Identification of bluetongue virus and epizootic hemorrhagic disease virus serotypes in French Guiana in 2011 and 2012

Veterinary Microbiology 174 (2014) 78–85

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Identification of bluetongue virus and epizootic hemorrhagic disease virus serotypes in French Guiana in 2011 and 2012 Cyril Viarouge a, Renaud Lancelot c,d, Germain Rives b, Emmanuel Bre´ard a, Manuelle Miller b, Xavier Baudrimont b, Virginie Doceul a, Damien Vitour a, Ste´phan Zientara a, Corinne Sailleau a,* a

ANSES/INRA/ENVA-UPEC, UMR 1161 Virologie, 23 avenue du ge´ne´ral de Gaulle, 94700 Maisons Alfort, France DAAF Guyane Sante´ et Protection Animales et Ve´ge´tales, Parc Rebard, B.P. 5002, 97 305 Cayenne Cedex, France CIRAD, UMR CMAEE, Campus International de Baillarguet TA A-DIR/B, F34398 Montpellier, France d INRA, UMR 1309, Campus International de Baillarguet TA A-DIR/B, F34398 Montpellier, France b c

A R T I C L E I N F O

A B S T R A C T

Article history: Received 24 March 2014 Received in revised form 5 September 2014 Accepted 6 September 2014

In French Guiana, the sero- and viro-prevalence of Bluetongue virus (BTV) is high but the circulating serotypes remain unknown. No data are available regarding the prevalence of Epizootic hemorrhagic disease (EHD). This study was conducted to assess the prevalence and to identify the circulating serotypes of these two Orbiviruses in this region (BTV and EHDV). Blood samples were collected in main livestock areas, from 122 young cattle between June and August 2011, to perform virological (PCR and viral isolation) and serological (ELISA) analyses. Moreover, samples from sheep and goat showing BTV-like clinical signs and from newly imported animals were analyzed using the same assays. Results confirmed an important viral circulation, with viro- and seroprevalence of 85% and 84% and 60% and 40% for BTV and EHDV, respectively. Ten Orbivirus serotypes were identified (BTV-1, 2, 6, 10, 12, 13, 17 and 24, EHDV-1 and 6). The circulation of many serotypes in intertropical America and in the Caribbean region underlines the need to establish measures to monitor and control animal movements. ß 2014 Elsevier B.V. All rights reserved.

Keywords: Bluetongue Epizootic hemorrhagic disease Orbivirus

Bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV) belong to the Reoviridae family and the Orbivirus genus (MacLachlan and Osburn, 2004; Verwoerd and Erasmus, 2004). These two viruses have structural, antigenic and molecular similarities. Both viruses are transmitted to their host range (ruminants) by Culicoides * Corresponding author. Tel.: +33 149772707; fax: +33 143689762. E-mail addresses: [email protected] (C. Viarouge), [email protected] (R. Lancelot), [email protected] (G. Rives), [email protected] (E. Bre´ard), [email protected] (M. Miller), [email protected] (X. Baudrimont), [email protected] (V. Doceul), [email protected] (D. Vitour), [email protected] (S. Zientara), [email protected] (C. Sailleau). http://dx.doi.org/10.1016/j.vetmic.2014.09.006 0378-1135/ß 2014 Elsevier B.V. All rights reserved.

biting midges. Serological and molecular techniques for the laboratory diagnosis of these two diseases are similar. Both viruses have seven different structural proteins (VP1 to VP7) divided into two capsids (Roy, 2005). The outer capsid consists of VP2 and VP5, while VP7 and VP3 form the inner capsid that contain the viral genome and the replication complex (VP1, VP4 and VP6). VP2, the major constituent of the outer capsid, is exposed at the surface of the virus particle and determines the serotype specific antigen. Twenty-six BTV serotypes (Maan et al., 2011) and 7 EHDV serotypes have been identified (Anthony et al., 2009). The specific antigens of each serotype induce the production of serotype-specific neutralizing antibodies. Segment 2, which encodes VP2, is favored to study the genetic variability between different serotypes.

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

Five BTV serotypes have long been identified in North America, specifically BTV-10, 11, 13 and 17, whereas BTV-2 was restricted to the south-eastern USA until 2010 when this serotype infected California (MacLachlan et al., 2013). Since 1998, 10 additional serotypes (BTV-1, 3, 5, 6, 9, 12, 14, 19, 22, 24), that were previously identified as exotic, have been isolated in the south-eastern USA but were not associated to disease outbreaks (MacLachlan and Guthrie, 2010). In the 1980s, a major program of sentinel herds has shown that BTV-1, 3, 4, 6, 8, 12, 17 were circulating in Central America and the Caribbean region, presumably without clinical expression (Mo et al., 1994). In South America, the only serotypes detected by virological methods (virus isolation or genome detection by Polymerase Chain Reaction) were serotype 4 in Brazil in 1979 and more recently in Argentina (Lager et al., 2004; Legisa et al., 2013) and serotype 12 in the southern provinces of Brazil in two clinical episodes in 2001 (Clavijo et al., 2002). In the Caribbean islands of Martinique and Guadeloupe, BTV-1, 2, 3, 5, 9, 10, 11, 13, 14, 17, 18, 22 and 24 were detected by RT-PCR between 2006 and 2011, in sheep with clinical signs, as well as in newly imported cattle from continental France used as sentinel animals (MacLachlan et al., 2007; Sailleau, unpublished data). Little information is available about the circulation of EHDV in South America. A study conducted in the 1980s identified antibodies against EHDV-1 and -2

79

(Gumm et al., 1984). In the USA, two serotypes, EHDV-1 (New Jersey strain) and EHDV-2 (Alberta strain), are endemic (Chalmers et al., 1964) (Shope et al., 1955). Moreover, in 2006, an exotic strain of EHDV-6 was isolated from moribund and dead white-tailed deer (Odocoileus virginianus) in Indiana and Illinois, that originates from a reassortment between serotypes 2 and 6 co-circulating strains (Allison et al., 2010). In the Caribbean region, EHDV-2 and 6 were detected by RT-PCR in 2010 and 2011 in Martinique and Guadeloupe (Viarouge, unpublished data). In 2011, to assess the animal-health risks associated with livestock trade with Martinique and Guadeloupe, the French Guiana directorate of veterinary services launched a survey to determine which serotypes of BTV and EHDV were circulating on their territory, with respect to those found in the Caribbean districts. We report here the results of this survey conducted in local and imported cattle and in small ruminants. 1. Materials and methods 1.1. Study area Guiana is a South-American French district (83,846 km2), spanning between latitude 28 and 68N, mostly covered (96%) by the rain forest (Fig. 1). It benefits

Fig. 1. Geographical location of animals sampled in French Guiana in 2011 and 2012 (for imported sheep) and distribution of animals testing positive with RT-PCR.

80

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

from a humid, equatorial climate, with low amplitude in monthly mean temperature (between 25 and 30 8C), and relative humidity ranging from 80 to 90%. Rainfall shows a seasonal pattern, with a ‘‘small’’ rainy season from November to January, and a ‘‘large’’ rainy season from March to July. Livestock farming is mostly implemented in the coastal area. In 2011, 324 cattle farms (16,400 cattle heads), and 144 small ruminant farms (1600 sheep and 1800 goat heads) were recorded. Most cattle were pure and crossbred Brahman zebus (Bos indicus), with some Asian buffaloes (Bubalus bubalis), European breeds, and smallsize creole cattle. Sheep and goat breeds were Martinik and Creole, respectively. About 70% of cattle were detained in 30 farms and reared with semi-extensive management practices: free browsing in large cultivated grasslands, no supplemental feeding, and natural insemination. Health monitoring was limited to compulsory vaccination (rabies) and screening tests (brucellosis, tuberculosis), together with some acaricides and anthelminthic treatments. 1.2. Sampling frame Three series of blood samples were collected between June 2011 and February 2012 in four distinct areas (Fig. 1): 1.2.1. Young cattle and buffaloes One hundred and twenty two EDTA-blood and sera samples from cattle or buffalos were collected during the summer of 2011 (June, July and August) in four ecologically distinct areas (Fig. 1): from the drier (Saint-Laurent: 2500 mm year1) to the wetter (Cayenne–Matiti and Kaw: 3500 mm year1), with coastal area (Saint-Laurent), forest border (Sinnamary), sub-urban area (Cayenne–Matiti) and swamps (Kaw). An annual BTV serological incidence rate close to 100% was reported in a previous study (Lancelot et al., 1989). Therefore, to maximize the probability to observe a viremia, we sampled ruminants older than 6 months (loss of colostral antibodies) and younger than 1 year (acquired immunity possibly inhibiting viremia). Because the proportion of calves was rather low in herds (annual calving rate ca. 80%), we selected farms with herd size > 50 heads, i.e., 40 farms located in the main production areas (Fig. 1). For a given virus (serotype of BTV or EHDV) with an incidence rate m during the study period, we set the falsenegative rate b = 0.05 (probability not to detect the virus when it is present). The sample size n to detect the virus was n = (f/v)  log(b)/log(1  m), with f the time between successive visits (in days), and v the mean viremia length (in days). We set f to 1 month (30.44 days), and v to 20 days, which was a low estimate for viremia length (BarrattBoyes and MacLachlan, 1994; Singer et al., 2001). With these values, the overall minimum sample size ranged from 89 to 2 (m = 0.05 and 0.95, respectively). In practice, we randomly allocated the 40 selected farms in 3 groups which were visited between February and June 2011, with a target sample size of 5 calves in each farm (i.e. a total of 200 calves).

1.2.2. Animals with clinical signs In July 2011, 3 sheep showed clinical signs (animal 1: conjunctivitis, nasal flow; animal 2: ulcerative crusting on the lips, hemorrhagic ulcer on posterior cloves (crown); animal 3: dry scabs around the eyes and on the head, facial edema). These animals were sampled together with 4 others in the same flock. One sample was also collected from a goat showing clinical signs (inflammation of the vulva, crusting at the corners of the lips). All these animals were located in the sub-urban area (Cayenne–Matiti) (Fig. 1). 1.2.3. Imported sheep In December 2011, 74 sheep were imported from France and were introduced in farms located in the Matiti and Cayenne areas. Blood samples were taken from these animals 2 months after their introduction (February 2012). The imported animals from France were vaccinated against BTV-1 and 8 before arrival. In each sampling occasion, blood samples were taken from the jugular vein, in dry tubes for serological analyses, and in tubes containing ethylenediaminetetraacetic acid (EDTA) for virology. 1.3. Serological analysis 1.3.1. BTV cELISA BTV antibodies were detected with a VP7 competition enzyme-linked immunosorbent assay (cELISA, ID SCREEN1 Bluetongue Competition Kit, ID VET, France). The assay was performed according to manufacturer’s instructions. Sera with an inhibition percentage <35% were considered as positive. 1.3.2. EHDV cELISA The detection of EHDV VP7 antibodies was performed using a blocking ELISA (LSIVET EHDV Blocking, LSI, France). The assay was performed according to manufacturer’s instructions (positive cut-off value at 60% of blocking). 1.4. Molecular analysis 1.4.1. Nucleic acid sample preparation Total RNA was extracted from 100 mL of blood using the Kingfisher 96 robot and the MagVet Universal isolation kit (LSI; reference: MV384) according to manufacturer’s instructions. Finally, the RNAs were eluted with 80 mL of ultrapure water and used in specific EHDV and BTV reverse-transcription polymerase chain reaction (RT-PCR). 1.4.2. BTV group-specific RT-PCR Reverse transcription (RT) and amplification were performed using a commercial real-time RT-PCR kit (ADI-352, AES) according to manufacturer’s instructions. This kit allowed all 26 serotypes to be detected, by amplification of BTV segment 10 encoding non-structural protein 3 (NS3). 1.4.3. BTV subgroup-specific primers The Alignment (Megalign) of the segment 2 nucleotide sequences available in GenBank shows that the 26

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

serotypes are associated in different clusters (Maan et al., 2012). Sequence data were used to design one primer-pair for each cluster (Table 1) allowing the amplification of each serotype for each group. A total of eight primer-pairs were selected in a conserved genomic region and were used in conventional RT-PCR using the one-step RT-PCR Kit (Qiagen, France). Briefly, 2.5 mL of denatured RNA were added to a mixture containing 15.2 mL of RNase-free water, 5 mL of 5 QIAGEN one-step RT-PCR buffer, 1 mL of dNTP mix (400 mM of each), 0.6 mM of each primer, 1 mL of QIAGEN one-step RT-PCR enzyme. The amplification was carried out according to the following cycling parameters: 50 8C for 30 min, 95 8C for 15 min, followed by 40 cycles of 1 min at 94 8C, 1 min at 56 8C and 1 min at 72 8C. Ten microliter of each RT–RT-PCR products were analyzed by electrophoresis on a 2% agarose gel. 1.4.4. EHDV group-specific RT-PCR Reverse transcription and amplification were performed using a commercial real-time RT-PCR kit (EHDV, LSI) according to manufacturer’s instructions. This kit allows all 7 serotypes to be detected by amplification of BTV segment 9 encoding NS1. 1.4.5. EHDV subgroup-specific primers EHDV subgroup-specific primers targeting segment 2 (Sailleau et al., 2012) were used in conventional RT-PCR assays using the protocol described above. 1.4.6. Sequencing of amplified products To identify the serotype, the amplified RT-PCR products were directly sequenced in both directions, using the primer-pairs used for amplification (Eurofinsdna).

81

Sequences were assembled by SeqMan (DNAstar programs, Lasergene) and compared (Blastn 2.2.23) to the homologous sequences available in GenBank. Based on the segment 2 nucleotide sequences of identified serotypes available in GenBank, primers were then designed to sequence the coding region. Sequence alignments were performed using MegAlign-Clustal V method (DNAstar software). 1.5. Virus isolation 1.5.1. Isolation by embryonated chicken eggs Individual groups of 3 embryonated chicken eggs (ECE) were each intravenously inoculated with 0.1–0.2 mL of a 101 dilution of washed and lysed blood (Clavijo et al., 2000). The eggs were incubated for 5 days at 35 8C and examined daily using a cold candling lamp. The embryos that died within 24 h were discarded. The embryos that died between days 2 and 5 were removed and homogenized in a pestle using a mortar with sterile sand and Eagle’s MEM supplemented with 100 mg/mL streptomycin and 100 UI/mL penicillin to give a final 10% suspension (w/ v). The tissue homogenates were clarified by centrifugation at 2000  g for 10 min at 4 8C and inoculated into BHK21 cells. Inoculated flasks were incubated at 37 8C and examined under a microscope every day for 7 days to check for cytopathic effects (CPE). 1.5.2. Isolation by cell culture A confluent monolayer of Culicoides variipennis larvae cells (KC cells) was inoculated with 0.5 mL of a 101 dilution of washed and lysed blood. After 30 min at room temperature, the appropriate volume of Schneider medium (supplemented with 10% FCS) was added. Inoculated

Table 1 BTV subgroup-specific primers. Serotype

Forward primer

Sequence (5–30 )

Localization

Reverse primer

Sequence (5–3)

Localization

Amplified product size bp

BT4 BT10 BT11 BT17 BT20 BT24 BT26 BT3 BT13 BT16 BT6 BT14 BT21 BT8 BT18 BT23 BT5 BT9 BT7 BT19 BT12 BT15 BT22 BT1 BT2

BT AF

TGGTATGATTGGAGTGTTMG

1174–1192

BT AR

TCAGCTTGGYATCCTTTTC

1540–1522

366

BT BF

GGTTAYCAYATGTCTCAKTAC

1707–1726

BT BR

TACGTCTCATAAAGCAACGC

2555–2535

848

BT CF

GATGTTATGGTAATCAACTT

2202–2222

BT CR

GTTGATTAGTTCGTGCACC

2918–2900

716

BT DF

AGAGTGACGACCCATGG

1662–1678

BT DR

TCACCCCACGTCTTCGC

2205–2189

543

BT EF

GTTTATGCATTGCCAATCAG

2577–2596

BT ER

GTCCCATGTCACTGAGAC

2905–2888

328

BT FF

GATTTTATGGATGTGCAGC

352–370

BT FR

GGAAACATATTCGACCACC

1112–1094

760

BT GF

AGTGWYCCACCATGGAGG

BT GR

ATCGATCGCCCAYTTCATCC

350–331

342

BT HF

ACGCWCATAGACAGTGGAG

BT HR

ARCTCTCWGTCACGAGAG

2929–2912

643

8–26

2286–2304

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

82

flasks were incubated at 28 8C for 7 days. Cells were then lysed by freezing and thawing and were analyzed by RTPCR to check for the presence of the virus. If the cycle threshold (CT) value was >30, a second passage was carried out. If the CT was <30, the cells/supernatants were inoculated to BHK-21 cells following the protocol described above.

Table 3 BTV and EHDV isolates obtained from the three sets of samples. Number of isolates Young bovine animals (n = 122) Animals with clinical signs (n = 8) Imported animals (n = 74)

2. Results 2.1. Serological results

Total

Serological assays were carried out on samples from the study on young cattle and buffaloes. As the imported sheep from France were vaccinated against BTV-1 and 8 before arrival, they have not been tested as well as the sheep with clinical signs (only blood on EDTA was sampled). The seroprevalence rates were 85% for BTV and 60% for EHDV (Table 2). 2.2. RT-PCR analyses Of 122 animals tested in the study, 102 (84%) and 48 (40%) were positive for RNA-BTV and EHDV (CT range 24– 37 for BTV and 26–37 for EHDV), respectively (Table 2 and Fig. 1). In Saint Laurent area, none of the animals tested was positive for EHDV. In total, 47 animals (39%) were positive for both EHDV and BTV. Six out of 7 sheep, as well as the goat showing clinical signs, were positive for BTV. Out of 74 newly-imported sheep, 24 tested positive for BTV only. These sheep were not tested for EHDV by RTPCR. 2.3. Viral isolation and identification of serotypes A total of 23 Orbivirus isolates were obtained. Sequencing analysis of amplified products obtained with the subgroup-specific primers targeting segment 2 (Table 1; Sailleau et al., 2012) allowed the identification of 8 BTV serotypes, and 2 EHDV serotypes. Details are shown in Table 3. 2.4. Sequence analysis The full length segment 2 sequence of one strain of each isolated serotype was determined and compared (Blastn 2.2.29) to the homologous sequence available in GenBank (Fig. 2).

Table 2 Serological and virological prevalence rates for BTV and EHDV in cattle sampled in Guiana, 2011 (n = 122). Virus

Serological prevalence rate (%)

CI 95%

Virological prevalence rate (%)

CI 95%

BTV EHDV

85 60

[85; 92] [51; 69]

84 40

[77; 90] [31; 49]

CI: confidence interval.

13

3 6

23

Identified serotypes BTV

EHDV

1(1), 2(1), 10(2), 12(1), 13(2), 17(1), 24(4) 2(1), 13(1), 17(1)

1(1), 6*

2(1), 6 (1), 12 (1), 13(2), 24(1) 8

2

(X) Number of isolates for each serotype. * No isolate, identification by sequencing analysis.

3. Discussion This study showed an intense Orbivirus circulation in French Guiana with a high prevalence rate for both BTV (84%) and EHDV (40%) in calves, showing that domestic ruminants were exposed to a strong infection pressure at an early age. Newly imported animals were also exposed to the same infection pressure. Indeed, about 30% of sheep imported in December 2011 were BTV positive only 2 months after importation. Given the relatively short period of viremia in sheep (varying from 11 to 40 days depending on different reports) (Bonneau et al., 2002; Koumbati et al., 1999; Richards et al., 1988), it is likely that even more animals were infected. Surprisingly no clinical signs were reported in these sheep while we identified BTV-2, 13 and 17 (Table 3) causing clinical signs in a sheep farm located in the same region (Matiti Cayenne). We can speculate that BTV-17 could be responsible for the clinical signs (no disease was reported on sheep infected with the two other serotypes); however, others factors such as the animal health status of the herd and the breed have to be taken into account in the induction of the disease Concerning EHDV, the observed serological and virological prevalence rates were lower than for BTV (Table 2). Also, lower virus transmission was observed in Saint Laurent. This coastal area was the driest region in our sample, containing many irrigated rice fields possibly less favorable for Culicoides ecology than other regions. In this study, BTV-1 and 2 have been isolated. In literature, there are not data about isolation of these 2 BTV serotypes in South America. MacLachlan et al. (2013) mention ‘‘C. insignis is the major vector of multiple BTV serotypes (including BTV 1–4, 6, 8, 12, 17, 19, 20, and probably others) in the Caribbean basin, Central America, and South America’’ without any more precision about the geographic location of these BTV serotypes. BTV-10, 12, 14, 13, 17 and 24 had been previously identified in South America (Homan et al., 1985; Lancelot et al., 1989). More recently BTV-4 was isolated in Argentina and Brazil (Legisa et al., 2013, 2014). We reported the first isolation of EHDV-1 and the first detection of EHDV-6 genome, thus confirming previous findings showing the presence of this Orbivirus in this area

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

83

Fig. 2. Phylogenetic trees of full-length segment 2 showing relationships between: (A) BTV isolates and homologous BTV serotypes (Genbank) (B) EHDV isolates and homologous EHDV serotypes (GenBank).

84

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

(Gumm et al., 1984). EHDV-6 was detected in 2010 in Martinique and Guadeloupe islands (Viarouge, unpublished data), but never reported in South America. BTV-6 was detected in recently imported sheep, but was not found in cattle a few months earlier. The list of Orbivirus serotypes circulating in Guiana reported in this study should not be considered as exhaustive and the work initiated in this study should be continued. We described a method to easily identify BTV serotypes. For this purpose, we selected sub-group primers, allowing the amplification of serotypes in each cluster (Table 1). These RT-PCRs, supplemented by nucleotide sequencing, were successfully used to identify serotypes of BTV directly isolated from blood or infected culture cells. Our method for identifying BTV serotypes (PCR + sequencing) used primers targeting genome regions of segment 2 more conserved than those used before (Maan et al., 2012). The use of a less selective RT-PCR (amplification of more than one serotype) can be an advantage in the case of mutations on the segment 2 which might cause failure of the typespecific RT-PCR. Moreover, the sequence data allowed both formal identification of the Orbivirus serotypes and provided useful information about the virus strains. Phylogenetic comparison of segment 2 sequences helped understanding the epidemiology of the virus. Indeed, phylogenetic analyses of segment 2 (encoding the serotype-specific protein VP2) of BTV and EHDV showed a strong correlation with the Orbivirus serotype (Fig. 2). The sequence analysis of the BTV-2 isolate showed a close relation with the BTV-2 isolated in California in

2010 (MacLachlan et al., 2013). The two isolates shared 98% of nucleotide identity, when only 93% and 91% were found with BTV-2 isolated in Florida in 1999 (accession number AY855267) and BTV-2 isolated in the French Martinique island in 2006 (accession number HQ222824), respectively. BTV-6, 13 and 17 isolates were most closely related to isolates from the USA (homology ranging from 92 to 95%). BTV-10 and 24 isolates showed a highest homology (96 and 93%, respectively) with isolates from the Caribbean basin (Martinique and Guadeloupe Island). Only BTV-1 and 12 isolates appeared to be out of a cluster. BTV-1 isolate shared only 87% of nucleotide identity with isolates from South Africa, China or France and BTV-12, 88 or 89% with isolates from Africa, Japan or Taiwan. The comparison of segment-2 sequences for EHDV-1 showed a highest homology (92%) with the USA strain New Jersey isolated in 1955 and only 84% identity with an isolate from La Reunion island (near Madagascar). Concerning EHDV-6, the nucleotide sequence of segment 2 was 97% identical to the EHDV-6 Australian strain (CSIRO753), EHDV6/2 reassortant (Allison et al., 2010) and EHDV-6 strain detected in Martinique and Guadeloupe. To better elucidate the origin of all these isolates, it would be useful to complete this study by sequencing the full virus genome. Out of the 8 BTV serotypes detected in Guiana, BTV-6 and BTV-12 had never been detected in Martinique and Guadeloupe but were detected in Trinidad and Tobago, and Puerto Rico (Legisa et al., 2014). Similarly, BTV-3, 5, 9, 11, 14, 18 and 22 were detected in the Caribbean islands, but

Fig. 3. BTV and EHDV serotypes isolated or detected in the Martinique and Guadeloupe between 2006 and 2011 and in Guiana in 2011 and 2012.

C. Viarouge et al. / Veterinary Microbiology 174 (2014) 78–85

were not observed in Guiana. Regarding EHDV, serotype 6 was detected in the 3 districts but EHDV-1 was only detected in Guiana (Fig. 3). It remains unclear why so few clinical signs were reported in this area. It should be emphasized that most BTV-infected ruminants develop mild or no obvious disease, especially in BTV-enzootic areas (MacLachlan and Osburn, 2006) and domestic ruminants infected with EHDV tend to develop unapparent to mild infection (MacLachlan and Osburn, 2004). However, it cannot be ruled out that some clinical cases occurred in the field and are not reported. Currently, no mitigation measures are taken in this French district and it seems utopian to manage the viral circulation. Indeed, the type of breeding (semi-extensive management practices) makes it difficult to monitor the vectors spread. Moreover, the low sanitary impact and the important number of BTV serotypes that are circulating make a vaccination strategy hard to implement. As shown in Fig. 3, the list of Orbivirus serotypes found in the Caribbean region and in Guiana is somewhat different. Therefore, there is a high risk of introducing new serotypes with live animal trade between these regions. Such introduction would inevitably increase the risk of emergence of reassortant viruses which can acquire a possible virulent phenotype. Such phenomenon has already been identified in the USA where the reassortment between a EHDV-6 strain of unknown origin and a endemic strain of EHDV-2 generated a reassortant virus able to cause severe outbreaks in deer (Allison et al., 2010). More recently, the OIE Reference Laboratory for Bluetongue in Italy (Lorusso et al., 2013) identified a reassortant strain BTV-4/1 during outbreaks in sheep (Sardinia-2012) caused by BTV-1 and BTV-4. References Allison, A.B., Goekjian, V.H., Potgieter, A.C., Wilson, W.C., Johnson, D.J., Mertens, P.P.C., Stallknecht, D.E., 2010. Detection of a novel reassortant epizootic hemorrhagic disease virus (EHDV) in the USA containing RNA segments derived from both exotic (EHDV-6) and endemic (EHDV-2) serotypes. J. Gen. Virol. 91, 430–439. Anthony, S.J., Maan, S., Maan, N., Kgosana, L., Bachanek-Bankowska, K., Batten, C., Darpel, K.E., Sutton, G., Attoui, H., Mertens, P.P.C., 2009. Genetic and phylogenetic analysis of the outer-coat proteins VP2 and VP5 of epizootic haemorrhagic disease virus (EHDV): comparison of genetic and serological data to characterise the EHDV serogroup. Virus Res. 145, 200–210. Barratt-Boyes, S.M., MacLachlan, N.J., 1994. Dynamics of viral spread in bluetongue virus infected calves. Vet. Microbiol. 40, 361–371. Bonneau, K.R., DeMaula, C.D., Mullens, B.A., MacLachlan, N.J., 2002. Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus-infected cattle and sheep. Vet. Microbiol. 88, 115–125. Chalmers, G.A., Vance, H.N., Mitchell, G.J., 1964. An outbreak of epizootic hemorrhagic disease in wild ungulates in alberta. Wildl. Dis. 6. Clavijo, A., Heckert, R.A., Dulac, G.C., Afshar, A., 2000. Isolation and identification of bluetongue virus. J. Virol. Methods 87, 13–23. Clavijo, A., Sepulveda, L., Riva, J., Pessoa-Silva, M., Tailor-Ruthes, A., Lopez, J.W., 2002. Isolation of bluetongue virus serotype 12 from an outbreak of the disease in South America. Vet. Rec. 151, 301–302. Gumm, I.D., Taylor, W.P., Roach, C.J., Alexander, F.C., Greiner, E.C., Gibbs, E.P., 1984. Serological survey of ruminants in some Caribbean and

85

South American countries for type-specific antibody to bluetongue and epizootic haemorrhagic disease viruses. Vet. Rec. 114, 635–638. Homan, E.J., Lorbacher de Ruiz, H., Donato, A.P., Taylor, W.P., Yuill, T.M., 1985. A preliminary survey of the epidemiology of bluetongue in Costa Rica and northern Colombia. J. Hyg. 94, 357–363. Koumbati, M., Mangana, O., Nomikou, K., Mellor, P.S., Papadopoulos, O., 1999. Duration of bluetongue viraemia and serological responses in experimentally infected European breeds of sheep and goats. Vet. Microbiol. 64, 277–285. Lager, I.A., Duffy, S., Miquet, J., Vagnozzi, A., Gorchs, C., Draghi, M., Cetra, B., Soni, C., Hamblin, C., Maan, S., Samuel, A.R., Mertens, P.P., Ronderos, M., Ramirez, V., 2004. Incidence and isolation of bluetongue virus infection in cattle of the Santo Tome Department, Corrientes Province, Argentina. Vet. Ital. 40, 141–144. Lancelot, R., Calvez, D., Waller, J., Kremer, M., Sanite, L., Lefe`vre, P.C., 1989. Observations e´pide´miologiques sur la fie`vre catarrhale du mouton (bluetongue) en Guyane franc¸aise. E´pide´miol. Sante´ Anim. 15, 103–116. Legisa, D., Gonzalez, F., De Stefano, G., Pereda, A., Dus Santos, M.J., 2013. Phylogenetic analysis of bluetongue virus serotype 4 field isolates from Argentina. J. Gen. Virol. 94, 652–662. Legisa, D.M., Gonzalez, F.N., Dus Santos, M.J., 2014. Bluetongue virus in South America, Central America and the Caribbean. Virus Res. 182, 87–94, http://dx.doi.org/10.1016/j.virusres.2013.10.030. Lorusso, A., Sghaier, S., Carvelli, A., Di Gennaro, A., Leone, A., Marini, V., Pelini, S., Marcacci, M., Rocchigiani, A.M., Puggioni, G., Savini, G., 2013. Bluetongue virus serotypes 1 and 4 in Sardinia during autumn 2012: new incursions or re-infection with old strains? Infect. Genet. Evol. 19, 81–87. Maan, N.S., Maan, S., Belaganahalli, M.N., Ostlund, E.N., Johnson, D.J., Nomikou, K., Mertens, P.P., 2012. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2. PLOS ONE 7, e32601. Maan, S., Maan, N.S., Nomikou, K., Veronesi, E., Bachanek-Bankowska, K., Belaganahalli, M.N., Attoui, H., Mertens, P.P.C., 2011. Complete genome characterisation of a novel 26th bluetongue virus serotype from Kuwait. PLoS ONE 6 (10), e26147. MacLachlan, N.J., Osburn, B.I., 2004. Epizootic haemorrhagic disease of deer. In: Infectious Diseases of Livestock. second ed., pp. 1227–1230. MacLachlan, N.J., Guthrie, A.J., 2010. Re-emergence of bluetongue, African horse sickness, and other Orbivirus diseases. Vet. Res. 41, 35. MacLachlan, N.J., Osburn, B.I., 2006. Impact of bluetongue virus infection on the international movement and trade of ruminants. J. Am. Vet. Med. Assoc. 228, 1346–1349. MacLachlan, N.J., Wilson, W.C., Crossley, B.M., Mayo, C.E., Jasperson, D.C., Breitmeyer, R.E., Whiteford, A.M., 2013. Novel serotype of bluetongue virus, Western North America. Emerg. Infect. Dis. 19, 665–666. MacLachlan, N.J., Zientara, S., Stallknecht, D.E., Boone, J.D., Goekjian, V.H., Sailleau, C., Balasuriya, U.B., 2007. Phylogenetic comparison of the S10 genes of recent isolates of bluetongue virus from the United States and French Martinique Island. Virus Res. 129, 236–240. Mo, C.L., Thompson, L.H., Homan, E.J., Oviedo, M.T., Greiner, E.C., Gonza´lez, J., Sa´enz, M.R., 1994. Bluetongue virus isolations from vectors and ruminants in Central America and the Caribbean. Interamerican Bluetongue Team. Am. J. Vet. Res. 55, 211–215. Richards, R.G., MacLachlan, N.J., Heidner, H.W., Fuller, F.J., 1988. Comparison of virologic and serologic responses of lambs and calves infected with bluetongue virus serotype 10. Vet. Microbiol. 18, 233–242. Roy, P., 2005. Bluetongue Virus Proteins and Particles and their Role in Virus Entry, Assembly, and Release, pp. 69–123. Sailleau, C., Zanella, G., Breard, E., Viarouge, C., Desprat, A., Vitour, D., Adam, M., Lasne, L., Martrenchar, A., Bakkali-Kassimi, L., Costes, L., Zientara, S., 2012. Co-circulation of bluetongue and epizootic haemorrhagic disease viruses in cattle in Reunion Island. Vet. Microbiol. 155, 191–197. Shope, R.E., MacNamara, L.G., Mangold, R., 1955. Epizootic haemorragic disease of deer. New Jersey Outdoors (November), 16–21. Singer, R.S., MacLachlan, N.J., Carpenter, T.E., 2001. Maximal predicted duration of viremia in bluetongue virus-infected cattle. J. Vet. Diagn. Invest. 13, 43–49. Verwoerd, D.W., Erasmus, B.J., 2004. Bluetongue. In: Coetzer, J.A.W., Tustin, R.C. (Eds.), Infectious diseases of livestock, 2. Oxford University Press, Cape Town, pp. 1201–1220.