- Email: [email protected]
Identification of biofilm formation by Mycoplasma gallisepticum
Veterinary Microbiology 161 (2012) 96–103
Contents lists available at SciVerse ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Identification of biofilm formation by Mycoplasma gallisepticum Hongjun Chen 1, Shengqing Yu 1, Meirong Hu, Xiangan Han, Danqing Chen, Xusheng Qiu, Chan Ding * Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 518 Ziyue Road, Shanghai 200241, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 5 April 2012 Received in revised form 4 July 2012 Accepted 10 July 2012
Mycoplasma gallisepticum is the causative agent of chronic respiratory disease in chickens and of infectious sinusitis in turkeys, chickens, game birds, pigeons, and passerine birds of all ages. This study investigated the biofilm-producing ability of M. gallisepticum strains in an attempt to explain its intriguing persistence in commercial flocks. Eleven strains of M. gallisepticum were investigated for their biofilm formation, which varied considerably. Strains Nobilis MG 6/85, S6 (P5 and P20), D9604, and SU15 were strong biofilm producers. Strains Rlow (P10 and P100), NCL, CG5, YL4, and F were weak biofilm producers. Strains Vaxsafe MG ts-11 and F36 did not produce biofilm as verified using a crystal violet staining assay. In addition, highly differentiated biofilm structures of strain Nobilis MG 6/85 with characteristic stacks and channels were observed under confocal scanning laser microscopy and scanning electron microscopy. The carbohydrates (sucrose, glucose), disodium ethylenediaminetetraacetic acid (EDTA), antibiotics (tetracycline, gentamicin), or detergent (Triton X-100) were further used to determine their effects on biofilm formation. Biofilm formation was significantly inhibited by 5% sucrose and 5 mmol/L EDTA. Compared with the planktonic mycoplasma, these biofilm-grown cultures were more resistant to tetracycline, gentamicin, and Triton X-100 treatments. Furthermore, real-time reverse transcriptase-polymerase chain reaction was performed to investigate the transcription of several genes that may be associated with biofilm formation. The results indicated that the transcriptions of some genes in the biofilm-grown cells were markedly decreased, including vlhA3.03, csmC, hatA, gapA, neuraminidase, and mgc2. Our results will benefit further research on the persistence of M. gallisepticum infections. ß 2012 Elsevier B.V. All rights reserved.
Keywords: Mycoplasma gallisepticum Biofilm Formation Biofilm variation
1. Introduction Mycoplasma gallisepticum, which belongs to the class Mollicutes and the family Mycoplasmataceae (Ley, 2003), causes chronic respiratory disease in chickens and infectious sinusitis in turkeys, chickens, game birds, pigeons, and passerine birds of all ages (Levisohn and Kleven, 2000). Once infected, these birds become carriers that remain infectious throughout their lifetimes and pose potential threats to other bird populations (Levisohn and Kleven, 2000; Ley,
* Corresponding author. Tel.: +86 21 34293441; fax: +86 21 54081818. E-mail address: [email protected] (C. Ding). 1 These authors contributed equally to this work. 0378-1135/$ – see front matter ß 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetmic.2012.07.013
2003). The precise mechanism for the persistence of the pathogen in commercial flocks remains unknown. A number of bacterial strains are thought to persist in the environment via biofilm formation (Hu et al., 2010; Kaplan and Fine, 2002; LeChevallier et al., 1988; Van Houdt et al., 2004; Vergara-Irigaray et al., 2009). Biofilms consist of sessile bacteria that are attached to a substratum or other directly attached members of the bacterial colony and often surrounded by an extracellular polysaccharide matrix (Trappetti et al., 2011). Biofilm formation allows the pathogen to effectively resist antibiotic treatment by limiting antibiotic exposure to certain areas of the biofilm both chemically and mechanically (Hu et al., 2010). Despite the wealth of research data provided on the diverse biofilm-producing bacterial species and mycoplasmas studied to date (Garcia-Castillo et al., 2008; Henrich
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
et al., 2011; Justice-Allen et al., 2011; Kornspan et al., 2011; McAuliffe et al., 2006, 2008; Simmons et al., 2007; Simmons and Dybvig, 2007, 2009), biofilm formation has not been well studied in M. gallisepticum. In this study, 11 M. gallisepticum strains with different virulence were investigated for their biofilm formation abilities. In addition, the effects of various chemical treatments on biofilm formation and the transcriptions of several genes associated with biofilm formation were investigated. Our results will benefit further research on the persistence of M. gallisepticum infections. 2. Materials and methods 2.1. Strains and growth conditions The M. gallisepticum virulent strain Rlow, moderately virulent classical strain S6, low virulence strain F, and avirulent strain F36 were provided by the Chinese Veterinary Culture Collection Center. The live attenuated vaccine strain Vaxsafe MG ts-11 was purchased from the Merial Beijing Animal Health Co. Ltd., (Beijing, China), while the Nobilis MG 6/85 strain was purchased from Intervet Shanghai Center for Animal Health (Shanghai, China). Strains DC9604, SU15, NCL, YL4, and CG5 were isolated from air sac samples in chickens infected with chronic respiratory disease in China and identified according to their morphology and biochemical properties as well as pvpA gene amplification using polymerase chain reaction (PCR) as described previously (Jiang et al., 2009). All of the strains used in this study are listed in Table 1. The strains were grown in a complete ATCC1 No. 243 broth medium containing heart extraction broth (Becton and Dickinson Company, NJ, USA), yeast extract solution (Gibco, MD, USA), 10% horse serum, and 10% swine serum, or the strains were grown on solid medium containing 1% Noble agar (BD) as described previously (Chen et al., 2011). Escherichia coli DH5a was purchased from Invitrogen (CA, USA) and cultured in Luria Bertani medium. 2.2. Crystal violet staining A modified assay involving crystal violet (CV) staining was used to quantify the biofilm formation
97
(Hu et al., 2010). Briefly, the strains were grown in the medium at 37 8C for 72 h. The cultures were diluted to an optical density of 0.1 at 655 nm (OD655), and 200 mL of each cell suspension was transferred to 96-well microtiter plates (Corning, NY, USA). The plates were incubated at 37 8C in 5% CO2 for 72 h. The wells were washed gently three times with 200 mL of 0.01 mol/L phosphate-buffered saline (PBS), dried in an inverted position, and stained with 200 mL of 0.1% CV for 30 min at room temperature. The wells were then rinsed with distilled water four times and air dried, and 100 mL of 95% ethanol was added to dissolve the CV. The optical density at 595 nm (OD595) was determined using a Synergy 2 microplate reader (Biotek, VT, USA). E. coli DH5a was used as a negative control for biofilm formation. The isolates were identified as having formed biofilm if the OD595 reading exceeded 0.31, a value equivalent to the mean OD595 of E. coli DH5a plus two standard deviations. Strains were classified as strong biofilm producers, weak biofilm producers, or non-biofilm producers if OD595 was 1.00, 0.31–0.99, or 0.31, respectively. All samples were measured in triplicate, and the mean one standard deviation (mean STD) for each isolate was calculated from three independent experiments. 2.3. Confocal scanning laser microscopy (CLSM) The architecture of the biofilm formed by Nobilis MG 6/85 strain was analyzed by three-dimensional CLSM using a model LSM 510 laser scanning microscope mounted on an Axiovert 100 M apparatus (Carl Zeiss, Jena, Germany) with a Fluar 20/0.75 UV objective. The biofilms were grown on glass coverslips for 24 h, 48 h, 72 h, or 96 h and then stained using a BacLight bacterial viability assay kit (Invitrogen) according to the manufacturer’s instructions. Coverslips were mounted on glass slides and examined using an excitation wavelength of 488 nm for SYTO1 9 and an emission filter of 500–550 nm. For propidium iodide (PI)-stained samples, an excitation wavelength of 568 nm and an emission filter of 580–650 nm were used (Hu et al., 2010; Kornspan et al., 2011).
Table 1 Mycoplasma gallisepticum strains used in this study. Strains
Passagesa
Biofilm formationb
Note
Reference
Rlow Rlow S6 S6 F F36 Vaxsafe MG ts-11 Nobilis MG 6/85 DC9604 SU15 NCL YL4 CG5
10 100 5 20 <25 >36 <10 <10 <10 <10 <10 <10 <10
+++ +++ ++++ ++++ + – – ++++ +++ +++ + + +
Invasive Pathogenic Pathogenic Pathogenic Vaccine Apathogenic Vaccine Vaccine Pathogenic Pathogenic Pathogenic Pathogenic Pathogenic
CVCCc In this study CVCC In this study CVCC CVCC Merial Intervet Ding et al. (1999) Jiang et al. (2009) Jiang et al. (2009) Jiang et al. (2009) Jiang et al. (2009)
a b c
M. gallisepticum strains were passaged in ATCC No. 243 medium. ++++ and +++, strong biofilm producer (OD595 1.00); ++, weak biofilm producer (0.31 < OD595 < 0.99); –, non-biofilm producer (OD595 0.31). Chinese Veterinary Culture Collection Center.
98
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
2.4. Scanning electron microscopy (SEM) The microstructure of the biofilm formed by strain Nobilis MG 6/85 was observed using SEM. Briefly, the biofilm was washed three times in PBS, immersed in 2.5% glutaraldehyde in cacodylate buffer (0.1 mol/L, pH 7.3) for 30 min, and subsequently rinsed three times in cacodylate buffer. The biofilms were immersed in 1.0% osmium tetroxide in cacodylate buffer for 1 h, followed by a brief rinse in distilled water. The biofilms were dehydrated through a series of 50%, 75%, 95%, and 100% ethanol washes, followed by dehydration in a 1:1 (100% ethanol hexamethyldisilizane) solution for 4 min and two final dehydrations in 100% hexamethyldisilizane for 4 min. The biofilms were dried overnight and sputtercoated with gold palladium (McAuliffe et al., 2006; Simmons et al., 2007; Simmons and Dybvig, 2009). The samples were observed using an International Scientific Instruments ISI-SX-40 scanning electron microscope. 2.5. Biofilm development Both CV staining and CLSM analysis were used to evaluate the development of the biofilm formed by Nobilis MG 6/85. For the CV staining, the biofilms were grown in the wells of a 96-well microtiter plate and stained with CV as described previously (Chen et al., 2011; Fredheim et al., 2009; Hu et al., 2010). Biofilm development was evaluated by recording OD595 from 8 h to 104 h at 8 h intervals. All samples were assayed in triplicate. For the CLSM analysis, 3 mL of the diluted sample was transferred into each well of a 6-well polystyrene microtiter plate (Corning) in which sterile glass cover slips had already been placed. The plates were further incubated and the cover slips were collected at 12 h, 24 h, 36 h, 48 h, and 72 h. After being rinsed three times with PBS, the cover slips were stained with 0.1 mL of the Live/Dead BacLight viability staining reagent (Molecular Probes, OR, USA) for 15 min according to the manufacturer’s instructions. Analysis of the biofilm formation was performed using CLSM on a Zeiss LSM 510 laser scanning microscope mounted on an Axiovert 100 Mapparatus (Carl Zeiss) with a Fluar 20/0.75 UV objective. Zeiss LSM Image Browser software was used to analyze the biofilm images. 2.6. The influence of carbohydrates and EDTA on biofilm formation Sucrose, glucose, and disodium EDTA (Sigma, MO, USA) were tested for their effects on Nobilis MG 6/85 strain biofilm formation (Juda et al., 2008). The mycoplasma were cultured and assessed for biofilm formation as described above except for the addition of concentrations of sucrose (0.25%, 0.5%, 1%, 2%, or 5%), glucose (0.25%, 0.5%, 1%, 2%, or 5%), or EDTA (0.1, 0.5, or 1 mmol/L) to the complete ATCC No. 243 medium. The influence of EDTA on the mature biofilm of Nobilis MG 6/85 was also tested. Specifically, the supernatant was removed from wells containing 88 h cultures of Nobilis MG 6/85 presenting with mature biofilm. The non-adherent cells were removed by thorough washing with PBS, 200 mL of medium containing 0.1, 0.5, 1,
2, 5, or 10 mmol/L EDTA was added to the wells, and the mycoplasma were further cultured for 88 h at 37 8C with 5% CO2. Biofilm formation was quantified by CV staining as described above. 2.7. The influence of antibiotics and detergents on biofilm formation The minimal inhibitory concentration (MIC) of tetracycline, gentamicin, and Triton X-100 was determined for planktonic and biofilm-grown cultures of Nobilis MG 6/85 as described previously (Grenier et al., 2009) with minor modifications. The planktonic mycoplasma cultures were diluted at 88 h to 103 CCU/mL using complete ATCC No. 243 broth medium containing different concentrations of the three experimental chemicals produced by two-fold serial dilutions (1000–0.024 mg/mL). Two hundred microliters of each cell suspension was then transferred to a 96well microtiter plate. After static incubation for 88 h at 37 8C in 5% CO2, the growth was monitored by measurement at OD655. For the biofilm-grown mycoplasma, each well of the microtiter plate contained a preformed biofilm that had grown for 48 h. After aspiration of the culture supernatant, 200 mL of ATCC No. 243 medium was added and the plate was incubated for an additional 48 h at 37 8C. The biofilm was suspended by pipetting, and the growth was estimated by measurement at OD655. The MIC was defined as the lowest concentration at which there was no measurable growth. 2.8. Real-time RT-PCR (rRT-PCR) analysis Nobilis MG strain 6/85 was cultured in fresh liquid medium in 60 mm dishes. After 72 h, the planktonic mycoplasma in the suspended culture and the mycoplasma biofilm formed at the surface of the dishes were collected independently, and the total RNAs of the planktonic or biofilm-grown mycoplasma were isolated using a QIAamp ViralRNA Mini Kit (Qiagen Co., CA, USA) according to the manufacturer’s protocol. Primers were designed using Lasergene software suite (DNASTAR, WI, USA) and listed in Table 2. cDNAs were then synthesized using reverse transcriptase and the forward primers of the genes, including vlhA3.03 (mga0380), csmC (mga1142), hatA (mga1017), gapA (mga0934), neuraminidase (mga0329), mgc2 (mga0932), pvpAb (mga0256), enolase (mga0209), and 16S rRNA. The rRT-PCR was performed using a Mastercycle1 ep realplex 2.2 (Eppendorf Co., Germany). Each reaction contained a volume of 20 mL, including 1 mL of cDNA, 10 mL of SYBR Green Premix (2) (Takara Co., Dalian), 0.4 mL of ROX Dye (50), 0.2 mL per 50 pmol concentration of each primer, and 8.2 mL of dilution buffer. The cycling parameters were as follows: initial denaturation at 95 8C for 10 min followed by 40 cycles of denaturation at 95 8C for 10 s, annealing at 50 8C for 5 s, and extension at 72 8C for 20 s. The melting curve analysis was performed automatically by Eppendorf Mastercycler ep Realplex software, demonstrating that the melting peaks were expected to occur at a melting temperature of 80 8C. Ten-fold dilutions were prepared from strain Rlow
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103 Table 2 Primers used for real-time reverse transcriptase-polymerase chain reaction analysis. Genes
Primers a
Sequences
vlhA3.03
P8-Fwd P8-Revb
ATGAACTCCTGAAGCGAA TAATTGGGTATGTGGGTG
csmC
P5-Fwd P5-Rev
CGATTGGGGCTTCTTTTAG TGGGTGGTTCTCACTCTGA
hatA
P7-Fwd P7-Rev
CACCCCTGATTTTTACGA CCATCTCACATTCTGTTCTC
gapA
P3-Fwd P3-Rev
AGCCGTTGGTAGTGTGTTC CTGATGGCTTGCTTGGT
neuraminidase
P1-Fwd P1-Rev
ACATTTTTAATCGGAAGC AATTTCAAGATCCTCTTC
mgc2
P4-Fwd P4-Rev
CTTTGTGTTCTCGGGTGT AATCAGGGTTCGGAGGT
pvpAb
P6-Fwd P6-Rev
AGTTGTTGTGACTTCTTGACC TGGCTATTGGGGCTCTTAT
enolase
P2-Fwd P2-Rev
ATGGCAAAGACAAACAGT ACAAGCAACTGTAGGAAA
16S rRNA
P9-Fwd P9-Rev
AGCTCGTGTCGTGAGATGT AGGGGCATGATGATTTGAC
a b
Forward primer. Reverse primer.
99
(P10) standard culture DNA with an initial concentration of 10 ng/mL, and these dilutions were used as a template in the rRT-PCR. The experiments were performed in triplicate with five repeat wells. Compared with the cycle threshold (Ct) value of rRT-PCR for 16S rRNA, the Ct values of the planktonic and biofilm-grown mycoplasma were statistically analyzed using Student’s t test.
3. Results 3.1. Biofilm formation of M. gallisepticum strains The CV staining of the biofilms on the glass coverslips revealed striking variability in the various strains’ ability to successfully form biofilms. Of the 11 analyzed strains, Nobilis MG 6/85 and S6 (P5 and P20) formed prolific biofilms (OD595 > 1.5). Strains D9604 and SU15 displayed an intermediate level of biofilm formation. Strains Rlow (P10 and P100), YL4, NCL, and F were weak biofilm producers. Strains Vaxsafe MG ts-11 and F36 were determined to be non-biofilm producers (OD595 < 0.31) (Fig. 1A). To confirm these results, additional staining was undertaken using 40 ,6-diamidino-2-phenylindole. The results showed that the coverslips were densely populated by the Nobilis MG 6/85 and S6 (P5) strains, while only a few fields of view, if any, revealed the presence of biofilms of Vaxsafe MG ts-11 or F36 strains (Fig. 1B).
Fig. 1. Biofilm formation in different strains of Mycoplasma gallisepticum. (A) Biofilm formation was evaluated using a crystal violet staining assay. The Nobilis MG 6/85, S6 (P5 and P20), D9604, and SU15 strains were determined to be strong biofilm producers (OD595 > 1.0). The Rlow (P10 and P100), NCL, CG5, YL4, and F strains were determined to be weak biofilm producers (OD595 = 0.31–0.99). The Vaxsafe MG ts-11 and F36 strains were determined to be non-biofilm producing strains (OD595 < 0.31). The data are means from three independent experiments. Error bars represent standard deviations. (B) 40 ,6-Diamidino-2phenylindole staining of colonized coverslips revealed the formation of dense populations by the Nobilis MG 6/85 and S6 (P5) strains, while only a few fields, if any, showed the presence of the Vaxsafe MG ts-11 or F36 strains. The bars denote 100 mm.
100
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
Fig. 2. Scanning electron microscopy (SEM) analysis of the biofilm structure. The biofilm microstructure was analyzed using SEM. (A) Nobilis MG 6/85 (35,000) and (B) Vaxsafe MG ts-11 (50,000). The bars denote 100 nm.
3.2. SEM analysis of the biofilm structure SEM analysis was undertaken to evaluate the biofilm microstructure. The results indicated that M. gallisepticum, particularly Nobilis MG 6/85, formed a prolific biofilm. After culturing for 72 h in the wells of 96-well microtiter plates, Nobilis MG 6/85 produced a mature biofilm in which a large number of cell clusters intertwined to form a dense net enclosing abundant numbers of mycoplasma (Fig. 2A). The biofilm was highly structured with numerous microcolonies encased in a thick opaque extracellular matrix when viewed at 35,000 magnification. Vaxsafe MG ts-11 cells (the biofilm-negative control) were dispersed at 72 h, even at 50,000 magnification (Fig. 2B). 3.3. Assessment of biofilm development The Nobilis MG 6/85 strain was used for the assessment. For CV staining, samples were taken from 8 h to 104 h at 8 h intervals during incubation. OD595 readings showed that the biofilm formation was detectable as early as 24 h, with maturation of the biofilm being evident at 88 h and a peak OD595 reading of 2.45. Markedly decreased biofilms were noted at longer times of 96 h and 104 h (Fig. 3A).
Confocal imaging examination of the biofilm development was performed at 24 h, 48 h, 72 h, and 96 h of incubation. Very small mycoplasma aggregates were stained with Live/Dead BacLight viability stain at 24 h of incubation. At that time, the attached bacteria and aggregates consisted of a sparse single layer of cells (Fig. 3Ba). At 48 h, the majority of the cells in the biofilm were stained green, indicating that they were alive or possessed intact membranes. This finding represents the point at which the early architecture of the biofilm was completely formed and the cell clusters increased in both size and number (Fig. 3Bb). At 72 h, the biofilm had matured, and the microcolonies reached their maximum size, exhibiting complex architecture (Fig. 3Bc). At 96 h, the biofilm was even more dense and compact, with an increasing number of dead cells made evident by PI staining (Fig. 3Bd). The percentages of live and dead mycoplasma present in the biofilm and its thickness at each time interval were determined using the Zeiss LSM Image Browser software. Approximately 95.4%, 87.3%, 73.4%, and 31.9% of the mycoplasma in the examined biofilms were alive at 24 h, 48 h, 72 h, and 96 h, respectively. The observed biofilm thicknesses were 0.12 mm at
Fig. 3. Biofilm development. The Nobilis MG 6/85 strain was used to investigate biofilm development. (A) Kinetics of biofilm formation. The OD595 readings showed that biofilm formation was detectable as early as 24 h (OD595 0.31), with maturation occurring at 88 h (peak OD595 of 2.45) and a decrease evident at 96 h and 104 h. (B) Confocal images of biofilm formation. In all panels, the bar denotes 400 mm. Development of the biofilm was monitored at 24, 48, 72, and 96 h of incubation. (a) At 24 h, adhesion of bacteria and formation of small single-layered aggregates were evident, consisting of a sparse single layer of cells. (b) At 48 h, the early architecture of the biofilm was evident, with increased size and number of cell clusters. (c) At 72 h, biofilm maturation was apparent, and the microcolonies had reached their maximum size with an evident complex architecture. (d) At 96 h, the biofilm had become more dense and compact, with more dead cells evident as revealed by staining with propidium iodide.
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
101
24 h, 2.29 mm at 48 h, 3.17 mm at 72 h, and 6.48 mm at 96 h.
3.5. The influence of antibiotics and Triton X-100 on biofilm formation
3.4. The influence of carbohydrates and EDTA on biofilm formation
The MIC was used to evaluate the influence of tetracycline, gentamicin, and Triton X-100 on the biofilm formation of strain Nobilis MG 6/85. The results demonstrated that the mycoplasma grown in biofilm conditions were much less vulnerable to these chemicals than were the planktonic cells. The MIC of tetracycline, gentamicin, and Triton X-100 in the biofilm-grown cells was twice as high compared with those observed in the planktonic mycoplasmas (Table 3).
The impact of carbohydrates on M. gallisepticum biofilm formation was examined via measurement of the OD595 of strain Nobilis MG 6/85 in the presence of 0.25%, 0.5%, 1%, 2%, or 5% sucrose or glucose in complete ATCC No. 243 medium. The results showed that biofilm growth was improved at low glucose and sucrose concentrations. However, in the presence of a high 5% sucrose in the medium, biofilm growth was significantly decreased (P < 0.05, Fig. 4A and B). Biofilm formation was partially abolished by the addition of 0.1–1 mmol/L of EDTA (Fig. 4C). However, with elevated EDTA dosage, increasing biofilm destruction was observed in the mature biofilm at 88 h. At a concentration of 5 mmol/L EDTA, the mean OD595 value of the biofilm was 1.78, a significant decrease of >50% compared to the mean value of the mature bacteria (OD595 = 4.05) (Fig. 4D).
3.6. Gene transcription analysis The rRT-PCR analysis revealed that the transcriptions of some genes in the biofilm-grown cells were markedly decreased, including vlhA3.03 (mga0380), csmC (mga1142), hatA (mga1017), gapA (mga0934), neuraminidase (mga0329), and mgc2 (mga0932), compared with those in the planktonic cells (Table 4). Biofilm formation, however, exhibited no influence on the transcriptional levels of the pvpAb (mga0256) or enolase (mga0209) genes.
Fig. 4. The influence of carbohydrates and ethylenediaminetetraacetic acid (EDTA) on biofilm formation. The effects of various concentrations of glucose or sucrose on biofilm formation are shown in (A) and (B), respectively. The destructive effects of EDTA on developing or mature biofilm are shown in (C) and (D), respectively. Data are expressed as means taken from four independent experiments. The error bars represent standard deviations.
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
102
Table 3 Minimum inhibitory concentration of each agent to the planktonic and biofilm-grown Nobilis MG 6/85. Conditions
Planktonic Biofilm-grown
Antibiotics
Triton X-100 (%)
Tetracycline (mg/mL)
Gentamicin (mg/mL)
32 64
128 256
0.25 0.50
Table 4 Real-time reverse transcriptase-polymerase chain reaction analysis of the gene transcriptions in the biofilm-grown mycoplasma. Genes
D-valuea
Change in mRNA level
vlhA3.03 csmC hatA gapA neuraminidase mgc2 pvpAb enolase
3.31 4.87 2.49 2.18 2.75 1.23 0.35 0.45
###b ### ##c ## ## #d No changee No change
a Compared with mean cycle threshold (Ct) values of the 16S rRNA gene. b Ct volumes of mRNAs were decreased >30%. c Ct volumes of mRNAs were decreased 16–30%. d Ct volume of mRNA was decreased among 5–15%. e Ct volumes of mRNAs were decreased <5%, indicating no change.
4. Discussion Given their paucity of resistance mechanisms and lack of a cell wall, mycoplasmas can generally survive for only brief periods outside of the protection of laboratory cultures or animal hosts (Justice-Allen et al., 2011). The formation of highly varied biofilms has enabled several mycoplasma species to show enhanced survival outside of protective host environments (Garcia-Castillo et al., 2008; Justice-Allen et al., 2011; Kornspan et al., 2011; McAuliffe et al., 2006, 2008; Simmons et al., 2007; Simmons and Dybvig, 2007, 2009). To M. gallisepticum, only strain Rlow proved to form biofilm (McAuliffe et al., 2006). However, no further studies have been published until now. In this study, a large portion of examined M. gallisepticum strains (9 of 11) demonstrated the ability to produce biofilm. Different mycoplasma strains exhibited remarkable variations in the ability to form biofilms. Some strains (Nobilis MG 6/85, S6, Rlow, and D9604) were capable of forming a prolific biofilm, whereas others formed only a moderate biofilm or no biofilm at all. A combination of CLSM and SEM confirmed that Nobilis MG 6/85, the strongest biofilm-producing strain, can form a characteristically thick biofilm. In other experiments, however, researchers examined the virulence of specific M. gallisepticum strains in specific pathogen-free chickens, and the results indicated that strong biofilm production may not necessarily correlate with virulence but will enhance bacterial survival under non-favorable conditions (Demina et al., 2010). Comparatively, attenuated vaccine strain Nobilis MG 6/85 was shown to be the most prolific strain in the current study, indicating that the biofilm formation of this mycoplasma is not well correlated with its virulence.
Two carbohydrates were tested for their roles in biofilm production based on the hypothesis that these molecules may serve as energy resources for the formation of the extracellular matrix of M. gallisepticum biofilms (McAuliffe et al., 2006). In this context, glucose was shown to increase the biofilm formation of the Nobilis MG 6/85 strain at a final concentration of 0.25–5%. However, the growth of planktonic Nobilis MG 6/85 was significantly inhibited by the addition of 5% sucrose to the medium, suggesting that high concentrations of glucose or sucrose actually have a negative impact on biofilm formation by inhibiting M. gallisepticum, but the mechanism of this inhibition remains unknown. Findings of an earlier study suggested that EDTA prevents biofilm formation in strains of Riemerella anatipestifer, a Gram-negative bacterial pathogen that is responsible for septicemia in ducks and geese (Hu et al., 2010). In this case, the biofilm formation of Nobilis MG 6/ 85 strain was partially abolished by 0.1–1 mmol/L EDTA. In the mature biofilm at 88 h, a significant decrease of >50% was observed at a concentration of 5 mmol/L EDTA. Compared with the results of the earlier study, EDTA was less efficient at inhibiting M. gallisepticum than R. anatipestifer, though inhibition did still occur in both species (Juda et al., 2008). Antimicrobial agents often fail to kill bacteria that are enclosed in biofilms, which results in more resistant bacterial strains (Hamilton, 2002). The current study demonstrated that mycoplasma grown within a biofilm was more resistant to tetracycline, gentamicin, and Triton X-100 than were planktonic cells, suggesting that mycoplasma biofilms are likely more resistant to many commonly used antibiotics and detergents than their planktonic counterparts. This improved resistance suggests that some mycoplasma strains may form biofilms in vivo, thus inhibiting the activity of antimicrobial agents that are commonly delivered in bird feed and creating a prolonged infection that is particularly difficult to eradicate in commercial flocks. A few key genes are likely responsible for biofilm formation and its variety within a species (Parker et al., 2009; Soong et al., 2006). The current study has raised further questions regarding how M. gallisepticum adheres to surfaces and initiates biofilm formation since it lacks all of the genes that are commonly associated with biofilm formation in other documented bacterial species. Notable genes not present include sigB, normally present in Grampositive bacteria, and the staphylococcal genes icaABC, bap, or its homologs esp and bhp as well as arl or sarA (Lauderdale et al., 2009). In Mycoplasma pulmonis, the length of the Vsa tandem repeats is associated with the formation of biofilms or microcolonies and affects the interactions between mycoplasma cells in these complex formations (Simmons et al., 2007; Simmons and Dybvig, 2007). Some correlation has been observed between Vsp expression and their ability to form a biofilm for M. pulmonis and Mycobacterium bovis (McAuliffe et al., 2006; Simmons et al., 2007). Furthermore, strains that express VspF can only marginally form biofilm, whereas strains expressing VspO or VspB prolifically form biofilms
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
(Simmons et al., 2007). In M. gallisepticum, biofilm formation might also be related to membrane lipoproteins or cytadhesins such as neuraminidase (Kornspan et al., 2011; Sachse et al., 1996), GapA (Goh et al., 1998), and/or pvpA (Jiang et al., 2009). Of these genes, only the neuraminidase homologs in Haemophilus influenzae and Streptococcus pneumoniae are involved in biofilm formation and host colonization in the upper respiratory tract (Parker et al., 2009; Soong et al., 2006). The decreased level of these mRNAs in biofilms of M. gallisepticum indicates that planktonic mycoplasma may need gapA, mgc2, vlhA3.03, hatA, and neuraminidase to form biofilms. Moreover, the low level of these genes in the biofilms suggests that they are modulated by certain factors in vitro. This suggestion is amenable to the confirmation in vivo using transposon-mutated mycoplasma clones. The genes associated with M. gallisepticum biofilm formation and the interactions between mycoplasmas in these complex formations has not yet been fully characterized, although both past and present results point to the involvement of a network consisting of many proteins and factors in mycoplasma biofilm development (McAuliffe et al., 2006; Simmons et al., 2007). The full characterization of biofilm formation in M. gallisepticum may play a pivotal role in the assessment and combat of infectious avian disease resistance, which is particularly useful in commercial flocks (McAuliffe et al., 2006). Additional research, however, will be required to elucidate the precise gene and factor involvement in biofilm formation and variation in M. gallisepticum strains. Acknowledgments This research was sponsored by the National Natural Science Foundation of China (30871883 and 31001077), the Shanghai Agri & Tech Foundation (Grant No. 2007-112), and the Project of Basic Research for National Nonprofit Institute of China (2008JB13). References Chen, H., Yu, S., Shen, X., Chen, D., Qiu, X., Song, C., Ding, C., 2011. The Mycoplasma gallisepticum alpha-enolase is cell surface-exposed and mediates adherence by binding to chicken plasminogen. Microb. Pathog. 51, 285–290. Demina, I.A., Serebryakova, M.V., Ladygina, V.G., Rogova, M.A., Kondratov, I.G., Renteeva, A.N., Govorun, V.M., 2010. Proteomic characterization of Mycoplasma gallisepticum nanoforming. Biochem. 75, 1252–1257. Ding, C., Yu, S., Liu, X., Wang, Y., 1999. Cloning and sequencing of the Mycoplasma gallisepticum DNA Fragment Encoding 16S ribosomal RNA. Chinese J. Vet. Med. 2, 32–35. Fredheim, E.G., Klingenberg, C., Rohde, H., Frankenberger, S., Gaustad, P., Flaegstad, T., Sollid, J.E., 2009. Biofilm formation by Staphylococcus haemolyticus. J. Clin. Microbiol. 47, 1172–1180. Garcia-Castillo, M., Morosini, M.I., Galvez, M., Baquero, F., del Campo, R., Meseguer, M.A., 2008. Differences in biofilm development and antibiotic susceptibility among clinical Ureaplasma urealyticum and Ureaplasma parvum isolates. J. Antimicrob. Chemother. 62, 1027–1030. Goh, M.S., Gorton, T.S., Forsyth, M.H., Troy, K.E., Geary, S.J., 1998. Molecular and biochemical analysis of a 105 kDa Mycoplasma gallisepticum cytadhesin (GapA). Microbiology (Reading, England) 144 (Pt 11), 2971–2978.
103
Grenier, D., Grignon, L., Gottschalk, M., 2009. Characterisation of biofilm formation by a Streptococcus suis meningitis isolate. Vet. J. 179, 292–295. Hamilton, M.A., 2002. Testing antimicrobials against biofilm bacteria. J. AOAC Int. 85, 479–485. Henrich, B., Schmitt, M., Bergmann, N., Zanger, K., Kubitz, R., Haussinger, D., Pfeffer, K., 2011. Mycoplasma salivarium detected in a microbial community with Candida glabrata in the biofilm of an occluded biliary stent. J. Med. Microbiol. 59, 239–241. Hu, Q., Han, X., Zhou, X., Ding, S., Ding, C., Yu, S., 2010. Characterization of biofilm formation by Riemerella anatipestifer. Vet. Microbiol. 144, 429–436. Jiang, H.X., Chen, J.R., Yan, H.L., Li, X.N., Chen, Z.L., Zeng, Z.L., 2009. Molecular variability of DR-1 and DR-2 within the pvpA gene in Mycoplasma gallisepticum isolates. Avian Dis. 53, 124–128. Juda, M., Paprota, K., Jaloza, D., Malm, A., Rybojad, P., Gozdziuk, K., 2008. EDTA as a potential agent preventing formation of Staphylococcus epidermidis biofilm on polychloride vinyl biomaterials. Ann. Agric. Environ. Med. 15, 237–241. Justice-Allen, A., Trujillo, J., Corbett, R., Harding, R., Goodell, G., Wilson, D., 2011. Survival and replication of Mycoplasma species in recycled bedding sand and association with mastitis on dairy farms in Utah. J. Dairy Sci. 93, 192–202. Kaplan, J.B., Fine, D.H., 2002. Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria. Appl. Environ. Microbiol. 68, 4943–4950. Kornspan, J.D., Tarshis, M., Rottem, S., 2011. Adhesion and biofilm formation of Mycoplasma pneumoniae on an abiotic surface. Arch. Microbiol. 193, 833–836. Lauderdale, K.J., Boles, B.R., Cheung, A.L., Horswill, A.R., 2009. Interconnections between Sigma B, agr, and proteolytic activity in Staphylococcus aureus biofilm maturation. Infect. Immun. 77, 1623–1635. LeChevallier, M.W., Cawthon, C.D., Lee, R.G., 1988. Inactivation of biofilm bacteria. Appl. Environ. Microbiol. 54, 2492–2499. Levisohn, S., Kleven, S.H., 2000. Avian mycoplasmosis (Mycoplasma gallisepticum). Rev. Sci. Tech. 19, 425–442. Ley, D.H., 2003. Mycoplasma gallisepticum infection. In: Saif, Y.M., Barnes, H.J., Gilson, J.R., Fadly, A.M., McDougald, L.R., Swayne, D.E., Editorial Board for the American Association of Avian Pathologists, (Eds.), Diseases of Poultry. 11th ed. Iowa State Press, pp. 722–744. McAuliffe, L., Ayling, R.D., Ellis, R.J., Nicholas, R.A., 2008. Biofilm-grown Mycoplasma mycoides subsp. mycoides SC exhibit both phenotypic and genotypic variation compared with planktonic cells. Vet. Microbiol. 129, 315–324. McAuliffe, L., Ellis, R.J., Miles, K., Ayling, R.D., Nicholas, R.A., 2006. Biofilm formation by Mycoplasma species and its role in environmental persistence and survival. Microbiology 152, 913–922. Parker, D., Soong, G., Planet, P., Brower, J., Ratner, A.J., Prince, A., 2009. The NanA neuraminidase of Streptococcus pneumoniae is involved in biofilm formation. Infect. Immun. 77, 3722–3730. Sachse, K., Grajetzki, C., Rosengarten, R., Hanel, I., Heller, M., Pfutzner, H., 1996. Mechanisms and factors involved in Mycoplasma bovis adhesion to host cells. Zentralbl. Bakteriol. 284, 80–92. Simmons, W.L., Bolland, J.R., Daubenspeck, J.M., Dybvig, K., 2007. A stochastic mechanism for biofilm formation by Mycoplasma pulmonis. J. Bacteriol. 189, 1905–1913. Simmons, W.L., Dybvig, K., 2007. Biofilms protect Mycoplasma pulmonis cells from lytic effects of complement and gramicidin. Infect. Immun. 75, 3696–3699. Simmons, W.L., Dybvig, K., 2009. Mycoplasma biofilms ex vivo and in vivo. FEMS Microbiol. Lett. 295, 77–81. Soong, G., Muir, A., Gomez, M.I., Waks, J., Reddy, B., Planet, P., Singh, P.K., Kaneko, Y., Wolfgang, M.C., Hsiao, Y.S., Tong, L., Prince, A., 2006. Bacterial neuraminidase facilitates mucosal infection by participating in biofilm production. J. Clin. Invest. 116, 2297–2305. Trappetti, C., Ogunniyi, A.D., Oggioni, M.R., Paton, J.C., 2011. Extracellular matrix formation enhances the ability of Streptococcus pneumoniae to cause invasive disease. PloS one 6, e19844. Van Houdt, R., Aertsen, A., Jansen, A., Quintana, A.L., Michiels, C.W., 2004. Biofilm formation and cell-to-cell signalling in Gram-negative bacteria isolated from a food processing environment. J. Appl. Microbiol. 96, 177–184. Vergara-Irigaray, M., Valle, J., Merino, N., Latasa, C., Garcia, B., Ruiz de Los Mozos, I., Solano, C., Toledo-Arana, A., Penades, J.R., Lasa, I., 2009. Relevant role of fibronectin-binding proteins in Staphylococcus aureus biofilm-associated foreign-body infections. Infect. Immun. 77, 3978–3991.
Contents lists available at SciVerse ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Identification of biofilm formation by Mycoplasma gallisepticum Hongjun Chen 1, Shengqing Yu 1, Meirong Hu, Xiangan Han, Danqing Chen, Xusheng Qiu, Chan Ding * Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 518 Ziyue Road, Shanghai 200241, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 5 April 2012 Received in revised form 4 July 2012 Accepted 10 July 2012
Mycoplasma gallisepticum is the causative agent of chronic respiratory disease in chickens and of infectious sinusitis in turkeys, chickens, game birds, pigeons, and passerine birds of all ages. This study investigated the biofilm-producing ability of M. gallisepticum strains in an attempt to explain its intriguing persistence in commercial flocks. Eleven strains of M. gallisepticum were investigated for their biofilm formation, which varied considerably. Strains Nobilis MG 6/85, S6 (P5 and P20), D9604, and SU15 were strong biofilm producers. Strains Rlow (P10 and P100), NCL, CG5, YL4, and F were weak biofilm producers. Strains Vaxsafe MG ts-11 and F36 did not produce biofilm as verified using a crystal violet staining assay. In addition, highly differentiated biofilm structures of strain Nobilis MG 6/85 with characteristic stacks and channels were observed under confocal scanning laser microscopy and scanning electron microscopy. The carbohydrates (sucrose, glucose), disodium ethylenediaminetetraacetic acid (EDTA), antibiotics (tetracycline, gentamicin), or detergent (Triton X-100) were further used to determine their effects on biofilm formation. Biofilm formation was significantly inhibited by 5% sucrose and 5 mmol/L EDTA. Compared with the planktonic mycoplasma, these biofilm-grown cultures were more resistant to tetracycline, gentamicin, and Triton X-100 treatments. Furthermore, real-time reverse transcriptase-polymerase chain reaction was performed to investigate the transcription of several genes that may be associated with biofilm formation. The results indicated that the transcriptions of some genes in the biofilm-grown cells were markedly decreased, including vlhA3.03, csmC, hatA, gapA, neuraminidase, and mgc2. Our results will benefit further research on the persistence of M. gallisepticum infections. ß 2012 Elsevier B.V. All rights reserved.
Keywords: Mycoplasma gallisepticum Biofilm Formation Biofilm variation
1. Introduction Mycoplasma gallisepticum, which belongs to the class Mollicutes and the family Mycoplasmataceae (Ley, 2003), causes chronic respiratory disease in chickens and infectious sinusitis in turkeys, chickens, game birds, pigeons, and passerine birds of all ages (Levisohn and Kleven, 2000). Once infected, these birds become carriers that remain infectious throughout their lifetimes and pose potential threats to other bird populations (Levisohn and Kleven, 2000; Ley,
* Corresponding author. Tel.: +86 21 34293441; fax: +86 21 54081818. E-mail address: [email protected] (C. Ding). 1 These authors contributed equally to this work. 0378-1135/$ – see front matter ß 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetmic.2012.07.013
2003). The precise mechanism for the persistence of the pathogen in commercial flocks remains unknown. A number of bacterial strains are thought to persist in the environment via biofilm formation (Hu et al., 2010; Kaplan and Fine, 2002; LeChevallier et al., 1988; Van Houdt et al., 2004; Vergara-Irigaray et al., 2009). Biofilms consist of sessile bacteria that are attached to a substratum or other directly attached members of the bacterial colony and often surrounded by an extracellular polysaccharide matrix (Trappetti et al., 2011). Biofilm formation allows the pathogen to effectively resist antibiotic treatment by limiting antibiotic exposure to certain areas of the biofilm both chemically and mechanically (Hu et al., 2010). Despite the wealth of research data provided on the diverse biofilm-producing bacterial species and mycoplasmas studied to date (Garcia-Castillo et al., 2008; Henrich
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
et al., 2011; Justice-Allen et al., 2011; Kornspan et al., 2011; McAuliffe et al., 2006, 2008; Simmons et al., 2007; Simmons and Dybvig, 2007, 2009), biofilm formation has not been well studied in M. gallisepticum. In this study, 11 M. gallisepticum strains with different virulence were investigated for their biofilm formation abilities. In addition, the effects of various chemical treatments on biofilm formation and the transcriptions of several genes associated with biofilm formation were investigated. Our results will benefit further research on the persistence of M. gallisepticum infections. 2. Materials and methods 2.1. Strains and growth conditions The M. gallisepticum virulent strain Rlow, moderately virulent classical strain S6, low virulence strain F, and avirulent strain F36 were provided by the Chinese Veterinary Culture Collection Center. The live attenuated vaccine strain Vaxsafe MG ts-11 was purchased from the Merial Beijing Animal Health Co. Ltd., (Beijing, China), while the Nobilis MG 6/85 strain was purchased from Intervet Shanghai Center for Animal Health (Shanghai, China). Strains DC9604, SU15, NCL, YL4, and CG5 were isolated from air sac samples in chickens infected with chronic respiratory disease in China and identified according to their morphology and biochemical properties as well as pvpA gene amplification using polymerase chain reaction (PCR) as described previously (Jiang et al., 2009). All of the strains used in this study are listed in Table 1. The strains were grown in a complete ATCC1 No. 243 broth medium containing heart extraction broth (Becton and Dickinson Company, NJ, USA), yeast extract solution (Gibco, MD, USA), 10% horse serum, and 10% swine serum, or the strains were grown on solid medium containing 1% Noble agar (BD) as described previously (Chen et al., 2011). Escherichia coli DH5a was purchased from Invitrogen (CA, USA) and cultured in Luria Bertani medium. 2.2. Crystal violet staining A modified assay involving crystal violet (CV) staining was used to quantify the biofilm formation
97
(Hu et al., 2010). Briefly, the strains were grown in the medium at 37 8C for 72 h. The cultures were diluted to an optical density of 0.1 at 655 nm (OD655), and 200 mL of each cell suspension was transferred to 96-well microtiter plates (Corning, NY, USA). The plates were incubated at 37 8C in 5% CO2 for 72 h. The wells were washed gently three times with 200 mL of 0.01 mol/L phosphate-buffered saline (PBS), dried in an inverted position, and stained with 200 mL of 0.1% CV for 30 min at room temperature. The wells were then rinsed with distilled water four times and air dried, and 100 mL of 95% ethanol was added to dissolve the CV. The optical density at 595 nm (OD595) was determined using a Synergy 2 microplate reader (Biotek, VT, USA). E. coli DH5a was used as a negative control for biofilm formation. The isolates were identified as having formed biofilm if the OD595 reading exceeded 0.31, a value equivalent to the mean OD595 of E. coli DH5a plus two standard deviations. Strains were classified as strong biofilm producers, weak biofilm producers, or non-biofilm producers if OD595 was 1.00, 0.31–0.99, or 0.31, respectively. All samples were measured in triplicate, and the mean one standard deviation (mean STD) for each isolate was calculated from three independent experiments. 2.3. Confocal scanning laser microscopy (CLSM) The architecture of the biofilm formed by Nobilis MG 6/85 strain was analyzed by three-dimensional CLSM using a model LSM 510 laser scanning microscope mounted on an Axiovert 100 M apparatus (Carl Zeiss, Jena, Germany) with a Fluar 20/0.75 UV objective. The biofilms were grown on glass coverslips for 24 h, 48 h, 72 h, or 96 h and then stained using a BacLight bacterial viability assay kit (Invitrogen) according to the manufacturer’s instructions. Coverslips were mounted on glass slides and examined using an excitation wavelength of 488 nm for SYTO1 9 and an emission filter of 500–550 nm. For propidium iodide (PI)-stained samples, an excitation wavelength of 568 nm and an emission filter of 580–650 nm were used (Hu et al., 2010; Kornspan et al., 2011).
Table 1 Mycoplasma gallisepticum strains used in this study. Strains
Passagesa
Biofilm formationb
Note
Reference
Rlow Rlow S6 S6 F F36 Vaxsafe MG ts-11 Nobilis MG 6/85 DC9604 SU15 NCL YL4 CG5
10 100 5 20 <25 >36 <10 <10 <10 <10 <10 <10 <10
+++ +++ ++++ ++++ + – – ++++ +++ +++ + + +
Invasive Pathogenic Pathogenic Pathogenic Vaccine Apathogenic Vaccine Vaccine Pathogenic Pathogenic Pathogenic Pathogenic Pathogenic
CVCCc In this study CVCC In this study CVCC CVCC Merial Intervet Ding et al. (1999) Jiang et al. (2009) Jiang et al. (2009) Jiang et al. (2009) Jiang et al. (2009)
a b c
M. gallisepticum strains were passaged in ATCC No. 243 medium. ++++ and +++, strong biofilm producer (OD595 1.00); ++, weak biofilm producer (0.31 < OD595 < 0.99); –, non-biofilm producer (OD595 0.31). Chinese Veterinary Culture Collection Center.
98
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
2.4. Scanning electron microscopy (SEM) The microstructure of the biofilm formed by strain Nobilis MG 6/85 was observed using SEM. Briefly, the biofilm was washed three times in PBS, immersed in 2.5% glutaraldehyde in cacodylate buffer (0.1 mol/L, pH 7.3) for 30 min, and subsequently rinsed three times in cacodylate buffer. The biofilms were immersed in 1.0% osmium tetroxide in cacodylate buffer for 1 h, followed by a brief rinse in distilled water. The biofilms were dehydrated through a series of 50%, 75%, 95%, and 100% ethanol washes, followed by dehydration in a 1:1 (100% ethanol hexamethyldisilizane) solution for 4 min and two final dehydrations in 100% hexamethyldisilizane for 4 min. The biofilms were dried overnight and sputtercoated with gold palladium (McAuliffe et al., 2006; Simmons et al., 2007; Simmons and Dybvig, 2009). The samples were observed using an International Scientific Instruments ISI-SX-40 scanning electron microscope. 2.5. Biofilm development Both CV staining and CLSM analysis were used to evaluate the development of the biofilm formed by Nobilis MG 6/85. For the CV staining, the biofilms were grown in the wells of a 96-well microtiter plate and stained with CV as described previously (Chen et al., 2011; Fredheim et al., 2009; Hu et al., 2010). Biofilm development was evaluated by recording OD595 from 8 h to 104 h at 8 h intervals. All samples were assayed in triplicate. For the CLSM analysis, 3 mL of the diluted sample was transferred into each well of a 6-well polystyrene microtiter plate (Corning) in which sterile glass cover slips had already been placed. The plates were further incubated and the cover slips were collected at 12 h, 24 h, 36 h, 48 h, and 72 h. After being rinsed three times with PBS, the cover slips were stained with 0.1 mL of the Live/Dead BacLight viability staining reagent (Molecular Probes, OR, USA) for 15 min according to the manufacturer’s instructions. Analysis of the biofilm formation was performed using CLSM on a Zeiss LSM 510 laser scanning microscope mounted on an Axiovert 100 Mapparatus (Carl Zeiss) with a Fluar 20/0.75 UV objective. Zeiss LSM Image Browser software was used to analyze the biofilm images. 2.6. The influence of carbohydrates and EDTA on biofilm formation Sucrose, glucose, and disodium EDTA (Sigma, MO, USA) were tested for their effects on Nobilis MG 6/85 strain biofilm formation (Juda et al., 2008). The mycoplasma were cultured and assessed for biofilm formation as described above except for the addition of concentrations of sucrose (0.25%, 0.5%, 1%, 2%, or 5%), glucose (0.25%, 0.5%, 1%, 2%, or 5%), or EDTA (0.1, 0.5, or 1 mmol/L) to the complete ATCC No. 243 medium. The influence of EDTA on the mature biofilm of Nobilis MG 6/85 was also tested. Specifically, the supernatant was removed from wells containing 88 h cultures of Nobilis MG 6/85 presenting with mature biofilm. The non-adherent cells were removed by thorough washing with PBS, 200 mL of medium containing 0.1, 0.5, 1,
2, 5, or 10 mmol/L EDTA was added to the wells, and the mycoplasma were further cultured for 88 h at 37 8C with 5% CO2. Biofilm formation was quantified by CV staining as described above. 2.7. The influence of antibiotics and detergents on biofilm formation The minimal inhibitory concentration (MIC) of tetracycline, gentamicin, and Triton X-100 was determined for planktonic and biofilm-grown cultures of Nobilis MG 6/85 as described previously (Grenier et al., 2009) with minor modifications. The planktonic mycoplasma cultures were diluted at 88 h to 103 CCU/mL using complete ATCC No. 243 broth medium containing different concentrations of the three experimental chemicals produced by two-fold serial dilutions (1000–0.024 mg/mL). Two hundred microliters of each cell suspension was then transferred to a 96well microtiter plate. After static incubation for 88 h at 37 8C in 5% CO2, the growth was monitored by measurement at OD655. For the biofilm-grown mycoplasma, each well of the microtiter plate contained a preformed biofilm that had grown for 48 h. After aspiration of the culture supernatant, 200 mL of ATCC No. 243 medium was added and the plate was incubated for an additional 48 h at 37 8C. The biofilm was suspended by pipetting, and the growth was estimated by measurement at OD655. The MIC was defined as the lowest concentration at which there was no measurable growth. 2.8. Real-time RT-PCR (rRT-PCR) analysis Nobilis MG strain 6/85 was cultured in fresh liquid medium in 60 mm dishes. After 72 h, the planktonic mycoplasma in the suspended culture and the mycoplasma biofilm formed at the surface of the dishes were collected independently, and the total RNAs of the planktonic or biofilm-grown mycoplasma were isolated using a QIAamp ViralRNA Mini Kit (Qiagen Co., CA, USA) according to the manufacturer’s protocol. Primers were designed using Lasergene software suite (DNASTAR, WI, USA) and listed in Table 2. cDNAs were then synthesized using reverse transcriptase and the forward primers of the genes, including vlhA3.03 (mga0380), csmC (mga1142), hatA (mga1017), gapA (mga0934), neuraminidase (mga0329), mgc2 (mga0932), pvpAb (mga0256), enolase (mga0209), and 16S rRNA. The rRT-PCR was performed using a Mastercycle1 ep realplex 2.2 (Eppendorf Co., Germany). Each reaction contained a volume of 20 mL, including 1 mL of cDNA, 10 mL of SYBR Green Premix (2) (Takara Co., Dalian), 0.4 mL of ROX Dye (50), 0.2 mL per 50 pmol concentration of each primer, and 8.2 mL of dilution buffer. The cycling parameters were as follows: initial denaturation at 95 8C for 10 min followed by 40 cycles of denaturation at 95 8C for 10 s, annealing at 50 8C for 5 s, and extension at 72 8C for 20 s. The melting curve analysis was performed automatically by Eppendorf Mastercycler ep Realplex software, demonstrating that the melting peaks were expected to occur at a melting temperature of 80 8C. Ten-fold dilutions were prepared from strain Rlow
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103 Table 2 Primers used for real-time reverse transcriptase-polymerase chain reaction analysis. Genes
Primers a
Sequences
vlhA3.03
P8-Fwd P8-Revb
ATGAACTCCTGAAGCGAA TAATTGGGTATGTGGGTG
csmC
P5-Fwd P5-Rev
CGATTGGGGCTTCTTTTAG TGGGTGGTTCTCACTCTGA
hatA
P7-Fwd P7-Rev
CACCCCTGATTTTTACGA CCATCTCACATTCTGTTCTC
gapA
P3-Fwd P3-Rev
AGCCGTTGGTAGTGTGTTC CTGATGGCTTGCTTGGT
neuraminidase
P1-Fwd P1-Rev
ACATTTTTAATCGGAAGC AATTTCAAGATCCTCTTC
mgc2
P4-Fwd P4-Rev
CTTTGTGTTCTCGGGTGT AATCAGGGTTCGGAGGT
pvpAb
P6-Fwd P6-Rev
AGTTGTTGTGACTTCTTGACC TGGCTATTGGGGCTCTTAT
enolase
P2-Fwd P2-Rev
ATGGCAAAGACAAACAGT ACAAGCAACTGTAGGAAA
16S rRNA
P9-Fwd P9-Rev
AGCTCGTGTCGTGAGATGT AGGGGCATGATGATTTGAC
a b
Forward primer. Reverse primer.
99
(P10) standard culture DNA with an initial concentration of 10 ng/mL, and these dilutions were used as a template in the rRT-PCR. The experiments were performed in triplicate with five repeat wells. Compared with the cycle threshold (Ct) value of rRT-PCR for 16S rRNA, the Ct values of the planktonic and biofilm-grown mycoplasma were statistically analyzed using Student’s t test.
3. Results 3.1. Biofilm formation of M. gallisepticum strains The CV staining of the biofilms on the glass coverslips revealed striking variability in the various strains’ ability to successfully form biofilms. Of the 11 analyzed strains, Nobilis MG 6/85 and S6 (P5 and P20) formed prolific biofilms (OD595 > 1.5). Strains D9604 and SU15 displayed an intermediate level of biofilm formation. Strains Rlow (P10 and P100), YL4, NCL, and F were weak biofilm producers. Strains Vaxsafe MG ts-11 and F36 were determined to be non-biofilm producers (OD595 < 0.31) (Fig. 1A). To confirm these results, additional staining was undertaken using 40 ,6-diamidino-2-phenylindole. The results showed that the coverslips were densely populated by the Nobilis MG 6/85 and S6 (P5) strains, while only a few fields of view, if any, revealed the presence of biofilms of Vaxsafe MG ts-11 or F36 strains (Fig. 1B).
Fig. 1. Biofilm formation in different strains of Mycoplasma gallisepticum. (A) Biofilm formation was evaluated using a crystal violet staining assay. The Nobilis MG 6/85, S6 (P5 and P20), D9604, and SU15 strains were determined to be strong biofilm producers (OD595 > 1.0). The Rlow (P10 and P100), NCL, CG5, YL4, and F strains were determined to be weak biofilm producers (OD595 = 0.31–0.99). The Vaxsafe MG ts-11 and F36 strains were determined to be non-biofilm producing strains (OD595 < 0.31). The data are means from three independent experiments. Error bars represent standard deviations. (B) 40 ,6-Diamidino-2phenylindole staining of colonized coverslips revealed the formation of dense populations by the Nobilis MG 6/85 and S6 (P5) strains, while only a few fields, if any, showed the presence of the Vaxsafe MG ts-11 or F36 strains. The bars denote 100 mm.
100
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
Fig. 2. Scanning electron microscopy (SEM) analysis of the biofilm structure. The biofilm microstructure was analyzed using SEM. (A) Nobilis MG 6/85 (35,000) and (B) Vaxsafe MG ts-11 (50,000). The bars denote 100 nm.
3.2. SEM analysis of the biofilm structure SEM analysis was undertaken to evaluate the biofilm microstructure. The results indicated that M. gallisepticum, particularly Nobilis MG 6/85, formed a prolific biofilm. After culturing for 72 h in the wells of 96-well microtiter plates, Nobilis MG 6/85 produced a mature biofilm in which a large number of cell clusters intertwined to form a dense net enclosing abundant numbers of mycoplasma (Fig. 2A). The biofilm was highly structured with numerous microcolonies encased in a thick opaque extracellular matrix when viewed at 35,000 magnification. Vaxsafe MG ts-11 cells (the biofilm-negative control) were dispersed at 72 h, even at 50,000 magnification (Fig. 2B). 3.3. Assessment of biofilm development The Nobilis MG 6/85 strain was used for the assessment. For CV staining, samples were taken from 8 h to 104 h at 8 h intervals during incubation. OD595 readings showed that the biofilm formation was detectable as early as 24 h, with maturation of the biofilm being evident at 88 h and a peak OD595 reading of 2.45. Markedly decreased biofilms were noted at longer times of 96 h and 104 h (Fig. 3A).
Confocal imaging examination of the biofilm development was performed at 24 h, 48 h, 72 h, and 96 h of incubation. Very small mycoplasma aggregates were stained with Live/Dead BacLight viability stain at 24 h of incubation. At that time, the attached bacteria and aggregates consisted of a sparse single layer of cells (Fig. 3Ba). At 48 h, the majority of the cells in the biofilm were stained green, indicating that they were alive or possessed intact membranes. This finding represents the point at which the early architecture of the biofilm was completely formed and the cell clusters increased in both size and number (Fig. 3Bb). At 72 h, the biofilm had matured, and the microcolonies reached their maximum size, exhibiting complex architecture (Fig. 3Bc). At 96 h, the biofilm was even more dense and compact, with an increasing number of dead cells made evident by PI staining (Fig. 3Bd). The percentages of live and dead mycoplasma present in the biofilm and its thickness at each time interval were determined using the Zeiss LSM Image Browser software. Approximately 95.4%, 87.3%, 73.4%, and 31.9% of the mycoplasma in the examined biofilms were alive at 24 h, 48 h, 72 h, and 96 h, respectively. The observed biofilm thicknesses were 0.12 mm at
Fig. 3. Biofilm development. The Nobilis MG 6/85 strain was used to investigate biofilm development. (A) Kinetics of biofilm formation. The OD595 readings showed that biofilm formation was detectable as early as 24 h (OD595 0.31), with maturation occurring at 88 h (peak OD595 of 2.45) and a decrease evident at 96 h and 104 h. (B) Confocal images of biofilm formation. In all panels, the bar denotes 400 mm. Development of the biofilm was monitored at 24, 48, 72, and 96 h of incubation. (a) At 24 h, adhesion of bacteria and formation of small single-layered aggregates were evident, consisting of a sparse single layer of cells. (b) At 48 h, the early architecture of the biofilm was evident, with increased size and number of cell clusters. (c) At 72 h, biofilm maturation was apparent, and the microcolonies had reached their maximum size with an evident complex architecture. (d) At 96 h, the biofilm had become more dense and compact, with more dead cells evident as revealed by staining with propidium iodide.
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
101
24 h, 2.29 mm at 48 h, 3.17 mm at 72 h, and 6.48 mm at 96 h.
3.5. The influence of antibiotics and Triton X-100 on biofilm formation
3.4. The influence of carbohydrates and EDTA on biofilm formation
The MIC was used to evaluate the influence of tetracycline, gentamicin, and Triton X-100 on the biofilm formation of strain Nobilis MG 6/85. The results demonstrated that the mycoplasma grown in biofilm conditions were much less vulnerable to these chemicals than were the planktonic cells. The MIC of tetracycline, gentamicin, and Triton X-100 in the biofilm-grown cells was twice as high compared with those observed in the planktonic mycoplasmas (Table 3).
The impact of carbohydrates on M. gallisepticum biofilm formation was examined via measurement of the OD595 of strain Nobilis MG 6/85 in the presence of 0.25%, 0.5%, 1%, 2%, or 5% sucrose or glucose in complete ATCC No. 243 medium. The results showed that biofilm growth was improved at low glucose and sucrose concentrations. However, in the presence of a high 5% sucrose in the medium, biofilm growth was significantly decreased (P < 0.05, Fig. 4A and B). Biofilm formation was partially abolished by the addition of 0.1–1 mmol/L of EDTA (Fig. 4C). However, with elevated EDTA dosage, increasing biofilm destruction was observed in the mature biofilm at 88 h. At a concentration of 5 mmol/L EDTA, the mean OD595 value of the biofilm was 1.78, a significant decrease of >50% compared to the mean value of the mature bacteria (OD595 = 4.05) (Fig. 4D).
3.6. Gene transcription analysis The rRT-PCR analysis revealed that the transcriptions of some genes in the biofilm-grown cells were markedly decreased, including vlhA3.03 (mga0380), csmC (mga1142), hatA (mga1017), gapA (mga0934), neuraminidase (mga0329), and mgc2 (mga0932), compared with those in the planktonic cells (Table 4). Biofilm formation, however, exhibited no influence on the transcriptional levels of the pvpAb (mga0256) or enolase (mga0209) genes.
Fig. 4. The influence of carbohydrates and ethylenediaminetetraacetic acid (EDTA) on biofilm formation. The effects of various concentrations of glucose or sucrose on biofilm formation are shown in (A) and (B), respectively. The destructive effects of EDTA on developing or mature biofilm are shown in (C) and (D), respectively. Data are expressed as means taken from four independent experiments. The error bars represent standard deviations.
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
102
Table 3 Minimum inhibitory concentration of each agent to the planktonic and biofilm-grown Nobilis MG 6/85. Conditions
Planktonic Biofilm-grown
Antibiotics
Triton X-100 (%)
Tetracycline (mg/mL)
Gentamicin (mg/mL)
32 64
128 256
0.25 0.50
Table 4 Real-time reverse transcriptase-polymerase chain reaction analysis of the gene transcriptions in the biofilm-grown mycoplasma. Genes
D-valuea
Change in mRNA level
vlhA3.03 csmC hatA gapA neuraminidase mgc2 pvpAb enolase
3.31 4.87 2.49 2.18 2.75 1.23 0.35 0.45
###b ### ##c ## ## #d No changee No change
a Compared with mean cycle threshold (Ct) values of the 16S rRNA gene. b Ct volumes of mRNAs were decreased >30%. c Ct volumes of mRNAs were decreased 16–30%. d Ct volume of mRNA was decreased among 5–15%. e Ct volumes of mRNAs were decreased <5%, indicating no change.
4. Discussion Given their paucity of resistance mechanisms and lack of a cell wall, mycoplasmas can generally survive for only brief periods outside of the protection of laboratory cultures or animal hosts (Justice-Allen et al., 2011). The formation of highly varied biofilms has enabled several mycoplasma species to show enhanced survival outside of protective host environments (Garcia-Castillo et al., 2008; Justice-Allen et al., 2011; Kornspan et al., 2011; McAuliffe et al., 2006, 2008; Simmons et al., 2007; Simmons and Dybvig, 2007, 2009). To M. gallisepticum, only strain Rlow proved to form biofilm (McAuliffe et al., 2006). However, no further studies have been published until now. In this study, a large portion of examined M. gallisepticum strains (9 of 11) demonstrated the ability to produce biofilm. Different mycoplasma strains exhibited remarkable variations in the ability to form biofilms. Some strains (Nobilis MG 6/85, S6, Rlow, and D9604) were capable of forming a prolific biofilm, whereas others formed only a moderate biofilm or no biofilm at all. A combination of CLSM and SEM confirmed that Nobilis MG 6/85, the strongest biofilm-producing strain, can form a characteristically thick biofilm. In other experiments, however, researchers examined the virulence of specific M. gallisepticum strains in specific pathogen-free chickens, and the results indicated that strong biofilm production may not necessarily correlate with virulence but will enhance bacterial survival under non-favorable conditions (Demina et al., 2010). Comparatively, attenuated vaccine strain Nobilis MG 6/85 was shown to be the most prolific strain in the current study, indicating that the biofilm formation of this mycoplasma is not well correlated with its virulence.
Two carbohydrates were tested for their roles in biofilm production based on the hypothesis that these molecules may serve as energy resources for the formation of the extracellular matrix of M. gallisepticum biofilms (McAuliffe et al., 2006). In this context, glucose was shown to increase the biofilm formation of the Nobilis MG 6/85 strain at a final concentration of 0.25–5%. However, the growth of planktonic Nobilis MG 6/85 was significantly inhibited by the addition of 5% sucrose to the medium, suggesting that high concentrations of glucose or sucrose actually have a negative impact on biofilm formation by inhibiting M. gallisepticum, but the mechanism of this inhibition remains unknown. Findings of an earlier study suggested that EDTA prevents biofilm formation in strains of Riemerella anatipestifer, a Gram-negative bacterial pathogen that is responsible for septicemia in ducks and geese (Hu et al., 2010). In this case, the biofilm formation of Nobilis MG 6/ 85 strain was partially abolished by 0.1–1 mmol/L EDTA. In the mature biofilm at 88 h, a significant decrease of >50% was observed at a concentration of 5 mmol/L EDTA. Compared with the results of the earlier study, EDTA was less efficient at inhibiting M. gallisepticum than R. anatipestifer, though inhibition did still occur in both species (Juda et al., 2008). Antimicrobial agents often fail to kill bacteria that are enclosed in biofilms, which results in more resistant bacterial strains (Hamilton, 2002). The current study demonstrated that mycoplasma grown within a biofilm was more resistant to tetracycline, gentamicin, and Triton X-100 than were planktonic cells, suggesting that mycoplasma biofilms are likely more resistant to many commonly used antibiotics and detergents than their planktonic counterparts. This improved resistance suggests that some mycoplasma strains may form biofilms in vivo, thus inhibiting the activity of antimicrobial agents that are commonly delivered in bird feed and creating a prolonged infection that is particularly difficult to eradicate in commercial flocks. A few key genes are likely responsible for biofilm formation and its variety within a species (Parker et al., 2009; Soong et al., 2006). The current study has raised further questions regarding how M. gallisepticum adheres to surfaces and initiates biofilm formation since it lacks all of the genes that are commonly associated with biofilm formation in other documented bacterial species. Notable genes not present include sigB, normally present in Grampositive bacteria, and the staphylococcal genes icaABC, bap, or its homologs esp and bhp as well as arl or sarA (Lauderdale et al., 2009). In Mycoplasma pulmonis, the length of the Vsa tandem repeats is associated with the formation of biofilms or microcolonies and affects the interactions between mycoplasma cells in these complex formations (Simmons et al., 2007; Simmons and Dybvig, 2007). Some correlation has been observed between Vsp expression and their ability to form a biofilm for M. pulmonis and Mycobacterium bovis (McAuliffe et al., 2006; Simmons et al., 2007). Furthermore, strains that express VspF can only marginally form biofilm, whereas strains expressing VspO or VspB prolifically form biofilms
H. Chen et al. / Veterinary Microbiology 161 (2012) 96–103
(Simmons et al., 2007). In M. gallisepticum, biofilm formation might also be related to membrane lipoproteins or cytadhesins such as neuraminidase (Kornspan et al., 2011; Sachse et al., 1996), GapA (Goh et al., 1998), and/or pvpA (Jiang et al., 2009). Of these genes, only the neuraminidase homologs in Haemophilus influenzae and Streptococcus pneumoniae are involved in biofilm formation and host colonization in the upper respiratory tract (Parker et al., 2009; Soong et al., 2006). The decreased level of these mRNAs in biofilms of M. gallisepticum indicates that planktonic mycoplasma may need gapA, mgc2, vlhA3.03, hatA, and neuraminidase to form biofilms. Moreover, the low level of these genes in the biofilms suggests that they are modulated by certain factors in vitro. This suggestion is amenable to the confirmation in vivo using transposon-mutated mycoplasma clones. The genes associated with M. gallisepticum biofilm formation and the interactions between mycoplasmas in these complex formations has not yet been fully characterized, although both past and present results point to the involvement of a network consisting of many proteins and factors in mycoplasma biofilm development (McAuliffe et al., 2006; Simmons et al., 2007). The full characterization of biofilm formation in M. gallisepticum may play a pivotal role in the assessment and combat of infectious avian disease resistance, which is particularly useful in commercial flocks (McAuliffe et al., 2006). Additional research, however, will be required to elucidate the precise gene and factor involvement in biofilm formation and variation in M. gallisepticum strains. Acknowledgments This research was sponsored by the National Natural Science Foundation of China (30871883 and 31001077), the Shanghai Agri & Tech Foundation (Grant No. 2007-112), and the Project of Basic Research for National Nonprofit Institute of China (2008JB13). References Chen, H., Yu, S., Shen, X., Chen, D., Qiu, X., Song, C., Ding, C., 2011. The Mycoplasma gallisepticum alpha-enolase is cell surface-exposed and mediates adherence by binding to chicken plasminogen. Microb. Pathog. 51, 285–290. Demina, I.A., Serebryakova, M.V., Ladygina, V.G., Rogova, M.A., Kondratov, I.G., Renteeva, A.N., Govorun, V.M., 2010. Proteomic characterization of Mycoplasma gallisepticum nanoforming. Biochem. 75, 1252–1257. Ding, C., Yu, S., Liu, X., Wang, Y., 1999. Cloning and sequencing of the Mycoplasma gallisepticum DNA Fragment Encoding 16S ribosomal RNA. Chinese J. Vet. Med. 2, 32–35. Fredheim, E.G., Klingenberg, C., Rohde, H., Frankenberger, S., Gaustad, P., Flaegstad, T., Sollid, J.E., 2009. Biofilm formation by Staphylococcus haemolyticus. J. Clin. Microbiol. 47, 1172–1180. Garcia-Castillo, M., Morosini, M.I., Galvez, M., Baquero, F., del Campo, R., Meseguer, M.A., 2008. Differences in biofilm development and antibiotic susceptibility among clinical Ureaplasma urealyticum and Ureaplasma parvum isolates. J. Antimicrob. Chemother. 62, 1027–1030. Goh, M.S., Gorton, T.S., Forsyth, M.H., Troy, K.E., Geary, S.J., 1998. Molecular and biochemical analysis of a 105 kDa Mycoplasma gallisepticum cytadhesin (GapA). Microbiology (Reading, England) 144 (Pt 11), 2971–2978.
103
Grenier, D., Grignon, L., Gottschalk, M., 2009. Characterisation of biofilm formation by a Streptococcus suis meningitis isolate. Vet. J. 179, 292–295. Hamilton, M.A., 2002. Testing antimicrobials against biofilm bacteria. J. AOAC Int. 85, 479–485. Henrich, B., Schmitt, M., Bergmann, N., Zanger, K., Kubitz, R., Haussinger, D., Pfeffer, K., 2011. Mycoplasma salivarium detected in a microbial community with Candida glabrata in the biofilm of an occluded biliary stent. J. Med. Microbiol. 59, 239–241. Hu, Q., Han, X., Zhou, X., Ding, S., Ding, C., Yu, S., 2010. Characterization of biofilm formation by Riemerella anatipestifer. Vet. Microbiol. 144, 429–436. Jiang, H.X., Chen, J.R., Yan, H.L., Li, X.N., Chen, Z.L., Zeng, Z.L., 2009. Molecular variability of DR-1 and DR-2 within the pvpA gene in Mycoplasma gallisepticum isolates. Avian Dis. 53, 124–128. Juda, M., Paprota, K., Jaloza, D., Malm, A., Rybojad, P., Gozdziuk, K., 2008. EDTA as a potential agent preventing formation of Staphylococcus epidermidis biofilm on polychloride vinyl biomaterials. Ann. Agric. Environ. Med. 15, 237–241. Justice-Allen, A., Trujillo, J., Corbett, R., Harding, R., Goodell, G., Wilson, D., 2011. Survival and replication of Mycoplasma species in recycled bedding sand and association with mastitis on dairy farms in Utah. J. Dairy Sci. 93, 192–202. Kaplan, J.B., Fine, D.H., 2002. Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria. Appl. Environ. Microbiol. 68, 4943–4950. Kornspan, J.D., Tarshis, M., Rottem, S., 2011. Adhesion and biofilm formation of Mycoplasma pneumoniae on an abiotic surface. Arch. Microbiol. 193, 833–836. Lauderdale, K.J., Boles, B.R., Cheung, A.L., Horswill, A.R., 2009. Interconnections between Sigma B, agr, and proteolytic activity in Staphylococcus aureus biofilm maturation. Infect. Immun. 77, 1623–1635. LeChevallier, M.W., Cawthon, C.D., Lee, R.G., 1988. Inactivation of biofilm bacteria. Appl. Environ. Microbiol. 54, 2492–2499. Levisohn, S., Kleven, S.H., 2000. Avian mycoplasmosis (Mycoplasma gallisepticum). Rev. Sci. Tech. 19, 425–442. Ley, D.H., 2003. Mycoplasma gallisepticum infection. In: Saif, Y.M., Barnes, H.J., Gilson, J.R., Fadly, A.M., McDougald, L.R., Swayne, D.E., Editorial Board for the American Association of Avian Pathologists, (Eds.), Diseases of Poultry. 11th ed. Iowa State Press, pp. 722–744. McAuliffe, L., Ayling, R.D., Ellis, R.J., Nicholas, R.A., 2008. Biofilm-grown Mycoplasma mycoides subsp. mycoides SC exhibit both phenotypic and genotypic variation compared with planktonic cells. Vet. Microbiol. 129, 315–324. McAuliffe, L., Ellis, R.J., Miles, K., Ayling, R.D., Nicholas, R.A., 2006. Biofilm formation by Mycoplasma species and its role in environmental persistence and survival. Microbiology 152, 913–922. Parker, D., Soong, G., Planet, P., Brower, J., Ratner, A.J., Prince, A., 2009. The NanA neuraminidase of Streptococcus pneumoniae is involved in biofilm formation. Infect. Immun. 77, 3722–3730. Sachse, K., Grajetzki, C., Rosengarten, R., Hanel, I., Heller, M., Pfutzner, H., 1996. Mechanisms and factors involved in Mycoplasma bovis adhesion to host cells. Zentralbl. Bakteriol. 284, 80–92. Simmons, W.L., Bolland, J.R., Daubenspeck, J.M., Dybvig, K., 2007. A stochastic mechanism for biofilm formation by Mycoplasma pulmonis. J. Bacteriol. 189, 1905–1913. Simmons, W.L., Dybvig, K., 2007. Biofilms protect Mycoplasma pulmonis cells from lytic effects of complement and gramicidin. Infect. Immun. 75, 3696–3699. Simmons, W.L., Dybvig, K., 2009. Mycoplasma biofilms ex vivo and in vivo. FEMS Microbiol. Lett. 295, 77–81. Soong, G., Muir, A., Gomez, M.I., Waks, J., Reddy, B., Planet, P., Singh, P.K., Kaneko, Y., Wolfgang, M.C., Hsiao, Y.S., Tong, L., Prince, A., 2006. Bacterial neuraminidase facilitates mucosal infection by participating in biofilm production. J. Clin. Invest. 116, 2297–2305. Trappetti, C., Ogunniyi, A.D., Oggioni, M.R., Paton, J.C., 2011. Extracellular matrix formation enhances the ability of Streptococcus pneumoniae to cause invasive disease. PloS one 6, e19844. Van Houdt, R., Aertsen, A., Jansen, A., Quintana, A.L., Michiels, C.W., 2004. Biofilm formation and cell-to-cell signalling in Gram-negative bacteria isolated from a food processing environment. J. Appl. Microbiol. 96, 177–184. Vergara-Irigaray, M., Valle, J., Merino, N., Latasa, C., Garcia, B., Ruiz de Los Mozos, I., Solano, C., Toledo-Arana, A., Penades, J.R., Lasa, I., 2009. Relevant role of fibronectin-binding proteins in Staphylococcus aureus biofilm-associated foreign-body infections. Infect. Immun. 77, 3978–3991.