Identification of basic transcriptional elements required for rif gene transcription

International Journal for Parasitology 37 (2007) 605–615 www.elsevier.com/locate/ijpara

Identification of basic transcriptional elements required for rif gene transcription Wai-Hong Tham *, Paul D. Payne, Graham V. Brown, Stephen J. Rogerson Department of Medicine, University of Melbourne, Royal Melbourne Hospital, Parkville, Victoria 3050, Australia Received 9 October 2006; received in revised form 16 November 2006; accepted 19 November 2006

Abstract The rif gene family is the largest multi-gene family in the malaria parasite Plasmodium falciparum. The gene products of rif genes, rifins, are clonally variant and transported to the surface of the infected erythrocyte where they are targets of the human immune response. Maximal rif transcription occurs during the late ring to early trophozoite stages of the intra-erythrocytic cycle. The factors involved in the transcriptional activation and repression of rif genes are not known. In this paper, we characterize several DNA elements involved in the regulation of rif transcription. We identify the upstream region that contains a functional promoter and the transcriptional start site of a rif gene. In addition, we identify two distinct regions within the rif upstream region involved in the transcriptional repression of these genes. These repressor sites are bound by nuclear protein factors expressed in different stages of the Plasmodium life cycle. We propose that the differential timing of binding provides a mechanism for the temporal repression of rif genes. In addition, we find that transcription profiles of upsA var genes and their neighbouring rif genes are unlinked. Ó 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: rif; var; Multi-gene families; Transcription regulation; Repressor; Plasmodium falciparum

1. Introduction Mortality and disease symptoms associated with Plasmodium falciparum malaria infections occur exclusively during the blood stage of infection. As the parasites mature to early pigmented trophozoites within the infected erythrocyte, parasite-derived molecules are expressed on the erythrocyte surface. These surface antigens are recognized by the host immune system and are implicated in host-protective immunity (Bull et al., 1998). However, by switching the proteins expressed, the parasite has the ability to generate novel antigenic properties on the surface of infected erythrocytes in response to pressure from the human immune system, thus providing a mechanism for immune evasion. * Corresponding author. Present address: Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria 3050, Australia. Tel.: +61 3 9345 2456; fax: +61 3 9347 0852. E-mail address: [email protected] (W.-H. Tham).

With 149 members, the rif gene family represents the largest multi-copy gene family in P. falciparum whose protein products, rifins, are located at the Maurer’s clefts and indirect evidence also supports their expression at the infected erythrocyte surface (Fernandez et al., 1999; Kyes et al., 1999; Marti et al., 2004; Khattab and Klinkert, 2006). Several studies have shown that rifins are immunogenic in natural infections and are recognized by human immune sera (Fernandez et al., 1999; Abdel-Latif et al., 2002, 2003, 2004). Although the functional role of rifins on the surface of the infected erythrocyte remains speculative, it is possible these proteins play an accessory role in rosette formation or cytoadherence (Kyes et al., 1999). There is compelling evidence that rifins are clonally variant, as different subsets of rifins are expressed on the erythrocyte surface by sibling clones derived from an isogenic background (Fernandez et al., 1999; Kyes et al., 1999). The heterogeneity of rifins on the erythrocyte surface may arise from post-translational modification of rifins destined for the surface or from a selective repression of

0020-7519/$30.00 Ó 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2006.11.006

606

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

transcription of individual rif genes. By analogy to the multi-copy var gene family whose protein products are transported to the erythrocyte surface, clonal variation could be controlled on a gene transcriptional level. Regulation of var gene transcription results in the expression of one full-length transcript from a single var gene and the transcriptional repression of all other var genes. The parasite switches expression to a different member through in situ activation of a transcriptionally silent var gene (Scherf et al., 1998). Very little is known about the mechanisms that regulate rif transcription. Northern blot analysis using a complex rif probe shows that maximal rif gene transcription occurs during the intra-erythrocytic cycle corresponding with the late ring to early pigmented trophozoite stage in the parasite clone Palo Alto (Kyes et al., 1999). Mechanisms must therefore be in place for the regulation of rif expression. To understand rif transcriptional regulation, we were interested in identifying the basic DNA sequence elements involved in rif gene expression using the genome reference clone 3D7. We focused our attention on a subset of eight rif genes that share a common upstream region with a var gene as they are orientated in a head-to-head fashion. Var genes are categorized into five different groups (upsA to upsE) from the alignment of their upstream regions and only upsA var genes are in a head-to-head orientation with a neighbouring rif gene (Lavstsen et al., 2003). UpsA var genes and their associated rif genes are located primarily in the subtelomeric regions of P. falciparum. Identification of regulatory elements within the shared upstream region would shed light on the elements involved in the regulation of rif and var gene transcription. In this paper, we identify the transcription start site of a rif gene and show that the region also possesses functional promoter activity. We believe we provide the first characterization of two distinct DNA sequence elements involved in the transcriptional repression of a rif gene. As expected, mutation of one of the repressor elements and the complete removal of the other lead to a decrease in repression. We also show that these repressor elements bind nuclear proteins expressed in different stages of the Plasmodium life cycle. The differential timing of binding of the repressor elements leads us to propose a model where one repressor element is involved in the selective repression of rif genes early in the life cycle and another separate repressor element is responsible for the repression of rif genes in the later stages of the life cycle. We also provide evidence that the transcription profile of upsA var and their neighbouring rif genes are not linked in unselected lines or in 3D7sir2D. 2. Materials and methods 2.1. Transcription analysis of rif genes and rapid amplification of cDNA ends (5 0 RACE) The 3D7 strain was cultured and synchronized using standard methods (Lambros and Vanderberg, 1979; Trager and

Jenson, 1978). Parasites were harvested at 0, 6, 12, 18, 24, 30, 32, 34, 36 and 40 h post invasion and total RNA and genomic DNA were extracted using the Trizol method (Kyes et al., 2000). RNA samples were treated with DNaseI according to the manufacturer’s instructions (GIBCO/BRL). cDNA was primed using random hexamers and the first strand cDNA synthesis kit from Invitrogen. To amplify genomic and cDNA transcript, two rounds of PCR were performed. The first PCR cycle used primers RINT1.5 (ATCCATTAT ACTAATATATTATTGTTTCCT) and 0009.3 (ACCT TACCTGCACTACCTAATGT) and the second nested PCR cycle was performed using RINT2.5 (TATAT TATTGTTTCCTCTAAAATTAAATAT) and 0009.3. 5 0 RACE was carried out using the 5 0 RACE system for rapid amplification of cDNA Ends, Version 2.0 kit from Invitrogen. Parasites were harvested at 18–24 h post invasion to coincide with the period of rif gene transcription and total RNA was extracted using the Trizol method (Kyes et al., 2000). All amplified products were cloned into a pGEM-T vector (Promega) and sequenced. 2.2. Vector construction for firefly luciferase reporters Upstream regions of rif genes were amplified from the 3D7 genome using a set of primers specific to the rif gene PF11_0009. The primers contain an introduced HindIII site in the 5 0 end and BamHI site in the 3 0 end. Primers 393F (CCCAAGCTTTAGAAGTTCTTACTAAATCGTAACG TA), 562F (CCCAAGCTTATAACAAATATTATGA TATGCAATGA), 700F (CCCAAGCTTAGATACAT TAGAGAGAAAGGTATAACAT), and 870F (CCC AAGCTTCGCACAACACTACATAAAACTATACAAT AGT) were used as the 5 0 end primers together with 3R (CGCGGATCCTTATTGTGATACGTATATTATTTTA TGATA; restriction sites are italized) as the 3 0 end primer to clone pRIF393, pRIF562, pRIF700 and pRIF870, respectively. Amplified products were cloned into a pGEM-T vector (Promega) and sequenced. In all cases, the sequences were 99% identical to PF11_0009. These sequences were subsequently cloned in the BamHI–HindIII site of pHHI-pac/ luc plasmid (a kind gift from Brendan Crabb, The Walter and Eliza Hall Institute of Medical Research), thereby fusing the rif upstream region to the Firefly luciferase gene. To clone pRIF870mut, we amplified the region spanning 3 to 870 from 3D7 genomic DNA using the primers 870mutF(GCGCTCGAGAAAACAACAAAACATAAAA CTATACAATAGT) and 54.3 (GCGCCATGGTTATT GTGATACGTATATTATTTTA TGATA; XhoI and NcoI sites are in italics). This fragment was inserted into a PGEMT vector to create 870mutPGEM-T. The mutated rif upstream region was excised from 870mutPGEM-T and inserted into the XhoI and NcoI sites of Pf86 (Militello and Wirth, 2003) to create pRIF870mut, thereby fusing the mutated upstream region to the Firefly luciferase gene. To clone pRIF870wt, we amplified the region spanning 3 to 870 from 3D7 genomic DNA using the primers 870wt.5 (GCGCTCGAGCGCACAACACTACATAAAACTATAC

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

AATAGT) and 54.3. We followed the same cloning procedure as above to create pRIF870wt. Both pRIF870wt and pRIF870mut were sequenced to ensure that no DNA modifications were introduced during the cloning procedure. To clone pRIF562mut and pRIF486, primers 562mutF (CCCAAGCTTATAACAAATATTATGATAAAAAATG A) and 486F (CCCAAGCTTACTAATAGGTTTTTCCAA ATTGT) were used, together with 3R to amplify the relevant upstream regions. Amplified products were cloned into a pGEM-T vector (Promega) and sequenced. These sequences were subsequently cloned in the BamHI–HindIII site of pHHI-pac/luc plasmid, thereby fusing the rif upstream region to the Firefly luciferase gene. 2.3. Transient transfection To control for transfection efficiency, we used plasmid pPfrluc which has the 5 0 untranslated region (UTR) of the calmodulin gene fused to the Renilla luciferase reporter (a kind gift from Kevin Militello; Militello and Wirth, 2003). Ring stage parasites were transfected with 100 lg of rif transfection constructs and 75 lg of pPfrLuc at 0.310 kV and 950 lF using a Biorad Gene Pulser II. 2.4. Luciferase assays Parasites were harvested at the early trophozoite stage in the following cell cycle post-transfection and lysates were extracted as described in the manufacturer’s instructions for the DLR Assay Kit (Promega). Twenty microliters of lysate was mixed with 100 ll of LARII reagent to activate Firefly luminescence and 100 ll of Stop and Glo reagent to activate Renilla luminescence. Luminescence measurements were done on an EG&G Berthold Lumat LB9507. For each transfection construct, transfections were repeated three times and luminescence measurements were an average value obtained from three independent readings. To control for background luminescence, a no-DNA control was included in every experiment and its luminescence measurements were subtracted from the measurements obtained for every transfection. The ratio of Firefly to Renilla luminescence was calculated for each transfection and the highest ratio in each experiment was normalized to 100%. 2.5. Electrophoretic mobility shift assays (EMSA) Electrophoretic mobility shift assays (EMSAs) were performed as described in Voss et al. (2003). For all competition experiments, unlabeled double-stranded oligos were incubated with the nuclear proteins for 10 min at room temperature prior to the addition of a radiolabeled probe. Binding reactions were loaded under current onto 4% or 6% native polyacrylamide gels, dried and exposed overnight onto Kodak BioMax Film.

607

2.6. Quantitative real-time PCR RNA was harvested from each parasite line at early rings and at late rings/early trophozoites using the Trizol method (Kyes et al., 2000) and treated with DNaseI (GIBCO/BRL) as described in the manufacturer’s instructions. 3D7sir2D was a gift from Dr. Alan Cowman (The Walter and Eliza Hall Institute of Medical Research). Reverse transcription was carried out using Superscript III and random hexamers (Invitrogen) and the cDNA was diluted and stored as single use aliquots in 80 °C. Primer sets 7, 8, 20, 25, 35, 96 and 97 as published in Salanti et al. (2003) were used to amplify the upsA var genes in head-to-head orientation with a rif gene. Primer sets 60 and 61 from Salanti et al. (2003) were also used to amplify two housekeeping genes; seryl-tRNA synthetase and fructose-biphosphate aldolase. In addition, we designed a unique primer pair to PFF0020c. Primer pairs to the neighbouring rif genes were designed using Primer Express software (Applied Biosystems) and all primers were made by Geneworks (Australia). Each PCR reaction used 5 ll of SYBR Green PCR master Mix (PE Biosystems) in a 10 ll reaction that was amplified using the ABI Prism 7900HT Sequence Detection System. The PCR cycling conditions were 95 °C for 10 min, then 40 cycles of 94 °C for 30 s, 54 °C for 40 s and 68 °C for 50 s with a 10 min extension at 68 °C followed by a dissociation step. The specificity of each primer pair was determined by dissociation curve analysis and gel electrophoresis. Absolute quantitation was performed using in vitro transcribed RNA standards that were diluted 10-fold seven times to generate an eight point standard curve to enable quantitation of 1011–104 molecules of cDNA. Absolute quantification was performed by plotting of threshold cycle values of the unknown samples onto standard curves of quantity plotted against Ct. The quantity of seryl-tRNA synthetase was used to normalize each var and rif transcript. 3. Results 3.1. Stages of rif gene transcription and identification of the transcriptional start site of a rif gene To determine when the upsA var-associated rif genes are transcribed in 3D7, we harvested RNA and genomic DNA from synchronized parasites at 0, 6, 12, 18, 24, 30, 32, 34, 36 and 40 h post invasion. To amplify the cDNA transcripts, we designed gene-specific primers to all eight rif genes neighbouring an upsA var gene. These primer pairs span the rif intron, allowing us to differentiate between genomic DNA versus cDNA amplification. All gene-specific primers could amplify the predicted products using genomic DNA as a template (data not shown). However, we only managed to amplify cDNA transcript (predicted size of 594 bp) for rif gene PF11_0009 (Fig. 1A). Maximal gene transcription for this gene occurred between 18 and 24 h

608

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

Fig. 1. The stages of rif gene transcription and transcription start site of a rif gene identified. (A) Using RNA harvested at 0, 6, 12, 18, 24, 30, 32, 34, 36 and 40 h post invasion, amplification of cDNA transcript show that maximal rif transcription occurs at 18 and 24 h post invasion. Genomic DNA amplification is shown in lane g. A 100 bp ladder (New England Biolabs) was loaded in the first and last lane of the gel. (B) Gel analysis of 5 0 RACE products obtained from the first and second PCR amplification. The + and  symbols refer to reverse transcription reactions which did and did not contain Superscript II, respectively. A 100 bp ladder (New England Biolabs) was loaded and the 400 bp fragment is marked with an asterisk. (C) A cloned upstream region of a 5 0 RACE product is shown. The three gene-specific primers are shown as GSP1, GSP2 and GSP3. First initiation codon and splice junction are shown in bold as ATG and GG, respectively. Arrows mark the three different transcriptional start sites identified from the 5 0 RACE products.

post invasion, which corresponds with the late ring to early trophozoite stage (lanes 18 and 24, Fig. 1A). From 30 h onwards we observed a band that corresponds to genomic DNA amplification (predicted size of 748 bp, lane g, Fig. 1A) which is a likely consequence of incomplete DNaseI digestion. To identify the transcriptional start site of a rif gene, we used a 5 0 RACE technique. Reverse transcription of the rif gene was performed using a gene-specific primer (GSP1) located downstream of the rif intron (Fig. 1C). The genespecific primers were designed based on sequence alignments of the upstream region of eight rif genes that are in a head-to-head orientation with an upsA var gene but the final sequence for the primers was based on the rif gene PF11_0009. In order to visualize the cDNA transcripts, the reverse transcription products were subjected to two amplification cycles of PCR using nested gene-specific primers (GSP2 and 3) located downstream of a rif intron in combination with anchored primers (Fig. 1C). We used gene-specific primers located downstream of the rif intron to allow identification of properly spliced cDNA transcripts upon sequencing of the 5 0 RACE products. The first PCR cycle yielded no amplified product whereas the second PCR cycle yielded amplified product only in reactions that contained Superscript II (Invitrogen) during the reverse transcription reaction (Fig. 1B). Eleven genuine spliced cDNA transcripts were identified upon sequencing and found to be co-linear with the 3D7

genomic sequence but heterogeneous in their 5 0 ends. These cDNA transcripts were >98% identical to the following rif genes; PFD0050w, PFD0025w, PFI0065w, PFI0020w, PF11_0009, PF11_0520, PF13_0004 and PFA0020w. Three different transcriptional start sites were found clustered within a 47 nucleotide region (Fig. 1C, arrows). The presence of three different transcriptional start sites may be a result of reverse transcriptase pausing due to the AT richness of the upstream region, rather than the existence of multiple transcriptional start sites. Of the 11 RACE products analyzed, five indicated initiation at position 245 and we propose this site to be the major transcription start site. 3.2. The rif upstream region possesses promoter and transcriptional repression activities To assess whether the upstream regions of rif genes possess functional promoter and repressor activity, we used transient transfection luciferase assays. Episomally maintained plasmids require passage through S-phase for the proper assembly of silent chromatin so parasites were harvested in the trophozoite stage in the following cell cycle post-transfection in all of our experiments (Deitsch et al., 2001). Transient luciferase assays were used to examine var intron silencing and therefore, we believe this technique would also facilitate the identification of repressor activity of rif genes (Calderwood et al., 2003; Deitsch et al., 2001).

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

We constructed transfection plasmids containing increasingly larger regions of rif upstream sequence fused to Firefly luciferase reporter (Fig. 2). The plasmids were named based on the most upstream nucleotide relative to the first rif ATG. The numbers in the brackets in the text below specify the upstream region relative to the first ATG that was cloned into the transfection vectors. The region spanning 3 to 870 was 99% identical to PF11_0009. The rif transfection plasmids were co-transfected with pPfrluc and Firefly luciferase and luminescence was measured and normalized to Renilla luciferase luminescence for each of the transfected parasite lines. Three distinct upstream regions appear to be involved in the transcriptional regulation of the rif gene (Fig. 2). The shortest construct pRIF393 (3 to 393) consistently showed the highest transcriptional activity, suggesting that a functional promoter lies within this region. This result was consistent with the mapping of the transcription start site at 245 nucleotides within this region (Fig. 1B). The construct pRIF562 that includes upstream region 3 to 562 showed a reduction of luciferase expression by 68%. A similar reduction in transcription activity was also observed in transfected parasites containing the pRIF700 construct that encompasses the region 3 to 700. Since pRIF562 and pRIF700 consistently showed a similar reduction in transcriptional activity, we propose that a repressor element was present in both constructs. Parasites transfected with pRIF870 (3 to 870) showed an even more pronounced reduction in gene expression, such that only 9% of the total luciferase expression was observed. This result suggested the existence of a second repressor element within the upstream region of 700 to -870. Based on the luciferase reporter assays, we were able to determine three regions of transcription regulation of a rif gene: (i) a functional promoter within 3 to 393 region; (ii) a repressor element within the 393 to

Fig. 2. Analysis of luciferase activity from the rif transfection constructs. Ring stage parasites were transfected with the constructs schematically depicted at the left hand side. For each transfection construct, transfections were repeated three times and luminescence measurements were an average value obtained from three independent readings. The error bars are the SD obtained from three independent experiments. To control for background luminescence, a no-DNA control was included in every experiment and its luminescence measurements were subtracted from the measurements obtained for every transfection.

609

562 region; and (iii) a second repressor element within the 700 to 870 region. 3.3. The repressor sites are targets for nuclear protein–DNA interactions To gain insight to the possible trans-acting factors that play a role in the regulation of transcription we performed a series of EMSAs. Seven fragments that encompassed the rif upstream region from 3 to 1006 were examined by EMSA for binding sites for nuclear proteins present in an asynchronous extract of P. falciparum parasites (data not shown). We found two probes that yielded DNA–protein complexes (Fig. 3). The first probe which encompasses the region 840 to 1006 showed the formation of a complex (Fig. 3A, lane 1 arrow) which was competed by a 50fold excess of specific cold competitor but not by a 50-fold excess of non-specific competitor (Fig. 3A, lanes 2 and 3, respectively). In addition, the complex formed is not present in the free probe lane (Fig. 3A, lane FP). The specific competitor in this experiment is a PCR product encompassing 840 to 1004 and the non-specific competitor is a PCR product encompassing 563 to 700. The second probe that included region 356 to 562 showed two distinct bands (Fig. 3B, lane 1 arrows). Formation of these complexes was greatly reduced when the binding reaction contained 50-fold excess of specific cold competitor (Fig. 3B, lane 2) and not with non-specific cold competitors (Fig. 3B, lane 3) suggesting that these complexes represented specific DNA–protein interactions. The specific competitor in this experiment is a PCR product encompassing 356 to 562 and the non-specific competitor is a PCR product encompassing 563 to 700. As expected, the complex was not formed in the absence of

Fig. 3. The rif upstream region is a target for DNA binding proteins. Competitions with 50-fold excess of specific (S) and non-specific (NS) competitors are as indicated. The lanes that did not contain any protein extracts are marked as FP. The arrows mark the formation of DNA– protein complexes. Electrophoretic mobility shift assays with probes spanning: (A) 840 to 1006 (lane 1 has no competitor, lane 2 has a specific competitor and lane 3 has a non-specific competitor); (B) 356 to 562 (lane 1 has no competitor, lane 2 has a specific competitor and lane 3 has a non-specific competitor); and (C) 563 to 700 upstream of the first initiation codon (lane 1 has no competitor and lane 2 has a specific competitor).

610

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

protein extract (Fig. 3B, lane FP). Fig. 3C shows an example of a region that showed no protein binding. Interestingly, the sites of protein binding (840 to 1006 and 356 to 562) were located within upstream regions that were identified to contain repressor elements from the luciferase reporter assays (Fig. 2, pRIF870 and pRIF562) and therefore we propose that these proteinbinding sites function as transcriptional repression elements. 3.4. The repressor site at 840 to 1004 is mapped to a 10 nucleotide GC rich sequence To characterize the exact region of binding, we introduced shorter oligonucleotides that span the entire region of the bound fragment. For the 840 to 1004 fragment, four double-stranded competitor probes labeled 8A–8D were incubated with the binding reaction to determine which of these probes could compete specifically (Fig. 4A). Lanes 1 and 10 in Fig. 4A (arrow) show the protein complexes formed on the 840 to 1004 fragment without the addition of any competitor. As expected, complex formation did not occur without the addition of protein extract (lane FP). For the specific competition experiments, only competitor 8C and 8D could reduce the level of protein binding to the 840 to 1004 fragment at 20-fold excess (Fig. 4A, lanes 7 and 9, respectively). The 8C probe has sequence overlap with the 8D probe, suggest-

ing that the region of binding might be present within this overlap (Fig. 4A, underlined). To test this hypothesis, we radiolabeled the 49 nucleotide region that encompassed probes 8C and 8D, incubated it with protein extract and competed the binding with smaller double-stranded competitors within that region, labeled 8.1–8.5 (Fig. 4B). Lane 1 in Fig. 4B (arrow) shows the formation of a DNA–protein complex in the absence of a competitor and lane FP did not contain any protein extract and therefore shows the absence of this complex (Fig. 4B, lane FP). At 50-fold excess, the only competitor that managed to compete for binding was competitor 8.3 (Fig. 4B, lane 4). This competitor contained a 10 bp GC rich sequence CGCACAACAC, which was the only sequence that overlapped the 8C and 8D sequence. To determine the sequence requirements for the binding, we repeated the competition experiments with mutated versions of oligonucleotide 8.3 that introduced three adenines consecutively (Fig. 4C). These mutated oligos were named 8.3mut1 to 8.3mut4. Lane 1 in Fig. 4C shows the formation of the complex when no competitor is added. However, when the EMSAs were repeated with these mutated oligos, none of them could successfully compete for binding, even at 50-fold excess (Fig. 4C, lanes 3–6) although 50-fold excess of wild-type 8.3 oligonucleotide could compete specifically (Fig. 4C, lane 2). This result suggested that binding site CGCACAACAC has relatively stringent nucleotide

Fig. 4. The 10 bp GC rich sequence CGCACAACAC is responsible for protein binding at 840 to 1006. The lanes without any protein extracts are labeled as FP. The arrows mark the formation of DNA–protein complexes. Unless otherwise noted, all competitions were performed with 50-fold excess of competitor. (A) The binding to 840 to 1006 is isolated to a 31 bp site. Lanes 1 and 10 are binding reactions that contain no competitor except for singlestranded competitor. Lanes 2, 4, 6 and 8 are competitions performed with the indicated competitors at 10-fold excess. Lanes 3, 5, 7 and 9 were competitions performed with the indicated competitors at 20-fold excess. Competitors 8A–8D encompass the whole region between 840 and 1006. Overlap between competitor 8C and 8D is underlined. (B) A 10 bp GC rich sequence is the site of protein binding. The entire sequence used for the radiolabeled probe is shown above the gel with the competitor fragments marked. Lanes 1 and 7 are binding reactions that contain no competitor. Binding reactions in lanes 2–6 contain competitor 8.1–8.5, respectively. (C) Strict sequence requirements for the 10 bp binding site. The mutated competitors used are shown below the figure. Lane 1 is a binding reaction that contains no competitor. Lane 2 contains specific competitor 8.3 in the binding reaction. Binding reactions in lanes 3–6 contain competitor 8.3mut1 to 8.3mut4, respectively.

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

requirements and that all of the residues present were required for full protein binding. To test the hypothesis that the CGCACAACAC element functions as a cis-acting repressor element, we mutated the site to AAAACAACAA and recloned the mutated upstream region adjacent to the Firefly luciferase gene. Based on our EMSA results, this mutated element should not provide a recognition site for nuclear proteins (Fig. 4C). The reporter plasmid that contains the mutated site was called pRIF870mut. We observe that pRIF870mut showed 2-fold increase in luciferase expression compared with pRIF870wt (Supplementary Fig. 1a). We conclude that the CGCACAACAC element (870 to 860) functions as a repressor element within the rif upstream region, and that recognition for protein binding is important for repression. 3.5. The repressor site at 356 to 562 is mapped to a 12 bp site To characterize the exact region of binding for the 356 to 562 fragment, we introduced shorter competitor oligonucleotides that span the entire region of the bound fragment (only competitor oligonucleotides 5.1–5.4 are shown in Fig. 5). Lanes 1 and 10 in Fig. 5A (arrows) show the for-

Fig. 5. A 12 bp site is responsible for protein binding within the 356 to 562 region. The lanes without any protein extracts are labeled as FP. The arrows mark the formation of DNA–protein complexes. Unless otherwise noted, all competitions were performed with 50-fold excess of competitor. (A) The binding to 356 to 562 is isolated to a 17 bp site. Lanes 1 and 10 show the formation of the two complexes without any specific competitor added to the binding reaction. Lane 11 contains the full-length specific competitor whereas lanes 2–9 contain shorter competitor oligos as indicated above the lanes. Lanes 2, 4, 6 and 8 are competitions performed with the indicated competitors at 10-fold excess. Lanes 3, 5, 7, and 9 were competitions performed with competitors at 20-fold excess. (B) The 12 bp binding site is dependent on specific residues. Lane 1 contains no specific competitor whereas lanes 2–6 contain competitors 5.3mut1 to 5.3mut5, respectively. The mutated oligonucleotides are shown on the right of the gel.

611

mation of the two complexes without any competitor added to the binding reaction. Although competition experiments were performed with fragments spanning the entire region, we found that only probes 5.3 and 5.4 at 20-fold excess successfully competed for binding (data not shown, Fig. 5A, lanes 7 and 9). The level of competition is similar to when a PCR fragment encompassing 356 to 562 was used as a specific competitor (lane 11). However, probe 5.4 did not show consistent competition at 50-fold excess (data not shown) and therefore we proceeded to further analyze binding within the 5.3 region. To further define the binding site, we radiolabeled the fragment encompassing the probes 5.1–5.4. We repeated the competition experiments with mutated versions of the 5.3 oligo which introduced three adenines in a row, consecutively. These mutated oligos were labeled 5.3mut1 to 5.3mut5 (Fig. 5B). Lane 1 of Fig. 5 shows the formation of the complex without addition of any competitors. When the EMSAs were repeated with the mutated oligonucleotides, we observe that all the mutated oligonucleotides compete to a certain degree but only 5.3mut1 and 5.3mut4 show complete competition for binding at 20-fold excess (Fig. 5B, lanes 2 and 5, respectively), suggesting that mutated residues within 5.3mut1 and 5.3mut4 were not required for protein binding. Therefore the sites required for protein binding within this 12 bp region are shown in uppercase italics TATGCAatgATT (546 to 535). To test the hypothesis that the TATGCAatgATT element functions as a cis-acting repressor element, we mutated the site to ATAAAAAATGATT and recloned the mutated upstream region adjacent to the Firefly luciferase gene. Based on our EMSA results, this mutated element should not provide a recognition site for nuclear proteins (Fig. 5B). The reporter plasmid that contains the mutated site was called pRIF562mut. We observe that pRIF562mut did not show a significant increase in luciferase expression compared with pRIF562wt (data not shown). We proceeded to completely remove the entire repressor element together with 16 bp of upstream flanking region and 47 bp of downstream sequence, and recloned the truncated region adjacent to the Firefly luciferase gene. This truncated construct was named pRIF486. pRIF486 showed an 1.9-fold increase in luciferase expression compared with pRIF562 (Supplementary Fig. 1b). The increase in luciferase expression indicates the involvement of this element in transcriptional repression. 3.6. The repressor sites recruit nuclear proteins present at different stages of the cell cycle To determine whether protein binding to the repressor elements was cell cycle regulated, we incubated the radiolabeled fragments with nuclear protein extracts obtained specifically from early rings (ER, 0–6 h), late rings (LR, 14–18 h), late trophozoite (LT, 30–34 h) and schizont (S, 36–40 h) cultures. We also harvested RNA from the stage-specific cultures and determined that the rif gene

612

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

PF11_0009 transcription was only present in late ring culture (data not shown). Although in Fig. 1A we show that PF11_0009 transcription was present in early trophozoite stage (lane 24, Fig. 1A), the trophozoite stage for this experiment consisted mostly of late pigmented trophozoites ( past 30 h post invasion) and therefore showed no rif transcription. For the 840 to 1004 fragment, proteins that bound this fragment were present in the late trophozoite and schizont extracts (Fig. 6A, lanes 4 and 5, respectively). The complex formed with these staged cultures was similar to the complex formed using an asynchronous nuclear extract (Fig. 6A, lane 1). Although we did observe a single complex in the ring extracts (Fig. 6A, lanes 2 and 3), this complex appeared to be non-specific as it could not be competed by 50-fold excess of a specific competitor (Fig. 6B, lane 2 asterisk). However, the DNA–protein complexes found in the late trophozoite extracts were competed by 50-fold excess of a specific competitor (Fig. 6B, lane 4) suggesting the late trophozoite and schizont stage DNA– protein complexes formed were genuine. Binding of the 356 to 562 fragment occurred only in the ring stage extracts (Fig. 6C, lanes 1 and 2). Interestingly, early ring extracts showed the formation of one complex rather than two complexes previously seen in the asynchronous nuclear extracts and with the late ring extracts (Fig. 3B, lane 1; Fig. 6C, lane 2). However, both set of complexes found in early and late rings were genuine as they were competed using specific competitors (Fig. 6D, lanes 2 and 4, specifically). From these results, we propose that proteins bind the TATGCAatgATT element early in the parasite life cycle whereas proteins bind the more upstream repressor element CGCACAACAC in later stages of the parasite life cycle.

3.7. The rif transcription profile is unlinked to the upsA var transcription profile in unselected lines To determine if transcription profiles between upsA var and their neighbouring rif genes were linked, we harvested RNA from the early ring (for var transcripts) and late ring/ early trophozoite stages within the cell cycle (for rif transcripts) from three different batches of 3D7 (labeled A–C, Fig. 7). All three lines showed a different transcription profile for both upsA var and their neighbouring rif genes. In line A, the var gene PFA0015c showed the highest level of transcript but both its neighbouring rif PFA0020w and non-neighbouring rif PFF0025w showed almost similar levels of transcript. For the B line, the neigbouring var and rif genes PFA0015c and PFA0020w showed highest levels of transcripts but so did the non-neighbouring var PF11_0521. In the C line, the var gene PFA0015c once again has the highest level of transcript but its neighbouring rif gene PFA0020w showed no increase in transcript level. Therefore, from these analyses we conclude that we cannot observe any evidence for transcriptional co-regulation of upsA var and their neighbouring rif genes. 3.8. A subset of upsA related rif genes is regulated by PfSir2 PfSIR2 is a homolog of budding yeast SIR2p that plays a central role in epigenetic gene silencing at telomeres, mating type loci and rDNA locus (Gasser and Cockell, 2001). Disruption of PfSir2 leads to a dramatic up-regulation of upsA var gene transcription as shown by microarray analyses (Duraisingh et al., 2005). To determine whether or not PfSir2 also played a role in the regulation of the neighbouring rif genes, we harvested RNA from synchronized parasites from wild-type and 3D7sir2D strains at both early

Fig. 6. Protein binding to the repressor elements is cell cycle regulated. Radiolabeled probes as indicated below the gels were incubated with protein extracts obtained from early rings (ER), late rings (LR), late trophozoite (LT), schizont (S) and asynchronous (AS) cultures. Lanes without any protein extracts are marked as FP. The arrows mark the formation of DNA–protein complexes and all competitions were performed with 50-fold excess of competitor. (A) Binding to the 840 to 1006 region only occurs in late trophozoite and schizont stages. Lane 1 is incubated with nuclear proteins extracted from an asynchronous culture. Lanes 2–5 are incubated with protein extracts obtained from early rings, late rings, late trophozoite and schizont cultures, respectively. (B) Protein complex formed by late trophozoite extract is competed using specific competitors. Lanes 1 and 2 are incubated with nuclear proteins obtained from late rings and lanes 3 and 4 are incubated with nuclear proteins from late trophozoite cultures. Lanes 2 and 4 contain specific competitors. The non-specific complex formed by late ring stage extracts is highlighted by an asterisk. (C) Binding to the 356 to 562 region only occurs in the ring stages. Lanes 1–4 are binding reactions incubated with early ring, late ring, late trophozoite and schizont nuclear protein extracts, respectively. (D) The ring stage complexes are competed using a specific competitor. Lanes 1 and 2 are binding reactions incubated with early ring nuclear protein extracts and lanes 3 and 4 are incubated with late ring nuclear protein extracts. Lanes 2 and 4 contain specific competitor.

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

613

est up-regulation by real-time PCR and as described in the published result. Five of the upsA related rif genes also showed an increase in transcript levels in 3D7sir2D relative to the wild-type strain; PF11_0009, PF11_0520, PF13_0004, PFD0025w and PFD1230c. However, PFI1815c, PFA0020w and PFF0025 did not show an increase in transcript levels relative to the wild-type strain. Therefore, we conclude that even in a situation where the chromatin structure of upsA var gene is activated for transcription, the neighbouring rif gene can still maintain its closed chromatin structure. 4. Discussion

Fig. 7. Quantitative real-time analysis of upsA var and neighbouring rif gene transcription profile. Real-time PCR was performed on cDNA obtained from three independent lines (A–C) harvested for early ring stage parasites for var transcript and late ring/early trophozoite stage parasites for rif transcript. Absolute quantities of var and rif transcripts were determined using standard curves and normalized to levels of transcript obtained for seryl-tRNA synthetase. On the y-axis are mean values of normalized quantities of var (on left axis) and rif (on right axis) transcript and the error bars are SD from triplicate readings. The x-axis is labeled with the respective var and rif gene names. The black bars represent var transcripts and the grey bars represent rif transcripts.

ring and late ring/early trophozoite stages for quantitative real-time PCR analysis. Results in Fig. 8 show that transcription of all upsA var genes was up-regulated in 3D7sir2D relative to wild-type 3D7 as reported in Duraisingh et al. (2005). In addition, PF13_0003 showed the high-

Our aim was to identify the gene regulatory sequences of rif genes and to study the possible transcriptional co-regulation of var and rif genes using a combination of 5 0 RACE, transient transfection reporter assays, mobility shift assays and quantitative real-time PCR. We show that the transcriptional start site of a rif gene is 245 nucleotides from the ATG initiation codon. A functional promoter also lies within this region as shown by our transient transfection luciferase assays. To date, the transcriptional start sites of two other rif genes, arbitrarily named rif1 and rif3, have also been mapped using the 5 0 RACE technique by Kyes et al. (1999). These 5 0 ends were sequenced from a Palo Alto PAR + strain that is genetically different from the 3D7 strain used in this study. Comparing the GenBank sequences of rif1 and rif3 with our identified 5 0 end, we find none of the +1 sequence was the same. However, all three transcriptional start sites map close to the translational initiation site; 213, 260 and 245 nucleotides away for rif1, rif3 and ours, respectively. In P. falciparum, other transcriptional start sites have been mapped more than 1 kb away from the initiation codon, but for MSP2, pF16 and pF25 they have been mapped relatively close to the ATG (256, 175 and 267 bp, respectively) like the rif genes (Dechering et al., 1999; Wickham et al., 2003). The transient transfection luciferase assays show that there are two distinct repressor sites within the rif upstream

Fig. 8. Transcript levels of upsA var and its neighbouring rif in 3D7sir2D strain. Real-time PCR was performed on cDNA made from RNA harvested from early ring stage (for var transcript) and late ring/early trophozoite stage (for rif transcript) parasites from 3D7sir2D and wild-type strains. Absolute quantities of var and rif transcript were determined using standard curves and normalized to levels of transcript obtained for seryl-tRNA synthetase. Fold change labeled on top of the bars was calculated by dividing the amount of normalized transcript for 3D7sir2D by the amount of normalized transcript for the wild-type strain.

614

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

region. Through a series of EMSAs, we were able to determine that a CGCACAACAC element (within pRIF870) and a TATGCAatgATT element (within pRIF562) were responsible for protein binding to the repressor sites. In addition, mutation of CGCACAACAC and the complete removal of the TATGCAatgATT element resulted in an increase in luciferase expression as expected if these sites function as repressor elements. Genome-wide BLAST analyses show that the CGC ACAACAC element and the TATGCAatgATT element are exclusively associated with rif genes. Three distinct repressor elements, CPE1, SPE1 and SPE2, are present in the upstream regions of upsB and upsC var genes (Voss et al., 2003). Sequence comparison between CPE1, SPE1 and the rif repressors show no significant similarity. Within SPE2 there is a CG rich motif TATAAATTCGCAC CACTATGCACAATAAAG that is similar to the rif CGCACAACAC element (shown in italics). However, we believe that SPE2 functions in a different context to the CGCACAACAC element for the following reasons. First, SPE2 has a conserved sequence motif consisting of a direct (T/G)GTGC(A/G) repeat spaced by four nucleotides that is required for protein binding. We do not see such a conserved motif within the CGCACAACAC element. Second, SPE2 protein binding occurs only in schizont stages whereas the CGCACAACAC element bound proteins expressed in both trophozoite and schizont stages. However, if SPE2 and the CGCACAACAC element were found to bind the same proteins, it would provide an intriguing mechanism for the co-regulation of rif and var repression. From our studies in 3D7, the expression profile of the rif gene PF11_0009 shows maximal transcription at the late ring to early trophozoite stage. Therefore this gene requires at least two elements of gene regulation to account for the activation of transcription in the early ring stage and the repression of transcription past the early trophozoite stage. Our identification of two distinct repressor elements that show differential timing of protein binding provides a mechanism for the separation of these two transcriptional functions. Binding of the TATGCAatgATT element occurred during the early ring stage and also during the late ring stage when gene transcription is activated for the rif gene. However, deletion of this element results in an increase in luciferase expression, suggesting that this element functions as a repressor site rather than an activator. We propose that protein binding to the TATGCAatgATT element which is present in all rif genes orientated headto-head with an upsA var gene, can selectively repress transcription of this subset of rif genes early in the cycle. The mobility shift assays show that the CGCACAACAC element was bound by proteins expressed in the late trophozoite and schizont stages, when transcription is repressed for the rif genes. Therefore, proteins bound to the CGCACAACAC element may serve to repress transcription of rif genes in the later stages of the cell cycle. The upsA var genes are the only var genes in a head-tohead orientation with a rif gene. It is possible that this subset

of var and rif genes may be transcriptionally co-regulated as they share a common upstream region. Var gene transcription occurs earlier in the life cycle compared with rif gene transcription, and a possible mechanism that allows transcription co-regulation is that var gene expression would establish an open and transcriptionally active chromatin structure that would spread to the entire upstream region, thus allowing transcription of the neighbouring rif gene. However, using real-time PCR analyses in three separate unselected lines, we did not find any evidence that the upsA var and their neighbouring rif genes were transcriptionally co-regulated. Although the transcription profile of var and rif genes were different among the three independent lines, high level expression of a var gene did not correlate with high level expression of its neighbouring rif nor vice versa. Furthermore, transcription of upsA var genes is regulated by PfSir2 but only five of the eight neighbouring rif genes show that same dependence on PfSir2. Therefore, the other three rif genes may not be epigenetically regulated and their transcription regulation is dependent on something other than PfSir2. In terms of co-regulation of other multi-gene families, Sharp et al. (2006) also did not find any evidence of transcriptional co-regulation between stevor and var genes in both sexual and asexual parasites. However, it is still possible that stevor and rif transcription are co-regulated with var transcription for specific adhesion phenotypes in which they play a role, but as yet no shared adhesion phenotype has been described for these multi-gene families, making such transcription analyses impossible. We believe the data presented in this paper constitute the first detailed description of the cis-acting elements involved in rif gene transcription. Future analyses that lead to the identification of the proteins that bind to these elements will yield more insight into the mechanism of rif gene regulation. Studies of var gene regulation find that the silencing of var genes is associated with the presence of a var intron (Deitsch et al., 2001). A single var gene escapes the default transcriptional down-regulation of all other var genes and is exclusively transcribed by localization of its promoter at a transcriptionally permissive perinuclear site (Duraisingh et al., 2005; Ralph et al., 2005 Voss et al., 2006; Dzikowski et al., 2006; Marty et al., 2006). Further studies are needed to determine if rif genes also employ some of these mechanisms. By understanding the transcriptional mechanism behind clonal variation, greater progress can be made in the understanding of immune evasion and malaria pathogenesis. Acknowledgements We thank Alan Cowman, Brendan Crabb, Michael Duffy and Till Voss for critical reading of this manuscript. We thank Joanne McCoubrie for invaluable advice on transient transfection, and Jean Baptiste Boule, David Katz and Till Voss for advice with EMSA. This work was supported by an Australian Research Council APD fellowship

W.-H. Tham et al. / International Journal for Parasitology 37 (2007) 605–615

to WHT and a Wellcome Trust Fellowship to SJR. GVB is funded from a Program Grant of the National Health and Medical Research Council. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ijpara. 2006.11.006. References Abdel-Latif, M.S., Cabrera, G., Kohler, C., Kremsner, P.G., Luty, A.J., 2004. Antibodies to rifin: a component of naturally acquired responses to Plasmodium falciparum variant surface antigens on infected erythrocytes. Am. J. Trop. Med. Hyg. 71, 179–186. Abdel-Latif, M.S., Dietz, K., Issifou, S., Kremsner, P.G., Klinkert, M.Q., 2003. Antibodies to Plasmodium falciparum rifin proteins are associated with rapid parasite clearance and asymptomatic infections. Infect. Immun. 71, 6229–6233. Abdel-Latif, M.S., Khattab, A., Lindenthal, C., Kremsner, P.G., Klinkert, M.Q., 2002. Recognition of variant rifin antigens by human antibodies induced during natural Plasmodium falciparum infections. Infect. Immun. 70, 7013–7021. Bull, P.C., Lowe, B.S., Kortok, M., Molyneux, C.S., Newbold, C.I., Marsh, K., 1998. Parasite antigens on the infected red cell surface are targets for naturally acquired immunity to malaria. Nat. Med. 4, 358– 360. Calderwood, M.S., Gannoun-Zaki, L., Wellems, T.E., Deitsch, K.W., 2003. Plasmodium falciparum var genes are regulated by two regions with separate promoters, one upstream of the coding region and a second within the intron. J. Biol. Chem. 278, 34125–34132. Dechering, K.J., Kaan, A.M., Mbacham, W., Wirth, D.F., Eling, W., Konings, R.N., Stunnenberg, H.G., 1999. Isolation and functional characterization of two distinct sexual-stage-specific promoters of the human malaria parasite Plasmodium falciparum. Mol. Cell Biol. 19, 967–978. Deitsch, K.W., Calderwood, M.S., Wellems, T.E., 2001. Malaria. Cooperative silencing elements in var genes. Nature 412, 875–876. Duraisingh, M.T., Voss, T.S., Marty, A.J., Duffy, M.F., Good, R.T., Thompson, J.K., Freitas-Junior, L.H., Scherf, A., Crabb, B.S., Cowman, A.F., 2005. Heterochromatin silencing and locus repositioning linked to regulation of virulence genes in Plasmodium falciparum. Cell 121, 13–24. Dzikowski, R., Frank, M., Deitsch, K., 2006. Mutually exclusive expression of virulence genes by malaria parasites is regulated independently of antigen production. PLoS Pathog. 2, e22. Fernandez, V., Hommel, M., Chen, Q., Hagblom, P., Wahlgren, M., 1999. Small, clonally variant antigens expressed on the surface of the Plasmodium falciparum-infected erythrocyte are encoded by the rif gene family and are the target of human immune responses. J. Exp. Med. 10, 1393–1404. Gasser, S.M., Cockell, M.M., 2001. The molecular biology of the SIR proteins. Gene 279, 1–16.

615

Khattab, A., Klinkert, M.Q., 2006. Maurer’s clefts-restricted localization, orientation and export of a Plasmodium falciparum RIFIN. Traffic. (Epub ahead of print). Kyes, S., Pinches, R., Newbold, C., 2000. A simple RNA analysis method shows var and rif multigene family expression patterns in Plasmodium falciparum. Mol. Biochem. Parasitol. 105, 311–315. Kyes, S.A., Rowe, J.A., Kriek, N., Newbold, C.I., 1999. Rifins: a second family of clonally variant proteins expressed on the surface of red cells infected with Plasmodium falciparum. Proc. Natl. Acad. Sci. 96, 9333– 9338. Lambros, C., Vanderberg, J.P., 1979. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J. Parasitol. 65, 418–420. Lavstsen, T., Salanti, A., Jensen, A.T., Arnot, D.E., Theander, T.G., 2003. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions. Malar. J. 10, 27– 31. Marti, M., Good, R.T., Rug, M., Knuepfer, E., Cowman, A.F., 2004. Targeting malaria virulence and remodeling proteins to the host erythrocyte. Science 306, 1897–1898. Marty, A.J., Thompson, J.K., Duffy, M.F., Voss, T.S., Cowman, A.F., Crabb, B.S., 2006. Evidence that Plasmodium falciparum chromosome end clusters are cross-linked by protein and are the sites of both virulence gene silencing and activation. Mol. Microbiol. 62, 72–83. Militello, K.T., Wirth, D.F., 2003. A new reporter gene for transient transfection of Plasmodium falciparum. Parasitol. Res. 89, 154–157. Ralph, S.A., Scheidig-Benatar, C., Scherf, A., 2005. Antigenic variation in Plasmodium falciparum is associated with movement of var loci between subnuclear locations. Proc. Natl. Acad. Sci. USA 102, 5414–5419. Salanti, A., Staalsoe, T., Lavstsen, T., Jensen, A.T., Sowa, M.P., Arnot, D.E., Hviid, L., Theander, T.G., 2003. Selective upregulation of a single distinctly structured var gene in chondroitin sulphate A-adhering Plasmodium falciparum involved in pregnancy – associated malaria. Mol. Microbiol. 49, 179. Scherf, A., Hernandez-Rivas, R., Buffet, P., Bottius, E., Benatar, C., Pouvelle, B., Gysin, J., Lanzer, M., 1998. Antigenic variation in malaria: in situ switching, relaxed and mutually exclusive transcription of var genes during intra-erythrocytic development in Plasmodium falciparum. EMBO J. 17, 5418–5426. Sharp, S., Lavstsen, T., Fivelman, Q.L., Saeed, M., McRobert, L., Templeton, T.J., Jensen, A.T.R., Baker, D.A., Theander, T.G., Sutherland, C.J., 2006. Programmed transcription of the var gene family, but not of stevor, in Plasmodium falciparum gametocytes. Eukaryot. Cell 5, 1206–1214. Trager, W., Jenson, J.B., 1978. Cultivation of malarial parasites. Nature 273, 621–622. Voss, T.S., Healer, J., Marty, A.J., Duffy, M.F., Thompson, J.K., Beeson, J.G., Reeder, J.C., Crabb, B.S., Cowman, A.F., 2006. A var gene promoter controls allelic exclusion of virulence genes in Plasmodium falciparum malaria. Nature 439, 1004–1008. Voss, T.S., Kaestli, M., Vogel, D., Bopp, S., Beck, H.P., 2003. Identification of nuclear proteins that interact differentially with Plasmodium falciparum var gene promoters. Mol. Microbiol. 48, 1593–1607. Wickham, M.E., Thompson, J., Cowman, A.F., 2003. Characterisation of the merozoite surface protein-2 promoter using stable and transient transfection in Plasmodium falciparum. Mol. Biochem. Parasitol. 129, 147–156.