguin. There was no significant difference in PpCreb2 and PpPax3 mRNA after PpTyr knockdown, suggesting that Creb2 and Pax3 might function upstream of Tyr in P. penguin, similar to that in mammal (Lang et al., 2005). Moreover, the compensatory expression of Creb2 and Pax3 by tyrosinase silencing might not exist, and no obvious feedback regulation of Tyr to Creb2 and Pax3 was found in melanin synthesis pathway of P. penguin. The Bcl2 is a cell apoptosis related gene and takes part in the control of cell survival (Seiberg, 2013). In this study, the tyrosinase silencing led to an obvious increase in PpBcl2 expression. A possible explanation was that the inhibition of melanin synthesis by Tyr silencing affected the normal cell survival in P. penguin, since melanin was an important product in protection cells against noxious DNA damage. Another explanation was that the decrease of tyrosinase protein affected the normal cell survival, because tyrosinase involved in pigment synthesis (Hofreiter and Schoneberg, 2010), wound healing (Aguilera et al., 2013) and innate immunity (Cerenius et al., 2008), all of which were important physiological processes in organism. The third explanation was that the decrease of Tyr mRNA saved more MITF to combine with Bcl2, enhanced the expression of Bcl2 and controlled the cell survival, because Bcl2 was also a direct MITF target gene (McGill et al., 2002), as same as Tyr (Lang et al., 2005). We thought the third point might be the dominant reason to explain the increase of PpBcl2 expression. LC-MS/MS was employed to detect the content and composition of eumelanin, which was considered to be the main pigment in P. penguin with black shell. DHI and DHICA were main components of eumelanin and could be oxidized to PDCA and PTCA, whose precursor-to-product
5. Conclusions In conclusion, we obtained a new tyrosinase gene from Pteria penguin, and classified it into α-subclass of type-3 copper protein. Tissue expression analysis showed that PpTyr was highly expressed in mantle, a nacre formation related tissue. The PpTyr silencing significantly inhibited PpTyr expression, increased PpBcl2 expression, but had no effect on PpCreb2 and PpPax3 expression. Furthermore, by liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis, the PpTyr silencing sharply decreased the total content of PDCA and PTCA, two main markers for eumelanin. The percentage of PDCA was also obviously decreased. Thus, we believed tyrosinase played a key role in melanin synthesis and color formation of P. penguin. Funding This work was supported by the Guangdong Provincial Science and Technology Program (2016A020210115); Guangdong Marine Fishery Development Foundation (B201601-Z08); Guangdong Major Project of Innovation School (GDOU2016050248); Outstanding Young Teacher 7
Gene 656 (2018) 1–8
F. Yu et al.
Foundation of Guangdong Ocean University (2014004) and Doctoral Scientific Research Foundation of Guangdong Ocean University (E15041).
1111/j.1600-0749.1998.tb00721.x. Ito, S., Nakanishi, Y., Valenzuela, R.K., Brilliant, M.H., Kolbe, L., Wakamatsu, K., 2011. Usefulness of alkaline hydrogen peroxide oxidation to analyze eumelanin and pheomelanin in various tissue samples: application to chemical analysis of human hair melanins. Pigment Cell Melanoma Res. 24, 605–613. http://dx.doi.org/10. 1111/j.1755-148X.2011.00864.x. Ito, S., Wakamatsu, K., Glass, K., Simon, J.D., 2013. High-performance liquid chromatography estimation of cross-linking of dihydroxyindole moiety in eumelanin. Anal. Biochem. 434, 221–225. http://dx.doi.org/10.1016/j.ab.2012.12.005. Kunwar, A., Adhikary, B., Jayakumar, S., Barik, A., Chattopadhyay, S., Raghukumar, S., Priyadarsini, K.I., 2012. Melanin, a promising radioprotector: mechanisms of actions in a mice model. Toxicol. Appl. Pharmacol. 264, 202–211. http://dx.doi.org/10. 1016/j.taap.2012.08.002. Lang, D., Lu, M.M., Huang, L., Engleka, K.A., Zhang, M., Chu, E.Y., Lipner, S., Skoultchi, A., Millar, S.E., Epstein, J.A., 2005. Pax3 functions at a nodal point in melanocyte stem cell differentiation. Nature 433, 884–887. http://dx.doi.org/10.1038/ nature03292. Lim, Y.J., Lee, E.H., Kang, T.H., Ha, S.K., Oh, M.S., Kim, S.M., Yoon, T.J., Kang, C., Park, J.H., Kim, S.Y., 2009. Inhibitory effects of arbutin on melanin biosynthesis of alphamelanocyte stimulating hormone-induced hyperpigmentation in cultured brownish guinea pig skin tissues. Arch. Pharm. Res. 32, 367–373. http://dx.doi.org/10.1007/ s12272-009-1309-8. Lin, C.C., Yang, C.H., Lin, Y.J., Chiu, Y.W., Chen, C.Y., 2015. Establishment of a melanogenesis regulation assay system using a fluorescent protein reporter combined with the promoters for the melanogenesis-related genes in human melanoma cells. Enzym. Microb. Technol. 68, 1–9. http://dx.doi.org/10.1016/j.enzmictec. 2014.09.008. McGill, G.G., Horstmann, M., Widlund, H.R., Du, J., Motyckova, G., Nishimura, E.K., Lin, Y.L., Ramaswamy, S., Avery, W., Ding, H.F., Jordan, S.A., Jackson, I.J., Korsmeyer, S.J., Golub, T.R., Fisher, D.E., 2002. Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell 109, 707–718. http://dx.doi.org/10.1016/S0092-8674(02)00762-6. Nagai, K., Yano, M., Morimoto, K., Miyamoto, H., 2007. Tyrosinase localization in mollusc shells. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 146, 207–214. http://dx. doi.org/10.1016/j.cbpb.2006.10.105. Panzella, L., Manini, P., Monfrecola, G., d'Ischia, M., Napolitano, A., 2006. An easy-to-run method for routine analysis of eumelanin and pheomelanin in pigmented tissues. Pigment Cell Res. 20, 128–133. http://dx.doi.org/10.1111/j.1600-0749.2006. 00359.x. Rzepka, Z., Buszman, E., Beberok, A., Wrzesniok, D., 2016. From tyrosine to melanin: signaling pathways and factors regulating melanogenesis. Postepy Hig. Med. Dosw. 70, 695–708. http://dx.doi.org/10.5604/17322693.1208033. Seiberg, M., 2013. Age-induced hair graying-the multiple effects of oxidative stress. Int. J. Cosmet. Sci. 35, 532–538. http://dx.doi.org/10.1111/ics.12090. Simon, J.D., Peles, D., Wakamatsu, K., Ito, S., 2009. Current challenges in understanding melanogenesis: bridging chemistry, biological control, morphology, and function. Pigment Cell Melanoma Res. 22, 563–579. http://dx.doi.org/10.1111/j.1755-148X. 2009.00610.x. Suzuki, M., Saruwatari, K., Kogure, T., Yamamoto, Y., Nishimura, T., Kato, T., Nagasawa, H., 2009. An acidic matrix protein, pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. http://dx.doi.org/10.1126/science.1173793. Szekely-Klepser, G., Wade, K., Wooolson, D., Brown, R., Fountain, S., Kindt, E., 2005. A validated LC/MS/MS method for the quantification of pyrrole-2,3,5-tricarboxylic acid (PTCA), a eumelanin specific biomarker, in human skin punch biopsies. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 826, 31–40. http://dx.doi.org/10. 1016/j. jchromb.2005.08.002. Takgi, R., Miyashita, T., 2014. A cDNA cloning of a novel alpha-class tyrosinase of Pinctada fucata: its expression analysis and characterization of the expressed protein. Enzym. Res. 780549, 1–9. http://dx.doi.org/10.1155/2014/780549. Yan, F., Luo, S.J., Jiao, Y., Deng, Y.W., Du, X.D., Huang, R.L., Wang, Q.H., Chen, W.Y., 2014. Molecular characterization of the BMP7 gene and its potential role in shell formation in Pinctada martensii. Int. J. Mol. Sci. 15, 21215–21228. http://dx.doi.org/ 10.3390/ijms151121215. Yu, F.F., Song, N.N., Wang, M.F., Qu, B.L., Yu, X.Y., 2016. The effects of arbutin and valproic acid shell color in Pteria penguin. Genom. Appl. Biol. 35, 1–6. http://dx.doi. org/10.13417/j.gab.035.00168.
Author contributions Feifei Yu and Bingliang Qu conceived and designed the experiments; Feifei Yu, Zhenni Pan and Kaihang Xu performed the experiments; Xiangyong Yu and Bingliang Qu analyzed the data; Yuewen Deng and Feilong Liang contributed materials; Feifei Yu drafted the manuscript; Bingliang Qu made a critical revision of the manuscript. Conflicts of interest The authors declare no conflict of interest. References Aguilera, F., McDougall, C., Degnan, B.M., 2013. Origin, evolution and classification of type-3 copper proteins: lineage-specific gene expansions and losses across the Metazoa. BMC Evol. Biol. 96, 1–12. http://dx.doi.org/10.1186/1471-2148-13-96. Andersen, S.O., 2010. Insect cuticular sclerotization: a review. Insect Biochem. Mol. Biol. 40, 166–178. http://dx.doi.org/10.1016/j.ibmb.2009.10.007. Bennett, D.C., Lamoreux, M.L., 2003. The color loci of mice-a genetic century. Pigment Cell Res. 16, 333–344. http://dx.doi.org/10.1034/j.1600-0749.2003.00067.x. Busca, R., Ballotti, R., 2000. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 13, 60–69. http://dx.doi.org/10.1034/j.1600-0749. 2000.130203.x. Cerenius, L., Lee, B.L., Söderhäll, K., 2008. The proPO-system: pros and cons for its role in invertebrate immunity. Trends Immunol. 29, 263–271. http://dx.doi.org/10.1016/j. it.2008.02.009. Cheli, Y., Ohanna, M., Ballotti, R., Bertolotto, C., 2009. Fifteen-year quest for microphthalmia-associated transcription factor target genes. Pigment Cell Melanoma Res. 23, 27–40. http://dx.doi.org/10.1111/j.1755-148X.2009.00653.x. Chen, D.S., Chan, K.M., 2012. Identification of hepatic copper-binding proteins from tilapia by column chromatography with proteomic approaches. Metallomics 4, 820–834. http://dx.doi.org/10.1039/c2mt20057k. Chen, X., Liu, X., Bai, Z., Zhao, L., Li, J., 2017. HcTyr and HcTyp-1 of Hyriopsis cumingii, novel tyrosinase and tyrosinase-related protein genes involved in nacre color formation. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 204, 1–8. http://dx.doi.org/ 10.1016/j.cbpb.2016.11.005. Cieslak, M., Reissmann, M., Hofreiter, M., Ludwig, A., 2011. Colours of domestication. Biol. Rev. Camb. Philos. Soc. 86, 885–899. http://dx.doi.org/10.1111/j.1469-185X. 2011.00177.x. Decker, H., Schweikardt, T., Nillius, D., Salzbrunn, U., Jaenicke, E., Tuczek, F., 2007. Similar enzyme activation and catalysis in hemocyanins and tyrosinases. Gene 398, 183–191. http://dx.doi.org/10.1016/j.gene.2007.02.051. Feng, D., Li, Q., Yu, H., Zhao, X., Kong, L., 2015. Comparative transcriptome analysis of the Pacific oyster Crassostrea gigas characterized by shell colors: identification of genetic bases potentially involved in pigmentation. PLoS One 10, e0145257. http:// dx.doi.org/10.1371/journal.pone.0145257. Hofreiter, M., Schoneberg, T., 2010. The genetic and evolutionary basis of colour variation in vertebrates. Cell. Mol. Life Sci. 67, 2591–2603. http://dx.doi.org/10.1007/ s00018-010-0333-7. Inoue, Y., Hasegawa, S., Yamada, T., Date, Y., Mizutani, H., Nakata, S., Matsunaga, K., Akamatsu, H., 2013. Analysis of the effects of hydroquinone and arbutin on the differentiation of melanocytes. Biol. Pharm. Bull. 36, 1722–1730. http://dx.doi.org/ 10.1248/bpb.b13-00206. Ito, S., Wakamatsu, K., 1998. Chemical degradation of melanins: application to identification of dopamine-melanin. Pigment Cell Res. 11, 120–126. http://dx.doi.org/10.
8
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Identification of a tyrosinase gene and its functional analysis in melanin synthesis of Pteria penguin
T
⁎
Feifei Yua, Zhenni Pana, Bingliang Qua, , Xiangyong Yub, Kaihang Xua, Yuewen Denga, Feilong Lianga a b
Fishery College, Guangdong Ocean University, 40 East Jiefang Road, Xiashan District, Zhanjiang 524025, China Ocean College, South China Agriculture University, 483 Wushan Road, Tianhe District, Guangzhou 510642, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Tyrosinase Pteria penguin Melanin RNA interference LC-MS/MS
Tyrosinase is a key rate-limiting enzyme in melanin synthesis. In this study, a new tyrosinase gene (Tyr) was identified from Pteria penguin and its effect on melanin synthesis was deliberated by RNA interference (RNAi). The cDNA of PpTyr was 1728 bp long, containing a 5′untranslated region (UTR) of 11 bp, a 3′UTR of 295 bp, and an open reading fragment of 1422 bp encoding 473 amino acids. Amino acid alignment showed PpTyr had the highest (50%) identity to tyrosinase-like protein 1 from Pinctada fucata. Phylogenetic tree analysis classified PpTyr into α-subclass of type-3 copper protein. Tissue expression analysis indicated that PpTyr was highly expressed in mantle, a nacre formation related tissue. After PpTyr RNA interference, PpTyr mRNA was significantly inhibited by 71.0% (P < 0.05). For other melanin-related genes, PpCreb2 and PpPax3 expression showed no significant change, but PpBcl2 was obviously increased. By liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis, the total content of PDCA (pyrrole-2, 3-dicarboxylic acid) and PTCA (pyrrole-2,3,5-tricarboxylic acid), as main markers for eumelanin, was sharply decreased by 66.6% after PpTyr RNAi (P < 0.05). The percentage of PDCA was also obviously decreased from 20.1% to 13.9%. This indicated that tyrosinase played a key role in melanin synthesis and color formation of P. penguin.
1. Introduction Pteria penguin (P. penguin) is an important marine bivalve to produce high quality seawater pearls in aquaculture of China. The color of pearl is the most important indicator to evaluate the pearl value. The nacre, secreted by mantle, is regarded as “mother of pearl”, whose color decides the color of pearl (Chen et al., 2017). The melanin is the major pigment in nacre of P. penguin and significantly affects the color of nacre (Yu et al., 2016). Inhibiting the synthesis and secretion of melanin in mantle could weaken the color of nacre and pearl in P. penguin. Melanin has attracted considerable interest because of their involvement in pigmentation and protection against ultraviolet (Ito et al., 2013). There is a complex pathway to regulate the melanin synthesis in vertebrates (Cheli et al., 2009). Tyrosinase (TYR) is a key rate-limiting enzyme for melanogenesis in this pathway (Hofreiter and Schoneberg, 2010; Cieslak et al., 2011), because tyrosinase catalyzes three different reactions in biosynthetic pathway of melanin: 1) the hydroxylation of tyrosine to L-DOPA; 2) the oxidation of L-DOPA to L-dopaquinone; and
3) the oxidation of 5, 6-dihydroxyindole (DHI) to indole-quinone (Inoue et al., 2013). The abnormality of TYR inhibited melanin production and caused oculocutaneous albinism type I (Bennett and Lamoreux, 2003). Recently, tyrosinases from several shellfish were characterized and studied (Chen et al., 2017; Feng et al., 2015; Takgi and Miyashita, 2014; Nagai et al., 2007). TYR was considered to play an important role in melanin synthesis, formation of shell matrix, and pigmentation of prismatic layer in Pinctada fucata (Takgi and Miyashita, 2014; Nagai et al., 2007), Hyriopsis cumingii (Chen et al., 2017) and Crassostrea gigas (Feng et al., 2015). We speculated that tyrosinase also worked as an important regulator to affect the melanin synthesis in Pteria penguin. Besides tyrosinase, some important factors were involved in melanin synthesis in mammalian (Rzepka et al., 2016; Lang et al., 2005; Kunwar et al., 2012). The cyclic-AMP responsive element-binding protein (CREB) was well known to regulate the expression of microphthalmia-associated transcription factor (MITF) (Rzepka et al., 2016), which regulated tyrosinase expression by phosphorylation (Cheli et al., 2009). The paired-box 3 (PAX3) was a transcription factor containing a
Abbreviations: RNAi, RNA interference; UTR, untranslated region; LC-MS/MS, liquid chromatograph-tandem mass spectrometer; PDCA, pyrrole-2, 3-dicarboxylic acid; PTCA, pyrrole2,3,5-tricarboxylic acid; DHI, 5,6-dihydroxyindole; DHICA, 5,6-dihydroxyindole-2-carboxylic acid; CREB, cyclic-AMP responsive element-binding protein; MITF, microphthalmia-associated transcription factor; Tyr, tyrosinase; PAX3, paired-box 3; BCL-2, B-cell lymphoma 2 ⁎ Corresponding author. E-mail address: [email protected] (B. Qu). https://doi.org/10.1016/j.gene.2018.02.060 Received 20 December 2017; Received in revised form 10 February 2018; Accepted 23 February 2018 Available online 26 February 2018 0378-1119/ © 2018 Published by Elsevier B.V.
Gene 656 (2018) 1–8
F. Yu et al.
Table 1 Primers used in the study. Primer
Sequence(5′–3′)
Application
Pptyr-outer-F Pptyr-inner-F Pptyr-outer-R Pptyr-inner-R UPM NUP Pptyr-test-F Pptyr-test-R Pptyr-qPCR-F Pptyr -qPCR-R PpCreb2-qPCR-F PpCreb2-qPCR-R PpPax3-qPCR-F PpPax3-qPCR-R PpBcl2-qPCR-F PpBcl2-qPCR-F 18S rRNA-F 18S rRNA-R Pptyr-siRNA1-F Pptyr- siRNA1-R Pptyr-siRNA2-F Pptyr- siRNA2-R GFP-siRNA-F GFP-siRNA-R
TGGATCTCCAGGCAGCAGTTTAATGAG GATGCCATTATGTACGAT GACTCCACCAACCCAGACATGAGG GATTACGCCAAGCTTGGGATTCTGCTGACTGGTG TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT AAGCAGTGGTATCAACGCAGAGT AGATGGGTCTCATGTGGGGAT CAATAACGTTTACGGAGCATTC GTTTGGTAATGGCAGAGGGTC TCGATAAAGGTATGGTGGAACC AACTCCCAGTGAAGCAGACA GCTCCCCAACAGTAGCCAAT TCCGTGCGTCATCAGTAGAC CCCTTGGTTTACTTCCGCCA TGAGGCACAGTTCCAGGATT ACTCTCCACACACCGTACAG CGTTCTTAGTTGGTGGAGCG AACGCCACTTGTCCCTCTAA GCGTAATACGACTCACTATAGGGCTGGCAATCCTATCGAGTG GCGTAATACGACTCACTATAGGGATGACAGACCCTCTGCCA GCGTAATACGACTCACTATAGGGGGGATCAGCTTATGTTATTGGGACT GCGTAATACGACTCACTATAGGGATCTCTTGGGGACTGAGCAATGTTA GATCACTAATACGACTCACTATAGGGATGGTGAGCAAGGGCGAGGA GATCACTAATACGACTCACTATAGGGTTACTTGTACAGCTCGTCCA
3′RACE Nest-3′RACE 5′RACE Nest-5′RACE RACE universal primer Nest-RACE universal primer cDNA test cDNA test qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR RNAi RNAi RNAi RNAi RNAi RNAi
subcordiformis were main food of these experimental animals.
homeodomain and a paired domain. PAX3 combined with the promoter of Mitf gene and activated the expression of Mitf, while at the same time, it competed with MITF for occupancy of the enhancer of dopachrome tautomerase (DCT), an downstream enzyme that functioned in melanin synthesis, thus preventing the expression of terminal markers of melanin synthesis (Lang et al., 2005). So PAX3 was shown to both promote and inhibit melanin synthesis. The B-cell lymphoma 2 (BCL-2), an oncoprotein involved in the regulation of apoptosis, had been shown to influence the melanin synthesis in mammal (Kunwar et al., 2012). However, there were few reports showing that these proteins above had participated in melanin synthesis in bivalves. There are two major chemically distinct melanin pigments, brownblack eumelanin and red-yellow pheomelanin (Szekely-Klepser et al., 2005). The shell color of P. penguin is deep black, therefore eumelanin is considered to be the main pigment in P. penguin. Eumelanin is mainly composed of the monomer units 5,6-dihydroxyindole (DHI) and 5,6dihydroxyindole-2-carboxylic acid (DHICA), which are insoluble in both acidic and alkaline solutions (Szekely-Klepser et al., 2005). However, the alkaline hydrogen peroxide oxidation products of DHI and DHICA, respectively named as pyrrole-2, 3-dicarboxylic acid (PDCA) and pyrrole-2,3,5-tricarboxylic acid (PTCA), could be detected by high-performance liquid chromatography (HPLC). PDCA and PTCA, as main markers for eumelanin, were identified and extensively used to evaluate the amount of eumelanin in sample using LC-MS/MS (Ito et al., 2011). In this study, we obtained a partial sequence of tyrosinase gene from the transcriptome data of P. penguin. A new Tyr gene from P. penguin was identified and its expression profile was analyzed. The exact effect of tyrosinase on melanin synthesis was deliberated by RNA interference (RNAi) technology and liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis.
2.2. RNA isolation and cDNA synthesis Total RNA from mantle (pallial zone), gill, adductor muscle, digestive diverticulum, foot, testis and ovary of P. penguin were isolated using RNeasyMini Kit according to the manufacturer's instructions (Qiagen, Gaithersburg, MD, USA). The quality of RNA was measured by electrophoresis on 1% agarose gels. The quantity of RNA was determined by measuring OD260/OD280 with NanoDrop ND1000 Spectrophotometer. The single strand cDNA was prepared from total RNA of mantle with M-MLV reverse transcriptase (Promega, Madison, WI, USA) and random primer. The transcriptome of P. penguin was constructed using RNA.
2.3. Cloning of Tyr cDNA and sequence analysis 5′RACE (Rapid Amplification of cDNA Ends) and 3′RACE reactions were conducted using SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) and Advantage 2 cDNA Polymerase Mix (Clontech, Mountain View, CA, USA) according to the manufacturer's instructions. The specific primers (Pptyr-outer-F and Pptyr-outer-R) were designed based on the partial sequence from the transcriptome of P. penguin. To increase the specificity of the amplification, nested-PCR was applied using Pptyr-inner-F and Pptyr-inner-R. All PCR products with expected size were subcloned into the PMD18-T vector (Takara, Dalian, China) and sequenced. The Pptyr-test-F and Pptyr-test-R were designed according to the linked nucleotide sequence to detect the correctness of sequence. All PCR primers were listed in the Table 1. The full-length cDNA of PpTyr was analyzed using the BLAST program available from (http://www.ncbi.nlm.nih.gov/). ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/) was used to characterize the open reading fragment (ORF). Signal 4.1 program (http://www.cbs. dtu.dk/services/SignalP/) was used to predict signal peptide of PpTyr. Transmembrane prediction was created by TMHMM program (http:// www.cbs.dtu.dk/services/TMHMM/). Multiple sequence alignments were created using the Clustal W program, and phylogenetic tree was constructed using MEGA 6.
2. Materials and methods 2.1. Experimental animals The Pteria penguin (about 350–400 g, shell length ranging between 10 and 12 cm) were obtained from Weizhou Island in Beihai, Guangxi Province, China. They were cultivated with the recirculating seawater at 25–26 °C in lab. Isochrysis zhanjiangensis and Platymonas 2
Gene 656 (2018) 1–8
F. Yu et al.
mobile phase A and B at start of the analysis was 90% A and 10% B. After 3 min, a linear gradient was then used to increase the fraction of mobile phase B to 100% and followed by an isocratic period. After 5 min, a linear gradient was used to restore the mobile phase ration to initial conditions. The cycle time was 7 min per injection. Analyses were performed at 40 °C at a flow rate of 0.3 mL/min. MS/MS detection was performed using a Xevo TQ triple quadrupole mass spectrometer operated in positive electrospray ionization (ESI) mode. The source temperature was 150 °C, desolvation temperature 550 °C, cone gas flow 50 L/h, desolvation gas flow 1100 L/h, and collision gas flow 0.14 mL/min (argon). The analytes were monitored in multireaction monitoring mode (MRM). Specific parameters are given in Table 2.
Table 2 Details of mass spectrometric detection. Compound
Parent ion (m/z)
Product ion (m/z)
Conc voltage (V)
Collision energy (eV)
Retention time (min)
PDCA PTCA
155.98 199.99
138.01 182.09
30 30
8 8
2.97 4.15
2.4. Quantitative real-time PCR (qRT-PCR) analysis of Tyr gene expression The cDNA was synthesized using a Superscript II polymerase kit (TransGen, Beijing, China) as a template. The qRT-PCR assays were performed using Thermo Scientific DyNAmo Flash SYBR Green qPCR Kit (Thermo scientific, Waltham, MA, USA) and were done with the Applied Biosystems 7500/7500 Fast Real-time System. Each sample was run in triplicate, along with the internal control gene 18SrRNA. The specific primers were listed in the Table 1.
2.8. Statistical analysis ANOVA in SPSS 19.0 (IBM, USA) was conducted to detect the differences in the relative expression levels of PpTyr, PpCreb2, PpPax3 and PpBcl2 from different samples. P < 0.05 was considered statistically significant.
2.5. RNA interference experiment
3. Results
RNAi experiment was performed to test the effect of PpTyr on melanin synthesis. Two PpTyr-specific small interfering RNAs (siRNA), Tyr-siRNA1 and Tyr-siRNA2, were designed and synthesized by T7 High Efficiency Transcription Kit (TransGen, Beijing, China). The green fluorescent protein (GFP) was cloned from pEGFP-N3 plasmid and GFPdsRNA was generated as a negative control (NC). The used primers were as Table 1. The integrity and quantity of dsRNA were verified as previously described (Suzuki et al., 2009). The 100 μL dsRNA was injected into adductor muscle of P. penguin at a final concentration of 1 μg/μL at the first time, and was injected with the same dose for the second time 4 days later (Yan et al., 2014). The 100 μL RNase-free water was injected as blank. Five individuals were used in each treatment group. Total RNA was extracted from the mantle at the 7th day after the first injection to detect the expression of relative genes.
3.1. Cloning and sequence analysis of Tyr cDNA in P. penguin Based on the part Tyr cDNA sequence from transcriptome database of P. penguin, the complete cDNA sequence of Tyr gene from P. penguin (Genbank accession no. KY799107) was cloned using RACE-PCR and named as PpTyr. The PpTyr cDNA, with a full length of 1728 bp, contained a 1422-bp open reading frame (12–1433), an 11-bp 5′-untranslated region (UTR), a 295-bp 3’-UTR with a typical polyadenylation signal sequence (AATAAA) and a 30 bp poly (A) tail (Fig. 1). The deduced amino acid sequence was 473 amino acids long, and contained an 18-residue signal peptide with a predicted cleavage site located between residues 18 and 19. The deduced molecular mass of PpTyr protein was 52.8 kDa with a theoretical pI of 6.23.
2.6. Isolation of total melanin
3.2. Multiple sequence alignment
The total melanin was isolated from mantle of P. penguin following a reported procedure (Panzella et al., 2006) with some modifications. Briefly, 1 g samples from mantle was finely homogenized in 1 mL phosphate buffer (pH 7.4) and incubated in 15 mL phosphate buffer with 2% (m/V) papain at 55 °C for 20 h. The mixture was centrifuged at 10000g/min for 10 min at room temperature. The precipitate was successively washed with 2 mL mineral ether, ethanol and water. The resulted black precipitate, as raw melanin, was dried and measured.
Amino acid sequence alignments of Tyr gene from P. penguin and other bivalves were performed. The PpTyr shared the highest (50%) identity with tyrosinase-like protein 1 of Pinctada fucata, 46% with tyrosinase 1 of Pinctada margaritifera, 45% with tyrosinase B2 of Pinctada maxima, and 36% with tyrosinase-like protein 1 of Mytilus coruscus. The sequence comparison revealed a conserved copperbinding domain (Cu(A)/Cu(B)), in which six histidine residues were highly conserved (Fig. 1 and Fig. 2A). As previous reports (Aguilera et al., 2013; Chen and Chan, 2012), the PpTyr gene owned an Nterminal signal peptide in addition to a conserved CuA/CuB domain, no cysteine-rich region and C-terminal transmembrane domain, and was classified to α-subclass of type-3 copper proteins (Fig. 2B).
2.7. LC-MS/MS assay of melanin component The content and component of melanin were analyzed using methods previously described by Ito and Wakamatsu (1998) with some modification. Briefly, a solution of 10 mg of melanin in 8.6 mL of 1 mol/ L K2CO3 was oxidized with 0.8 mL of 30% H2O2 by heating under reflux at 100 °C for 20 min. After cooling, 0.4 mL of 10% Na2SO3 was added to end the reaction. The mixture was acidified to pH 1.0 with 5 mL of 6 mol/L HCl and extracted twice with 70 mL of ether. The ether extract was dried in vacuo. The crystalline residue was redissolved by mobile phase and filtered by 0.45 μm organic membrane for HPLC analysis. The oxidation products were analyzed with liquid chromatographtandem mass spectrometer (LC-MS/MS). The chromatographic separation was performed using an Acquity ultraperformance liquid chromatography (UPLC) system consisting of a Waters ACQUITY UPLC HSS T3 (2.1 × 50 mm, 1.7 μm particle size). The mobile phase A was 0.1% (v/v) of formic acid in deionized water and 0.1%(v/v)of formic acid in methanol, respectively. The ratio of
3.3. Phylogenetic analyses The phylogenetic tree analysis was performed to indicate the evolutionary relationships of tyrosinases from different species. As shown in Fig. 2C, PpTyr was close to tyrosinase-like protein of Pinctada fucata and tyrosinase 1 of Pinctada margaritifera with a support of 99%. All tyrosinases of bivalves referred, including Pteria penguin, were grouped into a close cluster, named as α-subclass. The tyrosinases from Homo sapiens, Mus musculus, Xenopus laevis and Suberites domuncula were classified to a clade, γ-subclass. The α-subclass and γ-subclass were split from a same node, suggesting that they had a common ancestor. Similar to phylogenetic tree analysis, there was higher identity between αsubclass and γ-subclass based on alignment of the Cu(A)/Cu(B) domain (data not shown). The tyrosinases from Drosophila melanogaster and 3
Gene 656 (2018) 1–8
F. Yu et al.
80 23 161 50 242 77 323 104 404 131 485 158 566 185 647 212 728 239 809 266 890 293 971 320 1052 347 1133 374 1214 401 1295 428 1376 455 1456 474 1537 1618 1699 1728 Fig. 1. Nucleotide and deduced amino acid sequences of PpTyr. Two copper-binding domains (CuA/CuB) were grey, six highly conserved histidine residues inside them were circled. The initiation codon (ATG) and the stop codon (TAA) were boxed. The putative amino acid sequence of signal peptide was bold. The putative polyadenylation signal (aataaa) was underlined.
Amphimedon queenslandica belonged to another clade, β-subclass, which exhibited farther distances to α-subclass and γ-subclass tyrosinases.
profile of PpTyr with 18SrRNA as an internal control. As shown in Fig. 3, the PpTyr was constitutively expressed in all examined tissues, including mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. The expression level of PpTyr in mantle, which was responsible for nacre secretion, was significantly higher than that in other tissues (P < 0.05). The result suggested that PpTyr gene might
3.4. PpTyr mRNA expression profile in different tissues The qRT-PCR was employed to determine the tissue expression 4
Gene 656 (2018) 1–8
F. Yu et al.
PmarTyr1
A PfTyr-like1 PpTyr
McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2
PmarTyr1 PfTyr-like1 PpTyr McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2 PmarTyr1 PfTyr-like1 PpTyr McTyr-like1 MyTyr HcTyr CgTyr-like PmaxTyr B2
B
C
Fig. 2. Sequence alignment and phylogenetic analysis. (A) Multiple sequence comparison of Tyr copper-binding domain among bivalves including Pteria penguin (PpTyr, KY799107), Pinctada margaritifera (PmarTyr1, H2A0L0.1), Pinctada maxima (PmaxTyrB2, AHZ34292.1), Pinctada fucata (PfTyr-like1, BAF42771.1), Mytilus coruscus (McTyr-like1, AKI87982.1), Mizuhopecten yessoensis (MyTyr, AKE79095.1), Hyriopsis cumingii (HcTyr, APC92581.1) and Crassostrea gigas (CgTyr, XP_011422333.1). The conserved amino acids were written in black background, and similar amino acids were shaded in green and pink. The highly conserved histidine residues were signed with *. (B) A scheme depicting the structure of TYR protein in P. penguin, compared with γ-subclass and β-subclass protein. A signal peptide (SP) was shown in orange box. The Cu(A)/Cu(B) domain with six conserved histidine residues was shown in blue box. The cysteine-rich region (CYS) and transmembrane domain (TM) were shown in green box. (C) Phylogenetic tree of tyrosinase genes. Xenopus laevis (XlTyr, XP_018124324.1), Homo sapiens (HsTyr, AAB60319.1), Mus musculus (MmTyr, NP_035791.1), Suberites domuncula (SdTyr-like, CAE01389.1), Drosophila melanogaster (DmTyr, Q9W1V6.1) and Amphimedon queenslandica (AqTyr, XP_019858846.1). Numbers in the branches represented the bootstrap values (as a percentage). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
5
Gene 656 (2018) 1–8
F. Yu et al.
the content and composition of melanin in mantle from each group after RNA interference using LC-MS/MS. The most sensitive and specific MS/MS transitions for PDCA and PTCA, the alkaline hydrogen peroxide oxidation product of eumelanin, were obtained by examining their product ion spectra. The mass-to-charge ratio value of PDCA was 156, and that of PTCA was 199, consistent with their molecular weight (Fig. 5A and B). The quantity of PDCA and PTCA was calculated according to the special area of peak, which appeared at 2.97 min and 4.15 min, respectively. As shown in Fig. 5C and D, the total amount of PDCA and PTCA was sharply decreased by 66.6% in Tyr-siRNA2 group compared with the negative control groups (P < 0.05). The content of PDCA was inhibited by 75.7% and PTCA was inhibited by 64.4%. The percentage of PDCA in total oxidation products was obviously decreased from 20.1% to 13.9%.
4. Discussion The copper-binding proteins, which could obtain copper ions to achieve their active form, were divided into three groups based on their geometric structure of the active site: type-1, type-2 and type-3 (Aguilera et al., 2013; Chen and Chan, 2012). All type-3 copper proteins possessed a conserved pair of copper-binding sites, called as Cu(A)/Cu (B), and could be further classified into three subclasses based on the possession of other domain or motifs in addition to the Cu(A)/Cu(B) (Decker et al., 2007). The α-subclass had a signal peptide in N-terminal. The β-subclass lacked other domain except copper-binding domain. The γ-subclass possessed an N-terminal signal peptide, a cysteine-rich region and a transmembrane domain at C-terminal end (Chen and Chan, 2012; Lim et al., 2009). According to the classification above, this tyrosinase from P. penguin belonged to type-3 copper protein superfamily because of the existence of Cu(A)/Cu(B) domain, and was further classified to α-subclass due to the presence of an N-terminal signal peptide and the absence of cysteine-rich region and transmembrane domain at C-terminal end. As reported, tyrosinase participated in various physiological processes, including pigment synthesis, wound healing, oxygen transport, innate immunity and insect cuticle sclerotization (Cerenius et al., 2008; Andersen, 2010). That might explain why there was a constitutively expression of PpTyr in all examined tissues, such as mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. Most physiological processes above, especially pigment synthesis and immunity response, mainly happened in mantle (Lin et al., 2015). That might explain why there was the highest expression of PpTyr in mantle. Melanin synthesis is an enzymatic process that converts tyrosine to melanin pigment. > 40 relative genes form a complex network to regulate the melanin synthesis in mammals (Busca and Ballotti, 2000). Tyrosinase catalyzes two initial reactions and is the key rate-limiting enzyme. There are other transcription factors involved in regulation in the network, such as CREB and PAX3. They work, in single factor or complex of factors, to directly activate the MITF and indirectly regulate the expression of tyrosinase (Tyr), dopachrome tautomerase (Dct), and
Fig. 3. Expression profile of PpTyr in various tissues of P. penguin. The qRT-PCR was done with RNA samples from mantle, gill, adductor muscle, digestive diverticulum, foot, testis and ovary. The 18SrRNA gene of P. penguin was used as an internal control. Each bar was a mean of 5 pearl oysters. Significant difference (P < 0.05) was indicated by different letters through one-way ANOVA and Duncan's multiple comparisons. Bars sharing the same letter are not significantly different (P > 0.05). The bar represented standard deviation.
participate in nacre formation of P. penguin. 3.5. RNAi-mediated Tyr knockdown in P. penguin To investigate the function of Tyr in melanin synthesis of P. penguin, RNAi was performed to inhibit the expression of PpTyr. To evaluate the silencing effects of RNAi, the qRT-PCR was employed to detect the PpTyr expression at 7th day after the first siRNA injection. As shown in Fig. 4A, the PpTyr expression was reduced by 59.1% in the Tyr-siRNA1 group (P < 0.05) and 71.0% in the Tyr-siRNA2 group (P < 0.05) compared with the negative control group. 3.6. Effects of PpTyr silencing on the expression of Creb2, Pax3 and Bcl2 in P. penguin After RNAi, the transcripts of PpCreb2, PpPax3 and PpBcl2 genes were analyzed. As shown in Fig. 4B, the transcript of PpBcl2 gene, an apoptosis-related gene, was highly raised > 2.5 fold (P < 0.05). No significant difference in expression level of PpCreb2 and PpPax3, known as regulatory factors in melanin synthesis, was observed after PpTyr knockdown (P > 0.05). 3.7. Changes of melanin quantity and component after RNA interference To further investigate the function of TYR in P. penguin, we detected
Fig. 4. Expression of PpTyr, PpCreb2, PpPax3 and PpBcl2 after RNAi. (A) Expression of PpTyr. (B) Expression of PpCreb2, PpPax3 and PpBcl2. The qRTPCR was done with RNA samples from blank group (RNase-free water), negative control group (GFPsiRNA) and two RNAi groups (Tyr-siRNA1 and TyrsiRNA2) at the seventh days after first injection. The 18SrRNA of P. penguin was used as an internal control. Each bar was a mean of 5 individuals. Significant difference was indicated by different letters (P < 0.05) through one-way ANOVA and Duncan's multiple comparisons. Bars sharing the same letter are not significantly different (P > 0.05). The bar represented standard deviation. The comparisons were just taken among different groups of each gene.
6
Gene 656 (2018) 1–8
F. Yu et al.
A
B
Fig. 5. LC-MS/MS analysis of oxidation products of melanin in P. penguin. (A) The negative ion product spectra of PDCA at m/z 156 (B) The negative ion product spectra of PTCA at m/z 199 (C) HPLC chromatograms of oxidation products of melanin from negative group and Tyr-siRNA2 group. (D) The quantity of PDCA and PTCA in negative group and Tyr-siRNA2 group. Bars sharing the same letter are not significantly different (P > 0.05).
ion transitions could be established by mass spectrometer (Simon et al., 2009). In this study, the total content of eumelanin was significantly decreased by PpTyr silencing, which indicated that tyrosinase was a determinant of melanin synthesis in P. penguin, consistent with mammals. The melanin production mainly depended on the expression and activation of tyrosinase. After PpTyr RNA interfering, there was more obvious decrease in the percentage of PDCA (from 20.1% to 13.9%), which indicated that tyrosinase silencing showed more inhibition effect on degradation of DHI to PDCA, compared to DHICA to PTCA, in eumelanin synthesis process of P. penguin.
tyrosinase-related protein 1 (Tyrp1) (Busca and Ballotti, 2000). Both Creb and Pax3 were upstream genes of Mitf, and no feedback regulation among them was found. In this report, we analyzed the influence of tyrosinase knockdown on expression of relative genes in P. penguin. There was no significant difference in PpCreb2 and PpPax3 mRNA after PpTyr knockdown, suggesting that Creb2 and Pax3 might function upstream of Tyr in P. penguin, similar to that in mammal (Lang et al., 2005). Moreover, the compensatory expression of Creb2 and Pax3 by tyrosinase silencing might not exist, and no obvious feedback regulation of Tyr to Creb2 and Pax3 was found in melanin synthesis pathway of P. penguin. The Bcl2 is a cell apoptosis related gene and takes part in the control of cell survival (Seiberg, 2013). In this study, the tyrosinase silencing led to an obvious increase in PpBcl2 expression. A possible explanation was that the inhibition of melanin synthesis by Tyr silencing affected the normal cell survival in P. penguin, since melanin was an important product in protection cells against noxious DNA damage. Another explanation was that the decrease of tyrosinase protein affected the normal cell survival, because tyrosinase involved in pigment synthesis (Hofreiter and Schoneberg, 2010), wound healing (Aguilera et al., 2013) and innate immunity (Cerenius et al., 2008), all of which were important physiological processes in organism. The third explanation was that the decrease of Tyr mRNA saved more MITF to combine with Bcl2, enhanced the expression of Bcl2 and controlled the cell survival, because Bcl2 was also a direct MITF target gene (McGill et al., 2002), as same as Tyr (Lang et al., 2005). We thought the third point might be the dominant reason to explain the increase of PpBcl2 expression. LC-MS/MS was employed to detect the content and composition of eumelanin, which was considered to be the main pigment in P. penguin with black shell. DHI and DHICA were main components of eumelanin and could be oxidized to PDCA and PTCA, whose precursor-to-product
5. Conclusions In conclusion, we obtained a new tyrosinase gene from Pteria penguin, and classified it into α-subclass of type-3 copper protein. Tissue expression analysis showed that PpTyr was highly expressed in mantle, a nacre formation related tissue. The PpTyr silencing significantly inhibited PpTyr expression, increased PpBcl2 expression, but had no effect on PpCreb2 and PpPax3 expression. Furthermore, by liquid chromatograph-tandem mass spectrometer (LC-MS/MS) analysis, the PpTyr silencing sharply decreased the total content of PDCA and PTCA, two main markers for eumelanin. The percentage of PDCA was also obviously decreased. Thus, we believed tyrosinase played a key role in melanin synthesis and color formation of P. penguin. Funding This work was supported by the Guangdong Provincial Science and Technology Program (2016A020210115); Guangdong Marine Fishery Development Foundation (B201601-Z08); Guangdong Major Project of Innovation School (GDOU2016050248); Outstanding Young Teacher 7
Gene 656 (2018) 1–8
F. Yu et al.
Foundation of Guangdong Ocean University (2014004) and Doctoral Scientific Research Foundation of Guangdong Ocean University (E15041).
1111/j.1600-0749.1998.tb00721.x. Ito, S., Nakanishi, Y., Valenzuela, R.K., Brilliant, M.H., Kolbe, L., Wakamatsu, K., 2011. Usefulness of alkaline hydrogen peroxide oxidation to analyze eumelanin and pheomelanin in various tissue samples: application to chemical analysis of human hair melanins. Pigment Cell Melanoma Res. 24, 605–613. http://dx.doi.org/10. 1111/j.1755-148X.2011.00864.x. Ito, S., Wakamatsu, K., Glass, K., Simon, J.D., 2013. High-performance liquid chromatography estimation of cross-linking of dihydroxyindole moiety in eumelanin. Anal. Biochem. 434, 221–225. http://dx.doi.org/10.1016/j.ab.2012.12.005. Kunwar, A., Adhikary, B., Jayakumar, S., Barik, A., Chattopadhyay, S., Raghukumar, S., Priyadarsini, K.I., 2012. Melanin, a promising radioprotector: mechanisms of actions in a mice model. Toxicol. Appl. Pharmacol. 264, 202–211. http://dx.doi.org/10. 1016/j.taap.2012.08.002. Lang, D., Lu, M.M., Huang, L., Engleka, K.A., Zhang, M., Chu, E.Y., Lipner, S., Skoultchi, A., Millar, S.E., Epstein, J.A., 2005. Pax3 functions at a nodal point in melanocyte stem cell differentiation. Nature 433, 884–887. http://dx.doi.org/10.1038/ nature03292. Lim, Y.J., Lee, E.H., Kang, T.H., Ha, S.K., Oh, M.S., Kim, S.M., Yoon, T.J., Kang, C., Park, J.H., Kim, S.Y., 2009. Inhibitory effects of arbutin on melanin biosynthesis of alphamelanocyte stimulating hormone-induced hyperpigmentation in cultured brownish guinea pig skin tissues. Arch. Pharm. Res. 32, 367–373. http://dx.doi.org/10.1007/ s12272-009-1309-8. Lin, C.C., Yang, C.H., Lin, Y.J., Chiu, Y.W., Chen, C.Y., 2015. Establishment of a melanogenesis regulation assay system using a fluorescent protein reporter combined with the promoters for the melanogenesis-related genes in human melanoma cells. Enzym. Microb. Technol. 68, 1–9. http://dx.doi.org/10.1016/j.enzmictec. 2014.09.008. McGill, G.G., Horstmann, M., Widlund, H.R., Du, J., Motyckova, G., Nishimura, E.K., Lin, Y.L., Ramaswamy, S., Avery, W., Ding, H.F., Jordan, S.A., Jackson, I.J., Korsmeyer, S.J., Golub, T.R., Fisher, D.E., 2002. Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell 109, 707–718. http://dx.doi.org/10.1016/S0092-8674(02)00762-6. Nagai, K., Yano, M., Morimoto, K., Miyamoto, H., 2007. Tyrosinase localization in mollusc shells. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 146, 207–214. http://dx. doi.org/10.1016/j.cbpb.2006.10.105. Panzella, L., Manini, P., Monfrecola, G., d'Ischia, M., Napolitano, A., 2006. An easy-to-run method for routine analysis of eumelanin and pheomelanin in pigmented tissues. Pigment Cell Res. 20, 128–133. http://dx.doi.org/10.1111/j.1600-0749.2006. 00359.x. Rzepka, Z., Buszman, E., Beberok, A., Wrzesniok, D., 2016. From tyrosine to melanin: signaling pathways and factors regulating melanogenesis. Postepy Hig. Med. Dosw. 70, 695–708. http://dx.doi.org/10.5604/17322693.1208033. Seiberg, M., 2013. Age-induced hair graying-the multiple effects of oxidative stress. Int. J. Cosmet. Sci. 35, 532–538. http://dx.doi.org/10.1111/ics.12090. Simon, J.D., Peles, D., Wakamatsu, K., Ito, S., 2009. Current challenges in understanding melanogenesis: bridging chemistry, biological control, morphology, and function. Pigment Cell Melanoma Res. 22, 563–579. http://dx.doi.org/10.1111/j.1755-148X. 2009.00610.x. Suzuki, M., Saruwatari, K., Kogure, T., Yamamoto, Y., Nishimura, T., Kato, T., Nagasawa, H., 2009. An acidic matrix protein, pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. http://dx.doi.org/10.1126/science.1173793. Szekely-Klepser, G., Wade, K., Wooolson, D., Brown, R., Fountain, S., Kindt, E., 2005. A validated LC/MS/MS method for the quantification of pyrrole-2,3,5-tricarboxylic acid (PTCA), a eumelanin specific biomarker, in human skin punch biopsies. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 826, 31–40. http://dx.doi.org/10. 1016/j. jchromb.2005.08.002. Takgi, R., Miyashita, T., 2014. A cDNA cloning of a novel alpha-class tyrosinase of Pinctada fucata: its expression analysis and characterization of the expressed protein. Enzym. Res. 780549, 1–9. http://dx.doi.org/10.1155/2014/780549. Yan, F., Luo, S.J., Jiao, Y., Deng, Y.W., Du, X.D., Huang, R.L., Wang, Q.H., Chen, W.Y., 2014. Molecular characterization of the BMP7 gene and its potential role in shell formation in Pinctada martensii. Int. J. Mol. Sci. 15, 21215–21228. http://dx.doi.org/ 10.3390/ijms151121215. Yu, F.F., Song, N.N., Wang, M.F., Qu, B.L., Yu, X.Y., 2016. The effects of arbutin and valproic acid shell color in Pteria penguin. Genom. Appl. Biol. 35, 1–6. http://dx.doi. org/10.13417/j.gab.035.00168.
Author contributions Feifei Yu and Bingliang Qu conceived and designed the experiments; Feifei Yu, Zhenni Pan and Kaihang Xu performed the experiments; Xiangyong Yu and Bingliang Qu analyzed the data; Yuewen Deng and Feilong Liang contributed materials; Feifei Yu drafted the manuscript; Bingliang Qu made a critical revision of the manuscript. Conflicts of interest The authors declare no conflict of interest. References Aguilera, F., McDougall, C., Degnan, B.M., 2013. Origin, evolution and classification of type-3 copper proteins: lineage-specific gene expansions and losses across the Metazoa. BMC Evol. Biol. 96, 1–12. http://dx.doi.org/10.1186/1471-2148-13-96. Andersen, S.O., 2010. Insect cuticular sclerotization: a review. Insect Biochem. Mol. Biol. 40, 166–178. http://dx.doi.org/10.1016/j.ibmb.2009.10.007. Bennett, D.C., Lamoreux, M.L., 2003. The color loci of mice-a genetic century. Pigment Cell Res. 16, 333–344. http://dx.doi.org/10.1034/j.1600-0749.2003.00067.x. Busca, R., Ballotti, R., 2000. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 13, 60–69. http://dx.doi.org/10.1034/j.1600-0749. 2000.130203.x. Cerenius, L., Lee, B.L., Söderhäll, K., 2008. The proPO-system: pros and cons for its role in invertebrate immunity. Trends Immunol. 29, 263–271. http://dx.doi.org/10.1016/j. it.2008.02.009. Cheli, Y., Ohanna, M., Ballotti, R., Bertolotto, C., 2009. Fifteen-year quest for microphthalmia-associated transcription factor target genes. Pigment Cell Melanoma Res. 23, 27–40. http://dx.doi.org/10.1111/j.1755-148X.2009.00653.x. Chen, D.S., Chan, K.M., 2012. Identification of hepatic copper-binding proteins from tilapia by column chromatography with proteomic approaches. Metallomics 4, 820–834. http://dx.doi.org/10.1039/c2mt20057k. Chen, X., Liu, X., Bai, Z., Zhao, L., Li, J., 2017. HcTyr and HcTyp-1 of Hyriopsis cumingii, novel tyrosinase and tyrosinase-related protein genes involved in nacre color formation. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 204, 1–8. http://dx.doi.org/ 10.1016/j.cbpb.2016.11.005. Cieslak, M., Reissmann, M., Hofreiter, M., Ludwig, A., 2011. Colours of domestication. Biol. Rev. Camb. Philos. Soc. 86, 885–899. http://dx.doi.org/10.1111/j.1469-185X. 2011.00177.x. Decker, H., Schweikardt, T., Nillius, D., Salzbrunn, U., Jaenicke, E., Tuczek, F., 2007. Similar enzyme activation and catalysis in hemocyanins and tyrosinases. Gene 398, 183–191. http://dx.doi.org/10.1016/j.gene.2007.02.051. Feng, D., Li, Q., Yu, H., Zhao, X., Kong, L., 2015. Comparative transcriptome analysis of the Pacific oyster Crassostrea gigas characterized by shell colors: identification of genetic bases potentially involved in pigmentation. PLoS One 10, e0145257. http:// dx.doi.org/10.1371/journal.pone.0145257. Hofreiter, M., Schoneberg, T., 2010. The genetic and evolutionary basis of colour variation in vertebrates. Cell. Mol. Life Sci. 67, 2591–2603. http://dx.doi.org/10.1007/ s00018-010-0333-7. Inoue, Y., Hasegawa, S., Yamada, T., Date, Y., Mizutani, H., Nakata, S., Matsunaga, K., Akamatsu, H., 2013. Analysis of the effects of hydroquinone and arbutin on the differentiation of melanocytes. Biol. Pharm. Bull. 36, 1722–1730. http://dx.doi.org/ 10.1248/bpb.b13-00206. Ito, S., Wakamatsu, K., 1998. Chemical degradation of melanins: application to identification of dopamine-melanin. Pigment Cell Res. 11, 120–126. http://dx.doi.org/10.
8