- Email: [email protected]
Identification of amyloid-beta 1–42 binding protein fragments by screening of a human brain cDNA library
Neuroscience Letters 397 (2006) 79–82
Identification of amyloid-beta 1–42 binding protein fragments by screening of a human brain cDNA library Maria Elena Munguia, Tzipe Govezensky, Rodrigo Martinez, Karen Manoutcharian, Goar Gevorkian ∗ Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (UNAM), Apartado Postal 70228, Cuidad Universitaria, Mexico DF, CP 04510, Mexico Received 6 September 2005; received in revised form 11 November 2005; accepted 30 November 2005
Abstract Extracellular and intraneuronal formation of amyloid-beta (A) deposits have been demonstrated to be involved in the pathogenesis of Alzheimer’s disease (AD). However, the precise mechanism of A neurotoxicity is not completely understood. Previous studies suggest that binding of A with a number of targets have deleterious effects on cellular functions. It has been shown that A directly interacted with intracellular protein ERAB (endoplasmic reticulum amyloid -peptide-binding protein) also known as ABAD (A-binding alcohol dehydrogenase) resulting in mitochondrial dysfunction and cell death. In the present study we have identified another mitochondrial enzyme, ND3 of the human complex I, that binds to A1–42 by the screening of a human brain cDNA library expressed on M13 phage. Our results indicated a strong interaction between A and a phage-displayed 25 amino acid long peptide TTNLPLMVMSSLLLIIILALSLAYE corresponding to C-terminal peptide domain of NADH dehydrogenase, subunit 3 (MTND3) encoded by mitochondrial DNA (mtDNA). This interaction may explain, in part, the inhibition of complex I activity in astrocytes and neurons in the presence of A, described recently. To our knowledge, the present study is the first demonstration of interaction between A and one of the subunits of the human complex I. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Amyloid-beta peptide; Phage displayed cDNA library; Mitochondrial dysfunction; Human complex I
The accumulation of amyloid-beta (A) peptide in the brain and its deposition as plaques have been hypothesized to play a central role in the neuropathology of Alzheimer’s disease (AD). It has been shown that extracellular and intraneuronal formation of A deposits are involved in the pathogenesis of AD [1,3,10,11,16,19,23,25–27]. It has been reported that amyloid plaques are not the only toxic specie formed by A peptide and that soluble amyloid oligomeric pre-fibrillar assemblies are neurotoxic too [8,15,30]. However, the precise mechanism of A neurotoxicity is not completely understood. Previous studies showed that extracellular A interacts with a number of cell surface proteins and induces cell death as a result of an increased production of hydrogen peroxide and formation of toxic free radicals [2,9,13,17,35], inhibition of acetylcholine release and calcium flux [32] as well as pathological activation of signal transduction pathways like tau phosphorylation with subsequent
∗
Corresponding author. Tel.: +5255 56223151; fax: +5255 56223369. E-mail address: [email protected] (G. Gevorkian).
0304-3940/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2005.11.061
neurofibrillary tangle formation [4] and increased tyrosine phosphorylation of focal adhesion kinase (FAK) [36]. Also, intraneuronal accumulation of A1–42 has been studied extensively and mitochondria are suggested to play an important role in the mechanism by which intracellular A triggers neuronal dysfunction and degeneration [1,3,5,6,10,12,18,28,33,34]. Thus, it has been shown that A interacts with intracellular protein ERAB (endoplasmic reticulum amyloid -peptide-binding protein) proved to be an L3-hydroxyacyl-CoA dehydrogenase type II (NADH2) [12,33]. The precise mechanism by which the ERAB-A1–42 interaction induces neuronal damage is not completely understood. Recently, it has been shown that ERAB also known as ABAD (A-binding alcohol dehydrogenase) directly interacts with A in mitochondria in AD patients and in APP-transgenic mice [18,28,34]. Authors have proposed that this interaction may promote mitochondrial dysfunction and cell death and have suggested that inhibition of ABAD-A interaction may provide a new treatment strategy against AD [18,28,34]. Other examples of intracellular interactions of A are the inhibition of
80
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
cytochrome oxidase, ␣-ketoglutarate dehydrogenase and pyruvate dehydrogenase activities in isolated brain mitochondria and in purified form, suggesting that A can directly disrupt mitochondrial function [5,6]. In the present study we report the identification of another mitochondrial enzyme, ND3 of the human complex I, that binds to A1–42, by the screening of a human brain cDNA library expressed on M13 phage. All molecular biology procedures were carried out using standard protocols [24] or as recommended by manufacturers. Restriction enzymes, DNA isolation/purification kits, DNA polymerase, T4 DNA ligase and helper phage were obtained from Invitrogen, AmershamPharmaciaBiotech or Gibco BRL (USA). The oligonucleotides were synthesized at GibcoBRL. Initially, we have constructed a human brain cDNA library displayed on M13 phage. As a source of cDNA, a T7 Select Human Alzheimer’s Brain cDNA library (Novagen, Germany) was used. The T7 bacteriophages from this library were used as a template in a PCR with T7Select10-3b vector-based primers 5T7:TCATATGCTCCATGGATGCTCGGGGATCCGAATTC and 3T7:AATCTTAGTCTTACGTATTACTCGAGTGCGGCCGCAAGCTT carrying Nco I and SnaB I restriction enzymes recognition sites (underlined), respectively, to obtain cDNA inserts. About 3 g of PCR products were purified by Concert Rapid PCR purification System, digested with Nco I and SnaB I, column purified and ligated with about 1 g of similarly digested pG8SAET vector DNA (kindly provided by Dr. L. Frykberg [14]). The ligated DNA was column purified and introduced into Escerichia coli TG1 cells by electroporation using Gene Pulser II System (Bio-Rad Laboratories Inc., USA). Ten electroporations were performed, and the transformed TG1 cells were plated on LB-Amp plates to determine the diversity of the library. The diversity of the library was 2 × 105 . The resultant phagemid library was rescued/amplified using M13KO7 helper phage, purified by double PEG/NaCl (20% (w/v) polyethylene glycol-8000; 2.5 M NaCl) precipitation and resuspended in Tris-buffered saline (TBS). The typical phage yields were 1010 –1011 colony-forming units (cfu) per milliliter of culture medium. Ten randomly selected Amp-resistant colonies were analyzed by PCR. The presence of cDNA inserts ranging in size from 100 to 600 base pairs (bp) in nine clones was confirmed by agarose gel analysis of PCR products (Fig. 1). To identify peptides/proteins that bind to A1–42, a biopanning using the constructed phage-displayed library was carried out essentially as described previously [20,21]. Briefly, the wells of Nunc Maxisorp microtiter plates (Nunc, Denmark) were coated overnight with 2 g/ml of A1–42, washed with PBS/Tween 0.05% and blocked with PBS/BSA 2%. Then, 1011 phage particles from a cDNA phage library were added to each well. After incubation for 4 h at 4 ◦ C, the plate was washed with cold PBS-Tween and bound phage particles were eluted using glycine–HCl (0.2 M, pH 2.2) and neutralized by adding Tris–HCl (1 M, pH 9.1). The eluted phages were plated on LB-Amp plates, and individual colonies from the third round of panning were rescued/amplified using M13KO7 helper phage and used in ELISA screening as described [20]. This screening resulted in isolation of seven phage clones recogniz-
Fig. 1. PCR analysis of the DNA fragments obtained from 10 phage clones (lane 1–10). DNA was PCR amplified and separated on a 2% agarose gel. Bands were visualized by ethidium bromide staining and UV illumination. The 100 bp DNA ladder (Invitrogen) was used for DNA sizing.
ing A1–42. The PCR and agarose gel analysis showed that three most positive clones carried about 125 bp cDNA inserts. The DNA sequences of the inserts of these three clones were determined using automated ABI Prism 310 Genetic Analyzer (Applied Biosystems, USA), miniprep-purifed double-stranded DNA from phagemid clones and pG8SAET vector-based 5 and 3 primers. The DNA and deduced amino acid sequences were analyzed by computer search with ExPASy Molecular Biology server and BLAST database. The DNA sequencing and computer data base search revealed that all three clones contained identical cDNA inserts coding for 25 amino acid (aa) long peptide TTNLPLMVMSSLLLIIILALSLAYE corresponding to C-terminal peptide domain of NADH dehydrogenase, subunit 3 (MTND3) encoded by mitochondrial DNA (mtDNA). To analyze the binding of A1–42 to phage bearing a Cterminal peptide domain of Complex I ND3, an ELISA assay using amplified and purified phage clones was carried out as previously described [20,21]. Phage concentration used was 1011 per ml, and 100 l were added to each well of Nunc maxisorp microtiter plates. Plates were incubated overnight at 4 ◦ C, washed with PBS/Tween 0.05% and blocked with PBS/BSA 2%. Biotinylated A1–42 concentrations used ranged from 0.11 to 0.88 M. Biotinylated A1–42 was added to each well, and plates were incubated for 1 h at 37 ◦ C. After washing, an avidineperoxidase conjugate diluted 1:500 (Pharmingen, San Jose, CA, USA) was added followed by the ABTS single solution (Zymed). M13 phage was used as a negative control phage. OD readings at 405 nm were registered using Opsys MR Microplate Reader (DYNEX Technologies, USA). The dose dependent recognition of A1–42 by phage bearing a C-terminal peptide domain of MTND3 is shown in Fig. 2. In summary, in the present study we identified another mitochondrial enzyme that binds to A1–42, by the screening of a human brain cDNA library expressed on M13 phage. Our
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
81
strategies by interfering in interaction between A and ND3 of complex I. Acknowledgements This work was supported, in part by grant from NIH (AG 023534, National Institute of Aging) to G.G. Authors thank Gonzalo Acero for technical assistance. References
Fig. 2. Analysis of interaction of A1–42 with phage bearing a C-terminal peptide domain of Complex I ND3 by ELISA. Phage concentration used was 1011 per ml, and 100 l were added to each well. A1–42 concentrations used ranged from 0.11 to 0.88 M. M13 phage was used as a negative control phage. OD at 405 was registered. Data are means of two independent experiments.
results indicated a strong interaction between a mitochondrial enzyme of NADH-ubiquinone oxidoreductase chain 3 (ND3) and A. This interaction may explain, in part, the inhibition of complex I activity in astrocytes and neurons in the presence of A, described recently [1,7]. It has been shown previously that direct interaction of A with other enzymes in mitochondria (ABAD, cytochrome oxidase, pyruvate dehydrogenase and ␣-ketoglutarate) led to mitochondrial dysfunction [5,6]. To our knowledge, our study is the first demonstration of the interaction between A and one of the subunits of the human complex I. Complex I is the first and largest enzyme of the respiratory chain and is vital for cellular energy production. It consists of about 42 subunits, and seven of these subunits, ND3 among them, are encoded by the mitochondrial genome. Interestingly, our results demonstrate for the first time that A binds to a mitochondrial genome-encoded peptide/protein. There are almost no data in literature on the actual function of ND3 within complex I, except for few studies [22,29,31]. One of these studies reported a case of a patient with progressive neurological impairment as a result of a novel mutation, T10191C, leading to a substitution of a hydrophilic serine to a hydrophobic proline (S45P), which may affect the folding of the protein [29]. The second study suggests that the ND3 subunit plays an unknown but important role in electron transport, proton pumping, or ubiquinone binding, and that T10158C mutation in MTND3 gene is a cause of infantile mitochondrial encephalopathy and complex I deficiency [22]. Finally, the third study have demonstrated that a single-nucleotide polymorphism (SNP) 10398G causes a nonconservative amino acid change from threonine to alanine within ND3 (T114A) and is strongly associated with a significant decrease of the risk of Parkinson disease [31]. However, none of the mentioned mutations is within the peptide region identified in our study (aa 81–105). Although our findings do not give a final picture of the precise mechanism of mitochondrial dysfunction in AD, they do describe another pattern probably important in the pathology of AD and they do open a route for the discovery of new treatment
[1] A.M. Aleardi, G. Benard, O. Augereau, M. Malgat, J.C. Talbot, J.P. Mazat, T. Letellier, J. Dachary-Prigent, G.C. Solain, R. Rossignol, Gradual alteration of mitochondrial structure and function by -amyloids: importance of membrane viscosity changes, energy deprivation, reactive oxygen species production, and cytochrome c release, J. Bioenerg. Biomembr. 37 (2005) 207–225. [2] C. Behl, J.B. Davis, R. Lesley, D. Schubert, Hydrogen peroxide mediates amyloid beta protein toxicity, Cell 77 (1994) 817–827. [3] L.M. Billings, S. Oddo, K.N. Green, J.L. McGaugh, F.M. LaFerla, Intraneuronal A causes the onset of early Alzheimer’s diseaserelated cognitive deficits in transgenic mice, Neuron 45 (2005) 675– 688. [4] J. Busciglio, A. Lorenzo, J. Yeh, B.A. Yankner, Beta-amyloid fibrils induce tau phosphorylation and loss of microtubule binding, Neuron 14 (1995) 879–888. [5] L. Canevari, A.Y. Abramov, M.R. Duchen, Toxicity of amyloid  peptide: tales of calcium, mitochondria, and oxidative stress, Neurochem. Res. 29 (2004) 637–650. [6] C.S. Casley, L. Canevari, J.M. Land, J.B. Clark, M.A. Sharpe, Amyloid inhibits integrated mitochondrial respiration and key enzyme activities, J. Neurochem. 80 (2002) 91–100. [7] C.S. Casley, J.M. Land, M.A. Sharpe, J.B. Clark, M.R. Duchen, L. Canevari, -Amyloid fragment 25–35 causes mitochondrial dysfunction in primary cortical neurons, Neurobiol. Dis. 10 (2002) 258– 267. [8] B.A. Chromy, R.J. Nowak, M.P. Lambert, K.L. Viola, L. Chang, P.T. Velasko, B.W. Jones, S.J. Fernandez, P.N. Lacor, P. Horowitz, C.E. Finch, G.A. Krafft, W.L. Klein, Self-assembly of Abeta(1–42) into globular neurotoxins, Biochemistry 42 (2003) 12749–12760. [9] J. El Khoury, S.E. Hickmann, C.A. Thomas, J.D. Loike, S.C. Silverstein, Microglia, scavenger receptors, and the pathogenesis of Alzheimer’s disease, Neurobiol. Aging 19 (1998) S81–S84. [10] P. Fernandez-Vizarra, A.P. Fernandez, S. Castro-Blanco, J. Serrano, M.L. Bentura, R. Martinez-Murillo, A. Martinez, J. Rodrigo, Intra- and extracellular Abeta and PHF in clinically evaluated cases of Alzheimer’s disease, Histol. Histopathol. 19 (2004) 823–844. [11] G.K. Gouras, J. Tsai, J. Naslund, B. Vincent, M. Edgar, F. Checler, J.P. Greenfield, V. Haroutunian, J.D. Buxbaum, H. Xu, P. Greengard, N.R. Relkin, Intraneuronal A42 accumulation in numan brain, Am. J. Pathol. 156 (2000) 15–20. [12] X.Y. He, H. Schulz, S.Y. Yang, A human brain L-3-hydroxyacylcoenzyme A dehydrogenase is identical to an amyloid -peptide-binding protein involved in Alzheimer’s disease, J. Biol. Chem. 273 (1998) 10741–10746. [13] K. Hensley, J.M. Carney, M.P. Mattson, M. Aksenova, M. Harris, J.F. Wu, R.A. Floyd, D.A. Butterfield, A model for -amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease, Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 3270–3274. [14] K. Jacobsson, L. Frykberg, Shotgun phage display cloning, Comb. Chem. High Throughput Screen. 4 (2001) 135–143. [15] R. Kayed, E. Headd, J.L. Thompson, T.M. McIntire, S.C. Milton, C.W. Cotman, C.G. Glabe, Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis, Science 300 (2003) 486–488.
82
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
[16] P. Kuner, R. Schubenel, C. Hertel, -Amyloid binds to p75NTR and activates NFB in human neuroblastoma cells, J. Neurosci. Res. 54 (1998) 798–804. [17] L.F. Lue, D.G. Walker, L. Brachova, T.G. Beach, J. Rogers, A.M. Schmidt, D.M. Stern, S.D. Yan, Involvement of microglial receptor for advanced glycation endproducts (RAGE) in Alzheimer’s disease: identification of a cellular activation mechanism, Exp. Neurol. 171 (2001) 29–45. [18] J.W. Lustbader, M. Cirilli, C. Lin, H.W. Xu, K. Takuma, N. Wang, C. Caspersen, X. Chen, S. Pollak, M. Chaney, F. Trinchese, S. Liu, F. GunnMoore, L.F. Lue, D.G. Walker, P. Kuppusamy, Z.L. Zewier, O. Arancio, D. Stern, S.S. Yan, H. Wu, ABAD directly links A to mitochondrial toxicity in Alzheimer’s disease, Science 304 (2004) 448–452. [19] D.G. Lynn, S.C. Meredith, Review: model peptides and the physicochemical approach to -amyloids, J. Struct. Biol. 130 (2000) 153– 173. [20] K. Manoutcharian, G. Acero, M.E. Munguia, J.A. Montero, T. Govezensky, C. Cao, K. Ugen, G. Gevorkian, Amyloid-beta peptide specific single Ca´ın Fv antibodies isolated from an immune phage display library, J. Neuroimmunol. 145 (2003) 12–17. [21] K. Manoutcharian, J. Sotelo, E. Garcia, A. Cano, G. Gevorkian, Characterization of cerebrospinal fluid antibody specificities in neurocysicercosis using phage display peptide library, Clin. Immunol. 91 (1999) 117–121. [22] R. McFarland, D.M. Kirby, K.J. Fowler, A. Ohtake, M.T. Ryan, D.J. Amor, J.M. Fletcher, J.W. Dixon, F.A. Collins, D.M. Turnbull, R.W. Taylor, D.R. Thorburn, De novo mutations in the mitochondrial ND3 gene as a cause of infantile mitochondrial encephalopathy and complex I deficiency, Ann. Neurol. 55 (2003) 5–64. [23] S. Oddo, A. Caccamo, J.D. Shepherd, M.P. Murphy, T.E. Golde, R. Kayed, R. Metherate, M.P. Mattson, Y. Akbari, F.M. LaFerla, Tripletransgenic model of Alzheimer’s disease with plaques and tangles: intracellular Abeta and synaptic dysfunction, Neuron 39 (2003) 409– 421. [24] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [25] D.J. Selkoe, Alzheimer’s disease: a central role for amyloid, J. Neuropathol. Exp. Neurol. 53 (1994) 438–447. [26] D.J. Selkoe, Alzheimer’s disease: genes, proteins, and therapy, Physiol. Rev. 81 (2001) 741–766.
[27] R.H. Takahashi, T.A. Milner, F. Li, E.E. Nam, M.A. Edgar, H. Yamaguchi, M.F. Beal, H. Xu, P. Greengard, G.K. Gouras, Intraneuronal Alzheimer A42 accumulates in multivesicular bodies and is associated with synaptic pathology, Am. J. Pathol. 161 (2002) 1869–1879. [28] K. Takuma, J. Yao, J. Huang, H. Xu, X. Chen, J. Luddy, A.C. Trillat, D.M. Stern, O. Arancio, S.S. Yan, ABAD enhances Abeta-induced cell stress via mitochondrial dysfunction, FASEB J. 19 (2005) 597–598. [29] R.W. Taylor, R. Singh-Kler, C.M. Hayes, P.E.M. Smith, D.M. Turnbull, Progressive mitochondrial disease resulting from a novel missense mutation in the mitochondrial DNA ND3 gene, Ann. Neurol. 50 (2001) 104–107. [30] D.M. Walsh, I. Klyubin, J.M. Fadeeva, M.J. Rowan, D.J. Selkoe, Amyloid- oligomers: their production, toxicity and therapeutic inhibition, Biochem. Soc. Trans. 30 (2002) 552–557. [31] J.M. van der Walt, K.K. Nicodemus, E.R. Martin, W.K. Scott, M.A. Nance, R.L. Watts, J.P. Hubble, J.L. Haines, W.C. Koller, K. Lyons, R. Pahwa, M.B. Stern, A. Colcher, B.C. Hiner, J. Jankovic, W.G. Ondo, F.H. Allen Jr., C.G. Goetz, G.W. Small, F. Mastaglia, J.M. Stajich, A.C. McLaurin, L.T. Middleton, B.L. Scott, D.E. Schmechel, M.A. PericakVance, J.M. Vance, Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease, Am. J. Hum. Genet. 72 (2003) 804–811. [32] H.Y. Wang, D.H.S. Lee, M.R. D’Andrea, P.A. Peterson, R.P. Shank, -amyloid1–42 binds to ␣7 nicotinic acetylcholine receptor with high affinity, J. Biol. Chem. 275 (2000) 5626–5632. [33] S.D. Yan, J. Fu, C. Soto, X. Chen, H. Zhu, F. Al-Mohanna, K. Collison, A. Zhu, E. Stern, T. Saido, M. Tohyama, S. Ogawa, A. Roher, D. Stern, An intracellular protein that binds amyloid- peptide and mediates neurotoxicity in Alzheimer’s disease, Nature 389 (1997) 689–695. [34] S.D. Yan, D.M. Stern, Mitochondrial dysfunction and Alzheimer’s disease: role of amyloid-beta peptide alcohol dehydrogenase (ABAD), Int. J. Exp. Pathol. 86 (2005) 161–171. [35] S.D. Yan, H. Zhu, J. Fu, S.F. Yan, A. Roher, W.W. Tourtellotte, T. Rajavashisth, X. Chen, G.C. Godman, D. Astern, A.M. Schmidt, Amyloid- peptide-receptor for advanced glycation endproduct interaction elicits neuronal expression of macrophage-colony stimulating factor: a proinflammatory pathway in Alzheimer disease, Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 5296–5301. [36] C. Zhang, M.P. Lambert, C. Bunch, K. Barber, W.S. Wade, G.A. Krafft, W.L. Klein, Focal adhesion kinase expressed by nerve cell lines shows increased tyrosine phosporylation in response to Alzheimer’s A beta peptide, J. Biol. Chem. 269 (1994) 25247–25250.
Identification of amyloid-beta 1–42 binding protein fragments by screening of a human brain cDNA library Maria Elena Munguia, Tzipe Govezensky, Rodrigo Martinez, Karen Manoutcharian, Goar Gevorkian ∗ Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico (UNAM), Apartado Postal 70228, Cuidad Universitaria, Mexico DF, CP 04510, Mexico Received 6 September 2005; received in revised form 11 November 2005; accepted 30 November 2005
Abstract Extracellular and intraneuronal formation of amyloid-beta (A) deposits have been demonstrated to be involved in the pathogenesis of Alzheimer’s disease (AD). However, the precise mechanism of A neurotoxicity is not completely understood. Previous studies suggest that binding of A with a number of targets have deleterious effects on cellular functions. It has been shown that A directly interacted with intracellular protein ERAB (endoplasmic reticulum amyloid -peptide-binding protein) also known as ABAD (A-binding alcohol dehydrogenase) resulting in mitochondrial dysfunction and cell death. In the present study we have identified another mitochondrial enzyme, ND3 of the human complex I, that binds to A1–42 by the screening of a human brain cDNA library expressed on M13 phage. Our results indicated a strong interaction between A and a phage-displayed 25 amino acid long peptide TTNLPLMVMSSLLLIIILALSLAYE corresponding to C-terminal peptide domain of NADH dehydrogenase, subunit 3 (MTND3) encoded by mitochondrial DNA (mtDNA). This interaction may explain, in part, the inhibition of complex I activity in astrocytes and neurons in the presence of A, described recently. To our knowledge, the present study is the first demonstration of interaction between A and one of the subunits of the human complex I. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Amyloid-beta peptide; Phage displayed cDNA library; Mitochondrial dysfunction; Human complex I
The accumulation of amyloid-beta (A) peptide in the brain and its deposition as plaques have been hypothesized to play a central role in the neuropathology of Alzheimer’s disease (AD). It has been shown that extracellular and intraneuronal formation of A deposits are involved in the pathogenesis of AD [1,3,10,11,16,19,23,25–27]. It has been reported that amyloid plaques are not the only toxic specie formed by A peptide and that soluble amyloid oligomeric pre-fibrillar assemblies are neurotoxic too [8,15,30]. However, the precise mechanism of A neurotoxicity is not completely understood. Previous studies showed that extracellular A interacts with a number of cell surface proteins and induces cell death as a result of an increased production of hydrogen peroxide and formation of toxic free radicals [2,9,13,17,35], inhibition of acetylcholine release and calcium flux [32] as well as pathological activation of signal transduction pathways like tau phosphorylation with subsequent
∗
Corresponding author. Tel.: +5255 56223151; fax: +5255 56223369. E-mail address: [email protected] (G. Gevorkian).
0304-3940/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2005.11.061
neurofibrillary tangle formation [4] and increased tyrosine phosphorylation of focal adhesion kinase (FAK) [36]. Also, intraneuronal accumulation of A1–42 has been studied extensively and mitochondria are suggested to play an important role in the mechanism by which intracellular A triggers neuronal dysfunction and degeneration [1,3,5,6,10,12,18,28,33,34]. Thus, it has been shown that A interacts with intracellular protein ERAB (endoplasmic reticulum amyloid -peptide-binding protein) proved to be an L3-hydroxyacyl-CoA dehydrogenase type II (NADH2) [12,33]. The precise mechanism by which the ERAB-A1–42 interaction induces neuronal damage is not completely understood. Recently, it has been shown that ERAB also known as ABAD (A-binding alcohol dehydrogenase) directly interacts with A in mitochondria in AD patients and in APP-transgenic mice [18,28,34]. Authors have proposed that this interaction may promote mitochondrial dysfunction and cell death and have suggested that inhibition of ABAD-A interaction may provide a new treatment strategy against AD [18,28,34]. Other examples of intracellular interactions of A are the inhibition of
80
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
cytochrome oxidase, ␣-ketoglutarate dehydrogenase and pyruvate dehydrogenase activities in isolated brain mitochondria and in purified form, suggesting that A can directly disrupt mitochondrial function [5,6]. In the present study we report the identification of another mitochondrial enzyme, ND3 of the human complex I, that binds to A1–42, by the screening of a human brain cDNA library expressed on M13 phage. All molecular biology procedures were carried out using standard protocols [24] or as recommended by manufacturers. Restriction enzymes, DNA isolation/purification kits, DNA polymerase, T4 DNA ligase and helper phage were obtained from Invitrogen, AmershamPharmaciaBiotech or Gibco BRL (USA). The oligonucleotides were synthesized at GibcoBRL. Initially, we have constructed a human brain cDNA library displayed on M13 phage. As a source of cDNA, a T7 Select Human Alzheimer’s Brain cDNA library (Novagen, Germany) was used. The T7 bacteriophages from this library were used as a template in a PCR with T7Select10-3b vector-based primers 5T7:TCATATGCTCCATGGATGCTCGGGGATCCGAATTC and 3T7:AATCTTAGTCTTACGTATTACTCGAGTGCGGCCGCAAGCTT carrying Nco I and SnaB I restriction enzymes recognition sites (underlined), respectively, to obtain cDNA inserts. About 3 g of PCR products were purified by Concert Rapid PCR purification System, digested with Nco I and SnaB I, column purified and ligated with about 1 g of similarly digested pG8SAET vector DNA (kindly provided by Dr. L. Frykberg [14]). The ligated DNA was column purified and introduced into Escerichia coli TG1 cells by electroporation using Gene Pulser II System (Bio-Rad Laboratories Inc., USA). Ten electroporations were performed, and the transformed TG1 cells were plated on LB-Amp plates to determine the diversity of the library. The diversity of the library was 2 × 105 . The resultant phagemid library was rescued/amplified using M13KO7 helper phage, purified by double PEG/NaCl (20% (w/v) polyethylene glycol-8000; 2.5 M NaCl) precipitation and resuspended in Tris-buffered saline (TBS). The typical phage yields were 1010 –1011 colony-forming units (cfu) per milliliter of culture medium. Ten randomly selected Amp-resistant colonies were analyzed by PCR. The presence of cDNA inserts ranging in size from 100 to 600 base pairs (bp) in nine clones was confirmed by agarose gel analysis of PCR products (Fig. 1). To identify peptides/proteins that bind to A1–42, a biopanning using the constructed phage-displayed library was carried out essentially as described previously [20,21]. Briefly, the wells of Nunc Maxisorp microtiter plates (Nunc, Denmark) were coated overnight with 2 g/ml of A1–42, washed with PBS/Tween 0.05% and blocked with PBS/BSA 2%. Then, 1011 phage particles from a cDNA phage library were added to each well. After incubation for 4 h at 4 ◦ C, the plate was washed with cold PBS-Tween and bound phage particles were eluted using glycine–HCl (0.2 M, pH 2.2) and neutralized by adding Tris–HCl (1 M, pH 9.1). The eluted phages were plated on LB-Amp plates, and individual colonies from the third round of panning were rescued/amplified using M13KO7 helper phage and used in ELISA screening as described [20]. This screening resulted in isolation of seven phage clones recogniz-
Fig. 1. PCR analysis of the DNA fragments obtained from 10 phage clones (lane 1–10). DNA was PCR amplified and separated on a 2% agarose gel. Bands were visualized by ethidium bromide staining and UV illumination. The 100 bp DNA ladder (Invitrogen) was used for DNA sizing.
ing A1–42. The PCR and agarose gel analysis showed that three most positive clones carried about 125 bp cDNA inserts. The DNA sequences of the inserts of these three clones were determined using automated ABI Prism 310 Genetic Analyzer (Applied Biosystems, USA), miniprep-purifed double-stranded DNA from phagemid clones and pG8SAET vector-based 5 and 3 primers. The DNA and deduced amino acid sequences were analyzed by computer search with ExPASy Molecular Biology server and BLAST database. The DNA sequencing and computer data base search revealed that all three clones contained identical cDNA inserts coding for 25 amino acid (aa) long peptide TTNLPLMVMSSLLLIIILALSLAYE corresponding to C-terminal peptide domain of NADH dehydrogenase, subunit 3 (MTND3) encoded by mitochondrial DNA (mtDNA). To analyze the binding of A1–42 to phage bearing a Cterminal peptide domain of Complex I ND3, an ELISA assay using amplified and purified phage clones was carried out as previously described [20,21]. Phage concentration used was 1011 per ml, and 100 l were added to each well of Nunc maxisorp microtiter plates. Plates were incubated overnight at 4 ◦ C, washed with PBS/Tween 0.05% and blocked with PBS/BSA 2%. Biotinylated A1–42 concentrations used ranged from 0.11 to 0.88 M. Biotinylated A1–42 was added to each well, and plates were incubated for 1 h at 37 ◦ C. After washing, an avidineperoxidase conjugate diluted 1:500 (Pharmingen, San Jose, CA, USA) was added followed by the ABTS single solution (Zymed). M13 phage was used as a negative control phage. OD readings at 405 nm were registered using Opsys MR Microplate Reader (DYNEX Technologies, USA). The dose dependent recognition of A1–42 by phage bearing a C-terminal peptide domain of MTND3 is shown in Fig. 2. In summary, in the present study we identified another mitochondrial enzyme that binds to A1–42, by the screening of a human brain cDNA library expressed on M13 phage. Our
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
81
strategies by interfering in interaction between A and ND3 of complex I. Acknowledgements This work was supported, in part by grant from NIH (AG 023534, National Institute of Aging) to G.G. Authors thank Gonzalo Acero for technical assistance. References
Fig. 2. Analysis of interaction of A1–42 with phage bearing a C-terminal peptide domain of Complex I ND3 by ELISA. Phage concentration used was 1011 per ml, and 100 l were added to each well. A1–42 concentrations used ranged from 0.11 to 0.88 M. M13 phage was used as a negative control phage. OD at 405 was registered. Data are means of two independent experiments.
results indicated a strong interaction between a mitochondrial enzyme of NADH-ubiquinone oxidoreductase chain 3 (ND3) and A. This interaction may explain, in part, the inhibition of complex I activity in astrocytes and neurons in the presence of A, described recently [1,7]. It has been shown previously that direct interaction of A with other enzymes in mitochondria (ABAD, cytochrome oxidase, pyruvate dehydrogenase and ␣-ketoglutarate) led to mitochondrial dysfunction [5,6]. To our knowledge, our study is the first demonstration of the interaction between A and one of the subunits of the human complex I. Complex I is the first and largest enzyme of the respiratory chain and is vital for cellular energy production. It consists of about 42 subunits, and seven of these subunits, ND3 among them, are encoded by the mitochondrial genome. Interestingly, our results demonstrate for the first time that A binds to a mitochondrial genome-encoded peptide/protein. There are almost no data in literature on the actual function of ND3 within complex I, except for few studies [22,29,31]. One of these studies reported a case of a patient with progressive neurological impairment as a result of a novel mutation, T10191C, leading to a substitution of a hydrophilic serine to a hydrophobic proline (S45P), which may affect the folding of the protein [29]. The second study suggests that the ND3 subunit plays an unknown but important role in electron transport, proton pumping, or ubiquinone binding, and that T10158C mutation in MTND3 gene is a cause of infantile mitochondrial encephalopathy and complex I deficiency [22]. Finally, the third study have demonstrated that a single-nucleotide polymorphism (SNP) 10398G causes a nonconservative amino acid change from threonine to alanine within ND3 (T114A) and is strongly associated with a significant decrease of the risk of Parkinson disease [31]. However, none of the mentioned mutations is within the peptide region identified in our study (aa 81–105). Although our findings do not give a final picture of the precise mechanism of mitochondrial dysfunction in AD, they do describe another pattern probably important in the pathology of AD and they do open a route for the discovery of new treatment
[1] A.M. Aleardi, G. Benard, O. Augereau, M. Malgat, J.C. Talbot, J.P. Mazat, T. Letellier, J. Dachary-Prigent, G.C. Solain, R. Rossignol, Gradual alteration of mitochondrial structure and function by -amyloids: importance of membrane viscosity changes, energy deprivation, reactive oxygen species production, and cytochrome c release, J. Bioenerg. Biomembr. 37 (2005) 207–225. [2] C. Behl, J.B. Davis, R. Lesley, D. Schubert, Hydrogen peroxide mediates amyloid beta protein toxicity, Cell 77 (1994) 817–827. [3] L.M. Billings, S. Oddo, K.N. Green, J.L. McGaugh, F.M. LaFerla, Intraneuronal A causes the onset of early Alzheimer’s diseaserelated cognitive deficits in transgenic mice, Neuron 45 (2005) 675– 688. [4] J. Busciglio, A. Lorenzo, J. Yeh, B.A. Yankner, Beta-amyloid fibrils induce tau phosphorylation and loss of microtubule binding, Neuron 14 (1995) 879–888. [5] L. Canevari, A.Y. Abramov, M.R. Duchen, Toxicity of amyloid  peptide: tales of calcium, mitochondria, and oxidative stress, Neurochem. Res. 29 (2004) 637–650. [6] C.S. Casley, L. Canevari, J.M. Land, J.B. Clark, M.A. Sharpe, Amyloid inhibits integrated mitochondrial respiration and key enzyme activities, J. Neurochem. 80 (2002) 91–100. [7] C.S. Casley, J.M. Land, M.A. Sharpe, J.B. Clark, M.R. Duchen, L. Canevari, -Amyloid fragment 25–35 causes mitochondrial dysfunction in primary cortical neurons, Neurobiol. Dis. 10 (2002) 258– 267. [8] B.A. Chromy, R.J. Nowak, M.P. Lambert, K.L. Viola, L. Chang, P.T. Velasko, B.W. Jones, S.J. Fernandez, P.N. Lacor, P. Horowitz, C.E. Finch, G.A. Krafft, W.L. Klein, Self-assembly of Abeta(1–42) into globular neurotoxins, Biochemistry 42 (2003) 12749–12760. [9] J. El Khoury, S.E. Hickmann, C.A. Thomas, J.D. Loike, S.C. Silverstein, Microglia, scavenger receptors, and the pathogenesis of Alzheimer’s disease, Neurobiol. Aging 19 (1998) S81–S84. [10] P. Fernandez-Vizarra, A.P. Fernandez, S. Castro-Blanco, J. Serrano, M.L. Bentura, R. Martinez-Murillo, A. Martinez, J. Rodrigo, Intra- and extracellular Abeta and PHF in clinically evaluated cases of Alzheimer’s disease, Histol. Histopathol. 19 (2004) 823–844. [11] G.K. Gouras, J. Tsai, J. Naslund, B. Vincent, M. Edgar, F. Checler, J.P. Greenfield, V. Haroutunian, J.D. Buxbaum, H. Xu, P. Greengard, N.R. Relkin, Intraneuronal A42 accumulation in numan brain, Am. J. Pathol. 156 (2000) 15–20. [12] X.Y. He, H. Schulz, S.Y. Yang, A human brain L-3-hydroxyacylcoenzyme A dehydrogenase is identical to an amyloid -peptide-binding protein involved in Alzheimer’s disease, J. Biol. Chem. 273 (1998) 10741–10746. [13] K. Hensley, J.M. Carney, M.P. Mattson, M. Aksenova, M. Harris, J.F. Wu, R.A. Floyd, D.A. Butterfield, A model for -amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease, Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 3270–3274. [14] K. Jacobsson, L. Frykberg, Shotgun phage display cloning, Comb. Chem. High Throughput Screen. 4 (2001) 135–143. [15] R. Kayed, E. Headd, J.L. Thompson, T.M. McIntire, S.C. Milton, C.W. Cotman, C.G. Glabe, Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis, Science 300 (2003) 486–488.
82
M.E. Munguia et al. / Neuroscience Letters 397 (2006) 79–82
[16] P. Kuner, R. Schubenel, C. Hertel, -Amyloid binds to p75NTR and activates NFB in human neuroblastoma cells, J. Neurosci. Res. 54 (1998) 798–804. [17] L.F. Lue, D.G. Walker, L. Brachova, T.G. Beach, J. Rogers, A.M. Schmidt, D.M. Stern, S.D. Yan, Involvement of microglial receptor for advanced glycation endproducts (RAGE) in Alzheimer’s disease: identification of a cellular activation mechanism, Exp. Neurol. 171 (2001) 29–45. [18] J.W. Lustbader, M. Cirilli, C. Lin, H.W. Xu, K. Takuma, N. Wang, C. Caspersen, X. Chen, S. Pollak, M. Chaney, F. Trinchese, S. Liu, F. GunnMoore, L.F. Lue, D.G. Walker, P. Kuppusamy, Z.L. Zewier, O. Arancio, D. Stern, S.S. Yan, H. Wu, ABAD directly links A to mitochondrial toxicity in Alzheimer’s disease, Science 304 (2004) 448–452. [19] D.G. Lynn, S.C. Meredith, Review: model peptides and the physicochemical approach to -amyloids, J. Struct. Biol. 130 (2000) 153– 173. [20] K. Manoutcharian, G. Acero, M.E. Munguia, J.A. Montero, T. Govezensky, C. Cao, K. Ugen, G. Gevorkian, Amyloid-beta peptide specific single Ca´ın Fv antibodies isolated from an immune phage display library, J. Neuroimmunol. 145 (2003) 12–17. [21] K. Manoutcharian, J. Sotelo, E. Garcia, A. Cano, G. Gevorkian, Characterization of cerebrospinal fluid antibody specificities in neurocysicercosis using phage display peptide library, Clin. Immunol. 91 (1999) 117–121. [22] R. McFarland, D.M. Kirby, K.J. Fowler, A. Ohtake, M.T. Ryan, D.J. Amor, J.M. Fletcher, J.W. Dixon, F.A. Collins, D.M. Turnbull, R.W. Taylor, D.R. Thorburn, De novo mutations in the mitochondrial ND3 gene as a cause of infantile mitochondrial encephalopathy and complex I deficiency, Ann. Neurol. 55 (2003) 5–64. [23] S. Oddo, A. Caccamo, J.D. Shepherd, M.P. Murphy, T.E. Golde, R. Kayed, R. Metherate, M.P. Mattson, Y. Akbari, F.M. LaFerla, Tripletransgenic model of Alzheimer’s disease with plaques and tangles: intracellular Abeta and synaptic dysfunction, Neuron 39 (2003) 409– 421. [24] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [25] D.J. Selkoe, Alzheimer’s disease: a central role for amyloid, J. Neuropathol. Exp. Neurol. 53 (1994) 438–447. [26] D.J. Selkoe, Alzheimer’s disease: genes, proteins, and therapy, Physiol. Rev. 81 (2001) 741–766.
[27] R.H. Takahashi, T.A. Milner, F. Li, E.E. Nam, M.A. Edgar, H. Yamaguchi, M.F. Beal, H. Xu, P. Greengard, G.K. Gouras, Intraneuronal Alzheimer A42 accumulates in multivesicular bodies and is associated with synaptic pathology, Am. J. Pathol. 161 (2002) 1869–1879. [28] K. Takuma, J. Yao, J. Huang, H. Xu, X. Chen, J. Luddy, A.C. Trillat, D.M. Stern, O. Arancio, S.S. Yan, ABAD enhances Abeta-induced cell stress via mitochondrial dysfunction, FASEB J. 19 (2005) 597–598. [29] R.W. Taylor, R. Singh-Kler, C.M. Hayes, P.E.M. Smith, D.M. Turnbull, Progressive mitochondrial disease resulting from a novel missense mutation in the mitochondrial DNA ND3 gene, Ann. Neurol. 50 (2001) 104–107. [30] D.M. Walsh, I. Klyubin, J.M. Fadeeva, M.J. Rowan, D.J. Selkoe, Amyloid- oligomers: their production, toxicity and therapeutic inhibition, Biochem. Soc. Trans. 30 (2002) 552–557. [31] J.M. van der Walt, K.K. Nicodemus, E.R. Martin, W.K. Scott, M.A. Nance, R.L. Watts, J.P. Hubble, J.L. Haines, W.C. Koller, K. Lyons, R. Pahwa, M.B. Stern, A. Colcher, B.C. Hiner, J. Jankovic, W.G. Ondo, F.H. Allen Jr., C.G. Goetz, G.W. Small, F. Mastaglia, J.M. Stajich, A.C. McLaurin, L.T. Middleton, B.L. Scott, D.E. Schmechel, M.A. PericakVance, J.M. Vance, Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease, Am. J. Hum. Genet. 72 (2003) 804–811. [32] H.Y. Wang, D.H.S. Lee, M.R. D’Andrea, P.A. Peterson, R.P. Shank, -amyloid1–42 binds to ␣7 nicotinic acetylcholine receptor with high affinity, J. Biol. Chem. 275 (2000) 5626–5632. [33] S.D. Yan, J. Fu, C. Soto, X. Chen, H. Zhu, F. Al-Mohanna, K. Collison, A. Zhu, E. Stern, T. Saido, M. Tohyama, S. Ogawa, A. Roher, D. Stern, An intracellular protein that binds amyloid- peptide and mediates neurotoxicity in Alzheimer’s disease, Nature 389 (1997) 689–695. [34] S.D. Yan, D.M. Stern, Mitochondrial dysfunction and Alzheimer’s disease: role of amyloid-beta peptide alcohol dehydrogenase (ABAD), Int. J. Exp. Pathol. 86 (2005) 161–171. [35] S.D. Yan, H. Zhu, J. Fu, S.F. Yan, A. Roher, W.W. Tourtellotte, T. Rajavashisth, X. Chen, G.C. Godman, D. Astern, A.M. Schmidt, Amyloid- peptide-receptor for advanced glycation endproduct interaction elicits neuronal expression of macrophage-colony stimulating factor: a proinflammatory pathway in Alzheimer disease, Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 5296–5301. [36] C. Zhang, M.P. Lambert, C. Bunch, K. Barber, W.S. Wade, G.A. Krafft, W.L. Klein, Focal adhesion kinase expressed by nerve cell lines shows increased tyrosine phosporylation in response to Alzheimer’s A beta peptide, J. Biol. Chem. 269 (1994) 25247–25250.