- Email: [email protected]
Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus
Fish & Shellfish Immunology (2008) 24, 122e133
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/fsi
Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus Tohru Mekata a, Tomoya Kono b, Terutoyo Yoshida b, Masahiro Sakai b, Toshiaki Itami b,* a
Interdisciplinary Graduate School of Agriculture and Engineering, Department of Applied Biological Science, University of Miyazaki, 1-1, Gakuen Kibanadai-nishi, Miyazaki-shi, 889-2192 Miyazaki Prefecture, Japan b Department of Biological Production and Environmental Science, Faculty of Agriculture, University of Miyazaki, 1-1, Gakuen Kibanadai-nishi, Miyazaki-shi, 889-2192 Miyazaki Prefecture, Japan Received 2 August 2007; revised 1 October 2007; accepted 10 October 2007 Available online 25 October 2007
KEYWORDS Toll receptor; Kuruma shrimp; mRNA transcript; Quantitative expression analysis; Immunostimulation
Abstract Toll receptors are cell-surface receptors acting as pattern recognition receptors (PRRs) that are involved in the signaling pathway for innate immunity activation and are genetically conserved from insects to mammals. Tolls from penaeid shrimp are found in white leg shrimp Litopenaeus vannamei (lToll) and black tiger shrimp Penaeus monodon (PmToll). However, the molecular ligand-recognition patterns and identification of these penaeid Toll classes remain unknown. Here, we report cDNA cloning of a new type of Toll receptor gene (MjToll) from kuruma shrimp, Marsupenaeus japonicus, and the modulation of expression by immunostimulation. The full length cDNA of MjToll gene has 3095 nucleotides coding for a putative protein of 1009 amino acids. The MjToll gene is constitutively expressed in the gill, gut, lymphoid organ, heart, hematopoietic organ, hemocyte, ventral abdominal nerve cord, eyestalk neural ganglia and brain tissues. The MjToll gene expression was significantly increased (76-fold) as compared to a control in lymphoid organ stimulated with peptidoglycan at 12 h, in vitro. lToll gene showed high similarity to PmToll gene with 96.9% identity; however, MjToll gene exhibited a percentage identity of 59% with that of penaeid Toll homologues. Therefore, this suggests that the identified MjToll gene belongs to the other class of Toll receptors in shrimp. ª 2007 Elsevier Ltd. All rights reserved.
Introduction
* Corresponding author. Tel.: þ81 985 587 229; fax: þ81 985 582 884. E-mail address: [email protected] (T. Itami).
Toll receptors or Toll-like receptors (TLRs) are type I transmembrane proteins with extracellular and cytoplasmic Toll/IL-1 receptor (TIR) domain. Initially, fruit fly Drosophila Toll (dToll) was identified as a transmembrane
1050-4648/$ - see front matter ª 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2007.10.006
Toll receptor in M. japonicus protein that controls dorsal ventral patterning in Drosophila [1] but later studies have found that this molecule has induction of anti-fungal immunity [2]. Members of a multigene family of TLRs are recognized as key players in the recognition of microbes during host defense [3]. TLRs play an essential role in the activation of innate immunity by recognizing specific patterns of microbial components and are genetically conserved between insects and mammals. Typical TLRs share a characteristic structure consisting of several extracellular leucine-rich repeats (LRRs) involved in pathogen recognition, transmembrane, and intracellular TIR domains involved in the signaling as well as the physical localization of the TLR [4]. The innate immune system is of great importance in the host’s defense against pathogens and recognizes conserved motifs in pathogens termed ‘‘pathogen-associated molecular patterns’’ (PAMPs) [5]. PAMPs are recognized by a set of pattern recognition receptors (PRRs) and proteins which are germline coded receptors for the innate immune system. TLRs play an essential role in innate immunity in higher organisms [6,7]. TLRs on specialized antigen-presenting cells function as signal transducers using MyD88 or TRIF that leads to the production of pro-inflammatory cytokines and the expression of costimulatory molecules on the cell surface [6,8]. Considering the close relationship between insects and crustaceans [9], it was anticipated that the major immune signaling components and effectors in crustaceans may be identified using information derived from insects. However, this applies only for anti-bacterial and anti-fungal responses, but not for the immune response to pathogenic viruses. Recently, the Toll pathway was also identified as a vital part of the Drosophila antiviral response [10]. The shrimp culture industry expanded significantly during the 1980s, but recent devastating losses caused by viral diseases in shrimp culture have caused serious economic losses. Therefore, understanding the innate immunity of penaeid shrimp may contribute to the developing strategies for management of viral diseases and for longterm sustainability in the penaeid shrimp industry. Toll receptors in penaeid shrimp are reported in white leg shrimp and black tiger shrimp whose homology is 96.9% and are probably of the same class of Toll; however, the different classes of penaeid Tolls remain unknown. In this study, we determined the full length of a new class of Toll receptor gene in kuruma shrimp; and also quantitative expression analysis was carried out in order to analyze the ligand binding with MjToll gene.
Materials and methods cDNA production Kuruma shrimp, Marsupenaeus japonicus (average weight: 12 g), were obtained from a shrimp farm in Miyazaki, Japan. They were acclimatized in an aerated sea water tank with sand at 20 C and fed a commercial diet at 1% body weight per day for a week. Total RNA was extracted from the lymphoid organ using ISOGEN reagents (Nippon Gene, Japan) according to the
123 manufacturer’s instructions. cDNA was synthesized from 2 mg of the total RNA using a ReverTra Dash kit (Toyobo, Japan) following manufacturer’s instructions and used as a template for PCR.
Genomic DNA extraction Muscle tissue was removed from an individual shrimp and the genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN, Japan) according to the manufacturer’s instructions.
Cloning and sequencing Initially, two sets of degenerate primers (Table 1) were designed in the conserved region of the TIR domain from insects Toll gene (GenBank accession no.: EAT48962, AAX33677, AAQ64938 and BAD12073, respectively). PCR was performed using the cDNA as prepared above with primers TIR-F1, -F2, and -R1, -R2 (Table 1) that amplify the initial predicted sequence. Having isolated this partial kuruma shrimp Toll receptor, the entire length sequence was obtained using a 50 - and 30 -RACE-PCR with the gene-specific primers shown in Table 1. All PCR reactions were performed using the following: 10 ExTaq Buffer 5 mL, 4 mL dNTPs (2.5 mM of each), 0.25 mL ExTaq polymerase (5 U/mL; Takara Bio Inc., Japan), 5 mL of each gene-specific primer (5 mM), template cDNA 2 mL and 28.75 mL distilled water. The products were cloned into the pGEM-T Easy vector (Promega, USA) and transformed into DH5a (Promega, USA). Recombinants were identified using redewhite color selection when grown on MacConkey agar (SigmaeAldrich). Plasmid DNA from at least three independent clones was recovered using a QIAprep Spin Miniprep Kit (QIAGEN, Japan) and sequenced using a CEQ 8000 Automated Sequencer (Beckman Coulter, Inc., USA). The signal peptide, structural domains, and N-linked glycosylation sites in MjToll amino acid sequences were predicted using the SignalP program (http:// www.cbs.dtu.dk/services/SignalP/) and simple modular architecture research tool (SMART) version 4.0 program (http://www.smart.emblheidelbergde/) and the SCAN PROSITE program was predicted [11] (www.expasy.ch/ prosite/). The sequences generated were analyzed for similarity with other known sequences using FASTA [12] and a basic local alignment search tool suite of programs [13]. Direct comparison between cDNA sequences was performed using the gap program [14] within the Wisconsin Genetics Computer Group Sequence Analysis Software Package (version 10.0) and multiple sequence alignments were generated using CLUSTAL W (version 1.74) [15]. A phylogenetic analysis was performed using the full length amino acid sequences of the known TLR/Toll family molecules using the neighbor-joining (NJ) method [16] and was drawn using the program MEGA 4 [17] where confidence limits were added [18].
In vitro expression Total RNA was extracted from the stomach, gill, gut, lymphoid organ, muscle, heart, hepatopancreas,
124
T. Mekata et al.
Table 1
PCR primers used for MjToll analysis
Primers
Sequence (50 e30 )
Degenerate PCR TIR-F1 TIR-F2 TIR-R1 TIR-R2
GATGCSTTCATYTCGTAY TKCAYGAWCGWGACTGGYTG YCKYARCTTWTCCCARAACCA RTGMCYGCMYKRAATTC
50 -RACE 50 -R1 50 -R2 50 -R3 50 -R4 50 -R5 50 -R6 50 -R7 50 -R8
CCTTCATCTCTTGAACTCTGAGAAAGC TCAATGAGCTCGCAGTCACAGAC GAGCTTTGCAATGTGCTTAGCTTGT CTGCCCATTAGCAAATGAGGAAAAT TCCCAACACGTTCCAGTCCTTTA GAGGCTGGATACCATGTTGTTGTTG CATTTGGGAAACTGCAGTCGTT TTTGGCTTTATGTTGGCACTTCA
30 -RACE 30 -F1 30 -F2 30 -F3 30 -F4 30 -F5
GCCTACATTCAGCAGCAGATTA AAGCAAGTCGCAGGACCATT GATGGAGAAGTACCTCAACTTGAAA AACTGTGCAGGGCTCCAA AAGGGCTGTTCCAGAACTTG
Genomic structure ge-R1 ge-R2 ge-R3 ge-R4 ge-R5 ge-F1 ge-F2 ge-F3
CCTTCATCTCTTGAACTCTGAGAAAGC GAGCTTTGCAATGTGCTTAGCTTGT TCCCAACACGTTCCAGTCCTTTA CATTTGGGAAACTGCAGTCGTT TTTGGCTTTATGTTGGCACTTCA GCCTACATTCAGCAGCAGATTA GATGGAGAAGTACCTCAACTTGAAA AAGGGCTGTTCCAGAACTTG
RT-PCR analysis MjToll-F MjToll-R b-actin-F b-actin-R
TCTTTCTGGTGTTTTAGCTACTGTAA TTTGATGAGAGCACGACAATG ATGACACAGATCATGTTCGA GTAGCACAGCTTCTCCTTGA
Real-time RT-PCR analysis MjToll-F CTCATTCTTTCTGGTGTTTTAGCTACTGT MjToll-R TGAGTGAAGAGCCAAACTTTGATT MjToll-probe TTTGGAAATACAAGCAAG b-actin-F CTCGCTCCCTCAACCATGA b-actin-R CCGATCCAGACGGAGTACTTG b-actin-probe ATCAAGATCATTGCCC
Quantification of expressed MjToll gene in lymphoid organ treated with immunostimulants Construction of a standard curve To determine the absolute copy number of the target transcript, a cloned plasmid DNA for b-actin and MjToll gene was used to generate a standard curve. The cloned plasmid DNA (0.5 mL) was used as a template for PCR mixture as mentioned above. The primer sets used for the construction of the standard curve were MjToll-F and -R, b-actin-F and -R (Table 1). The amplification regime was 30 s at 94 C, followed by 30 cycles consisting of 94 C for 30 s, 60 C for 30 s, and 72 C for 1 min. These products were purified using Microcon Centrifugal Filter Devices (Millipore, USA). The copy numbers of the product were calculated according to the molecular weight of the products and then converted into the copy numbers based upon Avogadro’s number (1 mol Z 6.022 1023 molecules).
Quantification of MjToll mRNA expression using real-time PCR A quantitative real-time RT-PCR assay using the ABIPRISM_7300 Sequence Detection System (Applied Biosystems) was used to determine the expression profiles of MjToll in the shrimp lymphoid organ tissue culture in response to stimulation with LPS (lipopolysaccharide from Escherichia coli serotype 0127:B8; SIGMA), CpG DNA (ATCGACTCG AACGTTCC), flagellin (Salmonella muenchen, recombinant, E. coli, Wako), Imiquimod (LKT Laboratories, Inc.), PG (peptidoglycan from Staphylococcus aureus, Biochemika), and polyI:C (polyinosinicepolycytidylic acid, SIGMA). The primers of the target gene were MjToll-F and MjToll-R (Table 1) generating a segment of 55 bp. The b-actin gene of kuruma shrimp was used as an internal control to verify the quantitative real-time PCR reaction. The primers of the internal control gene were b-actin-F and b-actin-R producing a fragment of 58 bp. The data obtained from the RT-PCR analysis were subjected to one-way analysis of variance followed by an unpaired, two-tailed t-test. Differences were considered significant at P < 0.01.
Results Nucleotide and deduced amino acid sequences of MjToll
hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia, and brain of healthy kuruma shrimp using ISOGEN reagents (Nippon Gene, Japan) according to the manufacturer’s instructions. The RNA samples were treated with RNase-free DNase (HT Biotechnology) and the cDNA was synthesized from 2 mg of the total RNA using a ReverTra Dash kit (Toyobo, Japan), and used as the template for PCR. Gene-specific primers MjToll-F and MjToll-R (Table 1) for MjToll amplification were designed using highly conserved regions. A set of bactin primers (Table 1) served as controls for the quantity and quality of the cDNA.
The cloned full length sequence of the MjToll cDNA consisted of 3207 bp with a 3027 bp open reading frame coding for a 1009-amino acid peptide, and a 44 bp 30 -UTR (Fig. 1). The deduced amino acid sequence of MjToll was observed to have an extracellular domain (residues 134e 736), LRRs (residues 134e508), a membrane-proximal cysteine-rich flanking motif (residues 544e736), a single pass transmembrane segment (residues 791e813), and an intracellular TIR domain (residues 843e980). A signal peptide of 19 amino acids and 16 potential N-linked glycosylation sites were predicted (Fig. 1).
Toll receptor in M. japonicus
125
Figure 1 Nucleotide sequence and putative amino acid sequence of the MjToll gene from M. japonicus (AB333779). The amino acid sequence is shown with one-letter codes below the nucleotide sequence. The predicted signal peptide is shown in italics. The potential N-linked glycosylation sites in the extracellular domain are shown in boxes. The transmembrane region and the TIR domain are shown using a dotted line and underline, respectively.
MjToll domain structure Typical Toll receptor functional domains were found in MjToll. The potential signal peptide and the LRRs are found
as cysteine-rich motifs in the LRR N-terminal domain in the LRR C-terminal domain, and the TIR domain. The homology of MjToll with that of lToll and DmToll was significantly high in both domain architecture and overall length (Fig. 2).
126
T. Mekata et al. Signal peptide Leucine-rich repeats Leucine rich repeat C-terminal domain Leucine rich repeat N-terminal domain Transmembrane domain TIR domain
lToll Mj Toll
Figure 2
Dm Toll7
Dm Toll5 Dm Toll
Dm Toll6
Dm Toll8
Tt TLR
Ag Toll Am Toll
Es TLR
Comparison of protein secondary structures of MjToll to lToll, DmTolls, TtToll and EsTLR.
Comparison of MjToll with other penaeid Toll and Toll/TLR homologues The identity of MjToll with lToll and PmToll was 66.8% and 66.6% in nucleotide sequence, respectively (Fig. 3);
whereas 92.0% identity was confirmed between lToll and PmToll. MjToll exhibited 59.1% and 59.8% amino acids’ identities with lToll and PmToll, respectively. However, the identity between Pm and lToll was relatively high (96.9% aa) in both amino acid as well as nucleotide level.
Figure 3 Nucleotide sequence alignment of the MjToll, lToll and PmToll. Identical conserved residues are shaded in grey and black outline. The end of each sequence represents nucleotide identities.
Toll receptor in M. japonicus Comparison of the MjToll TIR domain with other known TIRs showed that MjToll was similar to lToll (68.8% identity) followed by yellow fever mosquito A. aegypti AaToll (55.1%), honey bee Apis mellifera AmToll (54.3%) and fruit fly Drosophila melanogaster DmToll (47.5%) (Fig. 4). Moreover, amino acid identity and the similarity of MjToll gene were compared with lToll, DmTolls and MmTLRs (Table 3). MjToll and lToll showed a similar pattern of identity for DmTolls or MmTLRs.
127
Genomic structure of MjToll The genomic sequence of MjToll was composed of 3696 bp nt, which contain four exons and three introns. This genomic organization did not show similarity with Toll’s in fruit fly (Fig. 7).
Expression analysis of MjToll using RT-PCR
The conservation of 12 tandem LRR repeats was observed in MjToll as in a mammal’s consensus sequence. In the LRRs of MjToll, an invariant asparagine residue was identified at position 10, while highly conserved leucine residues were found at positions 2, 5, 7, and 15 in each LRR. In addition, an insertion of seven residues was identified in LRR-10 (Fig. 5).
The quantitative expression of MjToll gene was confirmed using various tissues like gill, gut, lymphoid organ, heart, hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia and brain tissues (Fig. 8). The significant increase of MjToll expression by stimulation with PG was confirmed at 9 and 12 h, which was 26.8and 76.0-fold higher compared to the control, respectively (Fig. 9). However, the expression of MjToll gene was not modulated by the treatment with LPS, CpG DNA, flagellin, Imiquimod, or polyI:C (Table 4).
Phylogenetic analyses of MjToll and other Toll families
Discussion
A phylogenetic tree was constructed with the full length of known Toll/TLRs (Table 2), which showed several distant clusters (Fig. 6). MjToll formed a separate cluster with Toll/TLR of insects and squid away from vertebrate and sea urchin Strongylocentrotus purpuratus. Interestingly, the TLR of sea urchins belonging to invertebrates formed a cluster with TLR3, 7, 8, and 9 in vertebrates.
To date, the Tolls in penaeid shrimp have been isolated from white leg shrimp and black tiger shrimp. In this study, we isolated a new type of Toll (MjToll) with a different structure compared to the other penaeid Tolls. The MjToll showed 59.1% and 59.8% identity to lToll and PmToll, respectively; while the identity between lToll and PmToll was 96.9%. Therefore, the homology analysis suggests that
Analysis of LRRs in MjToll and comparison of MjToll with Toll/TLR homologues
Figure 4 Alignment of the MjToll Toll/IL-1 receptor (TIR) domain with the other TIRs. Identical or highly conserved residues are shaded in black while similar residues are shaded in grey. Sequences for the alignment were obtained from the GenBank (Table 2).
128
T. Mekata et al.
Table 2
Details of genes used for MjToll analysis
Species
Name
Accession number
Homo sapiens
HsTLR1 HsTLR2 HsTLR3 HsTLR4 HsTLR5 HsTLR6 HsTLR7 HsTLR8.1 HsTLR8.2 HsTLR9A HsTLR9B MmTLR MmTLR2 MmTLR3 MmTLR4 MmTLR5 MmTLR6 MmTLR7 MmTLR8 MmTLR9 MmTLR11 MmTLR12 MmTLR13 GgTLR1 GgTLR2 GgTLR5 GgTLR7 DrTLR2 DrTLR3 DrTLR4b OmTLR OmTLR3 SsTLR TtTLR lToll SpTLR1.1 SpTLR1.2 SpTLR2.1 EsTLR DmToll Dm18W DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 DmToll9 AgToll AaToll DyToll DsToll AmToll
NP_003254 NP_003255 NP_003256 AAF05316 NP_003259 NP_006059 NP_057646 NP_057694 NP_619542 AAF72189 AF259263 NP_109607 NP_036035 NP_569054 NP_067272 AAF65625 NP_035734 NP_573474 NP_573475 NP_112455 NP_991388 AAS37673 NP_991389 NP_001007489 NP_989609 NP_001019757 CAG15146 NP_997977 NP_001013287 NP_997978 CAF31506 AAX68425 CAJ80696 BAD12073 ABK58729 NP_999670 NP_999671 AAK21261 AAY27971 AAQ64938 AAA79208 AAF86229 AAF86228 AAF86227 AAF86226 AAF86225 AF247764 NP_649214 AAL37901 EAT48962 AAQ65064 AAQ64875 AAX33677
Mus musculus
Gallus gallus
Danio rerio
Oncorhynchus mykiss Salmo salar Tachypleus tridentatus Litopenaeus vannamei Strongylocentrotus purpuratus Euprymna scolopes Drosophila melanogaster
Anopheles gambiae Aedes aegypti Drosophila yakuba Drosophila simulans Apis mellifera
MjToll belongs to a new class of Toll receptors in shrimp. However, the domain structure of MjToll is similar to that of lToll and DmToll. This might suggest that Tolls in penaeid shrimp were derived from the same ancestral gene as
DmToll, and it expanded to a variety of Toll classes during evolution. All TLRs contain a number of N-linked glycosylation sites that may influence the surface pattern recognition of the receptor. TLR2 and TLR4 were reported to require glycosylation for functional activation [19,20]. When the predicted N-glycosylation sites of the human TLRs were examined, the concave surface formed by LRR residues 2e9 usually contained the glycosylation sites, and was predicted to contain the ligand-binding site of the TLRs [21]. Eleven potential N-linked glycosylation sites were found in the LRRs of the predicted Toll receptor protein sequence in scallop, Chlamys farreri, where Asn409, Asn508, Asn549 and Asn752 were located on a concave surface of this receptor [22]. Although 16 potential N-linked glycosylation sites were identified in the MjToll, the strict positions of important residues in the concave surface of LRRs in MjToll have not been determined. Further study of the active sites for N-glycosylation will be required in order to analyze the receptoreligand binding for biological activity. The LRR domains in mammalian TLRs recognize and respond to many different microbe components [23]. It has been shown that TLR9 affects the cell-mediated immune response for CpG DNA [24]. LRRs in human TLR9-ectodomain (ECD) have an insertion at position 10 [21]. This insertion has a place in a loop that connects the b-face in the convex surface with a CXXC motif. A similar motif was identified in the ligand-binding region of the CpG-binding protein that contains a Zn2þ ion and binds directly to unmethylated CpG dinucleotide sequences [25]. As TLR9 also responds to unmethylated CpG-containing sequences, it has been proposed that this insertion is directly involved in PAMP binding and perhaps coordinates a metal ion [21]. TLR5 is essential for the inflammatory response to flagellin from Gram-negative bacteria [26]. LRRs in TLR5 have also an insertion at position 15 [21]. Recently, it had been demonstrated that flagellin binds directly to the TLR5-ECD [27]. The flagellin-binding site in TLR5 is located between residues 386 and 407, placing it in LRR14. The sequence of LRR14, which is 32 residues in length, reveals a six-residue insertion after position 15. There is a possibility that this insertion in TLR5 contributes to flagellin binding [21]. DmToll and the TtToll do not possess insertions in their LRRs where this Toll may not directly recognize PAMP [28,29]. Therefore, the existence of an insertion in TLR-ECD may be important for the PAMP-binding pattern. The LRR domain of MjToll has insertions that are present in other Toll family genes, including the lToll gene, where LRR-10 has the insertion. This suggests that MjToll could function as a PAMP-binding receptor. However, because only one LRR has been detected with an insertion, no conclusions can be drawn about the function of MjToll with respect to the binding of PAMPs. Phylogenetic analyses showed the MjToll groups to the lToll and insect Toll family maintaining high bootstrap values (DmTolls, AmToll and AeToll). Tolls in vertebrates formed a cluster away from the shrimp and insect Tolls. MjToll forms Toll and clusters with the invertebrates, and might be derived from a common ancestral gene. Genomic organization of the MjToll gene consists of four exons and three introns that are different from the DmToll
Toll receptor in M. japonicus
Table 3
Amino acid identity and similarity of MjToll gene with other known Toll/TLR sequences MjToll lToll DmToll1 DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm TLR1 TLR2 TLR3 TLR4 TLR5 TLR6 TLR7 TLR8 TLR9 TLR11 TLR12 TLR13
MjToll lToll DmToll1 DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 MmTLR1 MmTLR2 MmTLR3 MmTLR4 MmTLR5 MmTLR6 MmTLR7 MmTLR8 MmTLR9 MmTLR11 MmTLR12 MmTLR13
60.2 49.2 40.9 47.1 42.2 35.3 36.3 42 38.9 38.9 40.6 40.1 40.2 37.7 43.2 43.8 41.8 42.7 40.3 43.1
41.7 27.7 27.8 47.6 43.1 39.6 45.7 92.8 47.7 44.7 34.3 37.3 34.5 35.9 38 41.6 41.6 37.6 42 38.1 45.7 41.5 43.5 38.8 44.5 41.1 42.7 37.8 42.7 44.4 40.9 44.2 41 42.6 43.2 39.1 42.4 37.8 44.2 43.1
21.2 24 21.1 38.7 48.6 28.1 30.2 32.8 45 41.8 41.5 43.6 39.5 43.2 38.6 38 39.2 39.1 39.6 41.3
28.4 27.7 92.5 21.7 42.1 38.8 38 43.2 36.8 37.5 38.8 38.4 40.1 35.7 42.9 43.2 41.9 38.7 36.4 42.2
24.6 26.6 27.4 24.7 25.9 29.9 30.2 35.3 46.2 44 41.8 43.8 42.5 44.5 38.9 38.6 37.8 40 39.6 42.1
18.7 18.8 21.1 15.3 21.6 16.6 56.9 57.8 28.3 29.7 31.6 29.8 29.6 27.5 32.9 32.7 33.8 31.8 29.8 33.2
19.9 20 21.5 17.5 22.6 18.3 36.4 56.4 30.8 30.3 32.3 31.2 31.7 28.9 35.1 34 34.4 33.1 32.3 35.7
22.8 23.8 22.1 18.7 23.2 20.4 36.9 34.9 33.6 32.3 35.5 34 33.3 34.3 37.1 37.6 36.2 34.4 34.2 38.6
21.2 21.6 20.4 21.3 19.9 21.7 15.7 16.9 19 53.2 44.1 44.1 45.2 77.4 40.5 39.1 40.7 41.5 41.1 42
21 23.3 19.6 20.3 19.7 21.7 16.1 17.9 17.6 30.2 44 45.6 44.2 54.7 41.1 40.4 40.8 41.6 41.7 41.5
20.9 22.6 20.8 19.9 20.8 20.9 16.6 18.5 21.7 23.8 22.2 44.5 47.2 43.8 45.5 45.2 44.9 45.5 44.7 47.2
20.4 24.1 19.9 20.5 21 23.5 17.2 17.6 20.3 23.5 25.6 25.7 46 45.6 42 43.5 41.7 42.5 42.6 44
20.9 22.3 21 18.5 20.7 22.9 17.1 18.6 18.9 23.1 25.9 24.2 24.1 44.9 42.9 42.1 41.3 44.5 43.6 44.3
21.3 22.5 20.4 21.6 19.7 22.2 16.1 16.5 18.4 64.7 30.9 24.3 24.1 22.6 40 39.4 40.7 42.3 41.4 42.1
21.1 22.2 21.6 19.1 21 20.8 17.9 19 19.7 21.7 22.5 26 23.5 24.2 21.6 61.5 56.7 41.9 41.4 48.4
22.2 22.7 22.2 20.6 21.9 20.7 19 18.8 19.2 22 22.6 25.5 25.1 23.7 22.5 42.2 56 41.4 40.9 47.2
20.6 22.4 21.2 21.2 21.5 22.8 20.3 20.4 20.6 22.3 23.6 24.4 23.6 22.8 23.2 36.1 34.8 40.9 40.1 47
22.7 23.5 20 20.4 20.7 21.6 18.4 19.6 19.9 20.6 21.6 23.4 21.9 24.4 21.6 23.1 23.1 22.8 55.2 45.5
20.8 21 18.6 19.4 19.1 20.5 17.2 19.4 19.9 21.4 22.8 24.1 22 23.1 22.4 22.1 21.7 23.9 37.4
21.9 23.4 22.2 21.5 21.2 22.4 18.5 19.9 21.6 24.2 24 26.5 27 24.4 25.4 27.2 26.5 25.6 25.4 26.6
44.7
Upper triangle: identity, lower triangle: similarity.
129
130
T. Mekata et al.
Figure 5
Alignment of the ectodomain of MjToll gene to the consensus sequences of leucine-rich repeats (LRRs).
MmTLR11 MmTLR12
Vertebrate TLR5 Vertebrate OmTLR3 TLR3 DrTLR3
HsTLR5 MmTLR5 GgTLR5 MmTLR13
Sea urchin TLR SpTLR2.1
Vertebrate TLR11,12,13
HsTLR3 MmT3
OmTLR1 SsTLR1
MmTLR4
Vertebrate TLR4
HsTLR4
SpTLR1.2
DrTLR4b
SpTLR1.1
MmTLR2
Vertebrate TLR1,2,6
HsTLR2 HsTLR9B HsTLR9A
Gg TLR2 DrTLR2
MmTLR9
DrTLR1 HsTLR8.2 GgTLR1
HsTLR8
MmTLR1
MmTLR8
HsTLR1 GgTLR7
Vertebrate TLR7,8,9
MmTLR6 HsTLR6
HsTLR7 MmTLR7
DmToll4 Dm Toll1 Ds Toll
Es TLR Dm Toll5
Dy Toll Aa Toll
DmToll8 Lv Toll
Mj Toll
Tt TLR
Am Toll Dm Toll6
Dm Toll7
Invertebrate Toll/TLR
Figure 6 Phylogenetic tree of TLRs. The full length amino acid sequences of TLRs from different organisms are aligned using the CLUSTAL X (version 1.83) program [40]. The phylogenetic tree was constructed using the Bootstrap NJ method with using the program MEGA 4 [17] . The scale bar indicates a branch length of 0.2 amino acid sequences and was obtained from the GenBank (Table 2).
Toll receptor in M. japonicus
131 123 294
252
MjToll 2273
149
403
202
117
DmToll1 1220
2071 53
1189
DmToll4
740
124
109
682
2464
DmToll6 4987
DmToll7 4271 103
DmToll9 295
231
70
216
727
222
1620
61
128 207
1128
Tehao
1342
1046
Intron Exon
18W 4158
Figure 7 Comparison of the genomic structure of MjToll to DmTolls. Boxes indicate exon-coding regions while bars indicate introns. Numbers indicate the length of the nucleotide sequences in each region. Nucleotide sequences were obtained from the GenBank (Table 2).
Figure 8 Expression analysis of MjToll in tissues. Specific-PCR was performed using the MjToll gene-specific primers, MjToll-F and MjToll-R, with cDNA from several tissues and was synthesized by RT-PCR. The b-actin gene was used as a control to determine the amount and quality of the cDNA. Abbreviations used: 1, stomach; 2, gill; 3, gut; 4, lymphoid organ; 5, muscle; 6, heart; 7, hepatopancreas; 8, hematopoietic organ; 9, hemocytes; 10, ventral abdominal nerve cord; 11, eyestalk neural ganglia; and 12, brain.
Figure 9 Quantitative real-time PCR analysis of the MjToll gene in lymphoid organ culture using LPS, CpG DNA, flagellin, Imiquimod, PG, polyI:C at 0, 1.5, 3, 6, 9 and 12 h. Quantitative MjToll mRNA levels were determined using real-time PCR and standardized with b-actin mRNA levels. Data are presented as means SE of triplicate tests.
132
T. Mekata et al.
Table 4 12 h
Copy numbers of MjToll mRNA in the lymphoid organ using several immunostimulants at 0 (control), 1.5, 3, 6, 9 and Control
CpGDNA Flagellin Imiquimod LPS Peptidoglycan PolyI:C a
2.80E þ 04 2.30E þ 04 4.80E þ 04 2.70E þ 04 1.40E þ 04 1.10E þ 04
1.5 h 7.8E þ 04 1.9E þ 04 7.1E þ 04 2.2E þ 04 5.2E þ 03 1.9E þ 04
3h (2.8) (0.8) (1.5) (0.8) (0.4) (1.8)
a
4.7E þ 04 1.5E þ 04 7.0E þ 04 4.9E þ 04 1.5E þ 04 7.0E þ 04
6h (1.7) (0.6) (1.5) (1.8) (1.1) 6.5)
1.7E þ 04 1.7E þ 04 6.9E þ 04 2.0E þ 04 8.9E þ 03 9.3E þ 03
9h (0.6) (0.7) (1.4) (0.7) (0.6) (0.9)
2.0E þ 05 2.7E þ 04 8.3E þ 04 3.8E þ 04 3.8E þ 05 7.0E þ 04
12 h (7.2) (1.2) (1.7) (1.4) (26.8) (6.6)
3.3E þ 04 3.8E þ 04 1.5E þ 05 5.5E þ 04 1.1E þ 06 6.6E þ 03
(1.2) (1.6) (3.2) (2.0) (76.0) (0.6)
Fold to control.
family genes. An intron exists in the TIR domain of MjToll and PmToll [30]; while no introns are found in most TIR domains of Tolls and TLRs. In the Toll/TLR genes that contain introns, the locations and phases are different which suggests that the TIR domain may have been subjected to many events of intron invasion during evolution [31,32]. This suggests that MjToll, like other shrimp and invertebrate Tolls and Vertebrate TLR genes, may also have had intron invasion. MjToll gene was expressed in a variety of tissues including the gill, gut, lymphoid organ, heart, hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia, and brain. Constitutive expression of MjToll gene in tissues is similar to that of lToll [33] and TtToll [29]. Members of the human TLR (HsTLR) family have been reported to differentially express in several tissues. Especially, HsTLR2, HsTLR4 or HsTLR8 are expressed in abundant tissues [34e36] and are involved with systemic biophylactic response. The expression of MjToll gene in a variety of tissues suggests these tissues have the possibility to react to an invasion by a pathogen where MjToll may be responsible for systemic innate immunity. Expression of MjToll gene was increased by stimulation with 10 mg/mL of PG at 9 and 12 h, and its levels were 26.8and 76.0-fold higher compared to the control. TLR2 in humans plays a major role in detecting Gram-positive bacteria and is also involved in the recognition of other microbial components such as LPS from Gram-negative bacteria or lipoteichoic acid from Gram-positive bacteria [37e39]. Although it is difficult to draw firm conclusions from the expression analysis, the similarity of ligand-recognition suggests that kuruma shrimp has a TLR homologue with the same ligandereceptor binding pattern to human TLR2. Therefore, further work will be required to isolate the other classes of Tolls and signaling molecules involved in Toll pathway and to compare expression profiles of penaeid shrimp Tolls in order to determine the biological functions. However, the discovery of a new type of Toll gene in penaeid shrimp will allow more detailed investigation into innate immune responses in shrimp.
Acknowledgements This study was supported in part by a grant from Research Fellowships of the Japan Society for the Promotion of Science (JSPS) for Young Scientists and Research and Development Program for New Bio-industry Initiatives.
References [1] Nusslein-Volhard C, Lohs-Schardin M, Sander K, Cremer C. A dorso-ventral shift of embryonic primordia in a new maternal-effect mutant of Drosophila. Nature 1980;283: 474e6. [2] Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 1996;86:973e83. [3] Hopkins PA, Sriskandan S. Mammalian toll-like receptors: to immunity and beyond. Clinical and Experimental Immunology 2005;140:395e407. [4] Yamamoto M, Akira S. TIR domain-containing adaptors regulate TLR signaling pathways. Advances In Experimental Medicine and Biology 2005;560:1e9. [5] Akira S. Mammalian toll-like receptors. Current Opinion In Immunology 2003;15:5e11. [6] Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nature Immunology 2001;2:675e80. [7] Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000;406:782e7. [8] Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RA. Phylogenetic perspectives in innate immunity. Science 1999;284: 1313e8 [New York, NY]. [9] Wilson K, Cahill V, Ballment E, Benzie J. The complete sequence of the mitochondrial genome of the crustacean Penaeus monodon: are malacostracan crustaceans more closely related to insects than to branchiopods? Molecular Biology and Evolution 2000;17:863e74. [10] Zambon RA, Nandakumar M, Vakharia VN, Wu LP. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 2005;102:7257e62. [11] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 1997;10:1e6. [12] Pearson WR, Lipman DJ. Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences of the United States of America 1988;85:2444e8. [13] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology 1990;215: 403e10. [14] Needleman SB, Wunsch CD. A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 1970;48:443e53. [15] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994;22:4673e80.
Toll receptor in M. japonicus [16] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 1987;4:406e25. [17] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. molecular biology and evolution 2007;24:1596e9. [18] Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985;39:783e91. [19] Weber AN, Morse MA, Gay NJ. Four N-linked glycosylation sites in human toll-like receptor 2 cooperate to direct efficient biosynthesis and secretion. Journal of Biological Chemistry 2004; 279:34589e94. [20] Ohnishi T, Muroi M, Tanamoto K. MD-2 is necessary for the tolllike receptor 4 protein to undergo glycosylation essential for its translocation to the cell surface. Clinical and Diagnostic Laboratory Immunology 2003;10:405e10. [21] Bell JK, Mullen GE, Leifer CA, Mazzoni A, Davies DR, Segal DM. Leucine-rich repeats and pathogen recognition in toll-like receptors. Trends in Immunology 2003;24:528e33. [22] Qiu L, Song L, Xu W, Ni D, Yu Y. Molecular cloning and expression of a toll receptor gene homologue from Zhikong scallop, Chlamys farreri. Fish & Shellfish Immunology 2007; 22:451e66. [23] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [24] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A toll-like receptor recognizes bacterial DNA. Nature 2000;408:740e5. [25] Lee JH, Voo KS, Skalnik DG. Identification and characterization of the DNA binding domain of CpG-binding protein. Journal of Biological Chemistry 2001;276:44669e76. [26] Takeda K, Kaisho T, Akira S. Toll-like receptors. Annual Review of Immunology 2003;21:335e76. [27] Mizel SB, West AP, Hantgan RR. Identification of a sequence in human toll-like receptor 5 required for the binding of Gram-negative flagellin. Journal of Biological Chemistry 2003;278:23624e9. [28] Levashina EA, Langley E, Green C, Gubb D, Ashburner M, Hoffmann JA, et al. Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 1999;285:1917e9. New York, NY.
133 [29] Inamori K, Ariki S, Kawabata S. A toll-like receptor in horseshoe crabs. Immunological Reviews 2004;198:106e15. [30] Arts JA, Cornelissen FH, Cijsouw T, Hermsen T, Savelkoul HF, Stet RJ. Molecular cloning and expression of a toll receptor in the giant tiger shrimp, Penaeus monodon. Fish & Shellfish Immunology 2007;23:504e13. [31] Kanzok SM, Hoa NT, Bonizzoni M, Luna C, Huang Y, Malacrida AR, et al. Origin of toll-like receptor-mediated innate immunity. Journal of Molecular Evolution 2004;58:442e8. [32] Rogers JH. The role of introns in evolution. FEBS Letters 1990; 268:339e43. [33] Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, Weng SP, et al. A toll receptor in shrimp. Molecular Immunology 2007;44: 1999e2008. [34] Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proceedings of the National Academy of Sciences of the United States of America 1998;95:588e93. [35] Chaudhary PM, Ferguson C, Nguyen V, Nguyen O, Massa HF, Eby M, et al. Cloning and characterization of two toll/interleukin-1 receptor-like genes TIL3 and TIL4: evidence for a multigene receptor family in humans. Blood 1998;91:4020e7. [36] Chuang TH, Ulevitch RJ. Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9. European Cytokine Network 2000;11:372e8. [37] Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, et al. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 1999;11:443e51. [38] Heine H, Kirschning CJ, Lien E, Monks BG, Rothe M, Golenbock DT. Cutting edge: cells that carry A null allele for toll-like receptor 2 are capable of responding to endotoxin. Journal of Immunology 1999;162:6971e5. [39] Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. Journal of Biological Chemistry 1999;274:17406e9. [40] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 1997;25:4876e82.
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/fsi
Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus Tohru Mekata a, Tomoya Kono b, Terutoyo Yoshida b, Masahiro Sakai b, Toshiaki Itami b,* a
Interdisciplinary Graduate School of Agriculture and Engineering, Department of Applied Biological Science, University of Miyazaki, 1-1, Gakuen Kibanadai-nishi, Miyazaki-shi, 889-2192 Miyazaki Prefecture, Japan b Department of Biological Production and Environmental Science, Faculty of Agriculture, University of Miyazaki, 1-1, Gakuen Kibanadai-nishi, Miyazaki-shi, 889-2192 Miyazaki Prefecture, Japan Received 2 August 2007; revised 1 October 2007; accepted 10 October 2007 Available online 25 October 2007
KEYWORDS Toll receptor; Kuruma shrimp; mRNA transcript; Quantitative expression analysis; Immunostimulation
Abstract Toll receptors are cell-surface receptors acting as pattern recognition receptors (PRRs) that are involved in the signaling pathway for innate immunity activation and are genetically conserved from insects to mammals. Tolls from penaeid shrimp are found in white leg shrimp Litopenaeus vannamei (lToll) and black tiger shrimp Penaeus monodon (PmToll). However, the molecular ligand-recognition patterns and identification of these penaeid Toll classes remain unknown. Here, we report cDNA cloning of a new type of Toll receptor gene (MjToll) from kuruma shrimp, Marsupenaeus japonicus, and the modulation of expression by immunostimulation. The full length cDNA of MjToll gene has 3095 nucleotides coding for a putative protein of 1009 amino acids. The MjToll gene is constitutively expressed in the gill, gut, lymphoid organ, heart, hematopoietic organ, hemocyte, ventral abdominal nerve cord, eyestalk neural ganglia and brain tissues. The MjToll gene expression was significantly increased (76-fold) as compared to a control in lymphoid organ stimulated with peptidoglycan at 12 h, in vitro. lToll gene showed high similarity to PmToll gene with 96.9% identity; however, MjToll gene exhibited a percentage identity of 59% with that of penaeid Toll homologues. Therefore, this suggests that the identified MjToll gene belongs to the other class of Toll receptors in shrimp. ª 2007 Elsevier Ltd. All rights reserved.
Introduction
* Corresponding author. Tel.: þ81 985 587 229; fax: þ81 985 582 884. E-mail address: [email protected] (T. Itami).
Toll receptors or Toll-like receptors (TLRs) are type I transmembrane proteins with extracellular and cytoplasmic Toll/IL-1 receptor (TIR) domain. Initially, fruit fly Drosophila Toll (dToll) was identified as a transmembrane
1050-4648/$ - see front matter ª 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2007.10.006
Toll receptor in M. japonicus protein that controls dorsal ventral patterning in Drosophila [1] but later studies have found that this molecule has induction of anti-fungal immunity [2]. Members of a multigene family of TLRs are recognized as key players in the recognition of microbes during host defense [3]. TLRs play an essential role in the activation of innate immunity by recognizing specific patterns of microbial components and are genetically conserved between insects and mammals. Typical TLRs share a characteristic structure consisting of several extracellular leucine-rich repeats (LRRs) involved in pathogen recognition, transmembrane, and intracellular TIR domains involved in the signaling as well as the physical localization of the TLR [4]. The innate immune system is of great importance in the host’s defense against pathogens and recognizes conserved motifs in pathogens termed ‘‘pathogen-associated molecular patterns’’ (PAMPs) [5]. PAMPs are recognized by a set of pattern recognition receptors (PRRs) and proteins which are germline coded receptors for the innate immune system. TLRs play an essential role in innate immunity in higher organisms [6,7]. TLRs on specialized antigen-presenting cells function as signal transducers using MyD88 or TRIF that leads to the production of pro-inflammatory cytokines and the expression of costimulatory molecules on the cell surface [6,8]. Considering the close relationship between insects and crustaceans [9], it was anticipated that the major immune signaling components and effectors in crustaceans may be identified using information derived from insects. However, this applies only for anti-bacterial and anti-fungal responses, but not for the immune response to pathogenic viruses. Recently, the Toll pathway was also identified as a vital part of the Drosophila antiviral response [10]. The shrimp culture industry expanded significantly during the 1980s, but recent devastating losses caused by viral diseases in shrimp culture have caused serious economic losses. Therefore, understanding the innate immunity of penaeid shrimp may contribute to the developing strategies for management of viral diseases and for longterm sustainability in the penaeid shrimp industry. Toll receptors in penaeid shrimp are reported in white leg shrimp and black tiger shrimp whose homology is 96.9% and are probably of the same class of Toll; however, the different classes of penaeid Tolls remain unknown. In this study, we determined the full length of a new class of Toll receptor gene in kuruma shrimp; and also quantitative expression analysis was carried out in order to analyze the ligand binding with MjToll gene.
Materials and methods cDNA production Kuruma shrimp, Marsupenaeus japonicus (average weight: 12 g), were obtained from a shrimp farm in Miyazaki, Japan. They were acclimatized in an aerated sea water tank with sand at 20 C and fed a commercial diet at 1% body weight per day for a week. Total RNA was extracted from the lymphoid organ using ISOGEN reagents (Nippon Gene, Japan) according to the
123 manufacturer’s instructions. cDNA was synthesized from 2 mg of the total RNA using a ReverTra Dash kit (Toyobo, Japan) following manufacturer’s instructions and used as a template for PCR.
Genomic DNA extraction Muscle tissue was removed from an individual shrimp and the genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN, Japan) according to the manufacturer’s instructions.
Cloning and sequencing Initially, two sets of degenerate primers (Table 1) were designed in the conserved region of the TIR domain from insects Toll gene (GenBank accession no.: EAT48962, AAX33677, AAQ64938 and BAD12073, respectively). PCR was performed using the cDNA as prepared above with primers TIR-F1, -F2, and -R1, -R2 (Table 1) that amplify the initial predicted sequence. Having isolated this partial kuruma shrimp Toll receptor, the entire length sequence was obtained using a 50 - and 30 -RACE-PCR with the gene-specific primers shown in Table 1. All PCR reactions were performed using the following: 10 ExTaq Buffer 5 mL, 4 mL dNTPs (2.5 mM of each), 0.25 mL ExTaq polymerase (5 U/mL; Takara Bio Inc., Japan), 5 mL of each gene-specific primer (5 mM), template cDNA 2 mL and 28.75 mL distilled water. The products were cloned into the pGEM-T Easy vector (Promega, USA) and transformed into DH5a (Promega, USA). Recombinants were identified using redewhite color selection when grown on MacConkey agar (SigmaeAldrich). Plasmid DNA from at least three independent clones was recovered using a QIAprep Spin Miniprep Kit (QIAGEN, Japan) and sequenced using a CEQ 8000 Automated Sequencer (Beckman Coulter, Inc., USA). The signal peptide, structural domains, and N-linked glycosylation sites in MjToll amino acid sequences were predicted using the SignalP program (http:// www.cbs.dtu.dk/services/SignalP/) and simple modular architecture research tool (SMART) version 4.0 program (http://www.smart.emblheidelbergde/) and the SCAN PROSITE program was predicted [11] (www.expasy.ch/ prosite/). The sequences generated were analyzed for similarity with other known sequences using FASTA [12] and a basic local alignment search tool suite of programs [13]. Direct comparison between cDNA sequences was performed using the gap program [14] within the Wisconsin Genetics Computer Group Sequence Analysis Software Package (version 10.0) and multiple sequence alignments were generated using CLUSTAL W (version 1.74) [15]. A phylogenetic analysis was performed using the full length amino acid sequences of the known TLR/Toll family molecules using the neighbor-joining (NJ) method [16] and was drawn using the program MEGA 4 [17] where confidence limits were added [18].
In vitro expression Total RNA was extracted from the stomach, gill, gut, lymphoid organ, muscle, heart, hepatopancreas,
124
T. Mekata et al.
Table 1
PCR primers used for MjToll analysis
Primers
Sequence (50 e30 )
Degenerate PCR TIR-F1 TIR-F2 TIR-R1 TIR-R2
GATGCSTTCATYTCGTAY TKCAYGAWCGWGACTGGYTG YCKYARCTTWTCCCARAACCA RTGMCYGCMYKRAATTC
50 -RACE 50 -R1 50 -R2 50 -R3 50 -R4 50 -R5 50 -R6 50 -R7 50 -R8
CCTTCATCTCTTGAACTCTGAGAAAGC TCAATGAGCTCGCAGTCACAGAC GAGCTTTGCAATGTGCTTAGCTTGT CTGCCCATTAGCAAATGAGGAAAAT TCCCAACACGTTCCAGTCCTTTA GAGGCTGGATACCATGTTGTTGTTG CATTTGGGAAACTGCAGTCGTT TTTGGCTTTATGTTGGCACTTCA
30 -RACE 30 -F1 30 -F2 30 -F3 30 -F4 30 -F5
GCCTACATTCAGCAGCAGATTA AAGCAAGTCGCAGGACCATT GATGGAGAAGTACCTCAACTTGAAA AACTGTGCAGGGCTCCAA AAGGGCTGTTCCAGAACTTG
Genomic structure ge-R1 ge-R2 ge-R3 ge-R4 ge-R5 ge-F1 ge-F2 ge-F3
CCTTCATCTCTTGAACTCTGAGAAAGC GAGCTTTGCAATGTGCTTAGCTTGT TCCCAACACGTTCCAGTCCTTTA CATTTGGGAAACTGCAGTCGTT TTTGGCTTTATGTTGGCACTTCA GCCTACATTCAGCAGCAGATTA GATGGAGAAGTACCTCAACTTGAAA AAGGGCTGTTCCAGAACTTG
RT-PCR analysis MjToll-F MjToll-R b-actin-F b-actin-R
TCTTTCTGGTGTTTTAGCTACTGTAA TTTGATGAGAGCACGACAATG ATGACACAGATCATGTTCGA GTAGCACAGCTTCTCCTTGA
Real-time RT-PCR analysis MjToll-F CTCATTCTTTCTGGTGTTTTAGCTACTGT MjToll-R TGAGTGAAGAGCCAAACTTTGATT MjToll-probe TTTGGAAATACAAGCAAG b-actin-F CTCGCTCCCTCAACCATGA b-actin-R CCGATCCAGACGGAGTACTTG b-actin-probe ATCAAGATCATTGCCC
Quantification of expressed MjToll gene in lymphoid organ treated with immunostimulants Construction of a standard curve To determine the absolute copy number of the target transcript, a cloned plasmid DNA for b-actin and MjToll gene was used to generate a standard curve. The cloned plasmid DNA (0.5 mL) was used as a template for PCR mixture as mentioned above. The primer sets used for the construction of the standard curve were MjToll-F and -R, b-actin-F and -R (Table 1). The amplification regime was 30 s at 94 C, followed by 30 cycles consisting of 94 C for 30 s, 60 C for 30 s, and 72 C for 1 min. These products were purified using Microcon Centrifugal Filter Devices (Millipore, USA). The copy numbers of the product were calculated according to the molecular weight of the products and then converted into the copy numbers based upon Avogadro’s number (1 mol Z 6.022 1023 molecules).
Quantification of MjToll mRNA expression using real-time PCR A quantitative real-time RT-PCR assay using the ABIPRISM_7300 Sequence Detection System (Applied Biosystems) was used to determine the expression profiles of MjToll in the shrimp lymphoid organ tissue culture in response to stimulation with LPS (lipopolysaccharide from Escherichia coli serotype 0127:B8; SIGMA), CpG DNA (ATCGACTCG AACGTTCC), flagellin (Salmonella muenchen, recombinant, E. coli, Wako), Imiquimod (LKT Laboratories, Inc.), PG (peptidoglycan from Staphylococcus aureus, Biochemika), and polyI:C (polyinosinicepolycytidylic acid, SIGMA). The primers of the target gene were MjToll-F and MjToll-R (Table 1) generating a segment of 55 bp. The b-actin gene of kuruma shrimp was used as an internal control to verify the quantitative real-time PCR reaction. The primers of the internal control gene were b-actin-F and b-actin-R producing a fragment of 58 bp. The data obtained from the RT-PCR analysis were subjected to one-way analysis of variance followed by an unpaired, two-tailed t-test. Differences were considered significant at P < 0.01.
Results Nucleotide and deduced amino acid sequences of MjToll
hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia, and brain of healthy kuruma shrimp using ISOGEN reagents (Nippon Gene, Japan) according to the manufacturer’s instructions. The RNA samples were treated with RNase-free DNase (HT Biotechnology) and the cDNA was synthesized from 2 mg of the total RNA using a ReverTra Dash kit (Toyobo, Japan), and used as the template for PCR. Gene-specific primers MjToll-F and MjToll-R (Table 1) for MjToll amplification were designed using highly conserved regions. A set of bactin primers (Table 1) served as controls for the quantity and quality of the cDNA.
The cloned full length sequence of the MjToll cDNA consisted of 3207 bp with a 3027 bp open reading frame coding for a 1009-amino acid peptide, and a 44 bp 30 -UTR (Fig. 1). The deduced amino acid sequence of MjToll was observed to have an extracellular domain (residues 134e 736), LRRs (residues 134e508), a membrane-proximal cysteine-rich flanking motif (residues 544e736), a single pass transmembrane segment (residues 791e813), and an intracellular TIR domain (residues 843e980). A signal peptide of 19 amino acids and 16 potential N-linked glycosylation sites were predicted (Fig. 1).
Toll receptor in M. japonicus
125
Figure 1 Nucleotide sequence and putative amino acid sequence of the MjToll gene from M. japonicus (AB333779). The amino acid sequence is shown with one-letter codes below the nucleotide sequence. The predicted signal peptide is shown in italics. The potential N-linked glycosylation sites in the extracellular domain are shown in boxes. The transmembrane region and the TIR domain are shown using a dotted line and underline, respectively.
MjToll domain structure Typical Toll receptor functional domains were found in MjToll. The potential signal peptide and the LRRs are found
as cysteine-rich motifs in the LRR N-terminal domain in the LRR C-terminal domain, and the TIR domain. The homology of MjToll with that of lToll and DmToll was significantly high in both domain architecture and overall length (Fig. 2).
126
T. Mekata et al. Signal peptide Leucine-rich repeats Leucine rich repeat C-terminal domain Leucine rich repeat N-terminal domain Transmembrane domain TIR domain
lToll Mj Toll
Figure 2
Dm Toll7
Dm Toll5 Dm Toll
Dm Toll6
Dm Toll8
Tt TLR
Ag Toll Am Toll
Es TLR
Comparison of protein secondary structures of MjToll to lToll, DmTolls, TtToll and EsTLR.
Comparison of MjToll with other penaeid Toll and Toll/TLR homologues The identity of MjToll with lToll and PmToll was 66.8% and 66.6% in nucleotide sequence, respectively (Fig. 3);
whereas 92.0% identity was confirmed between lToll and PmToll. MjToll exhibited 59.1% and 59.8% amino acids’ identities with lToll and PmToll, respectively. However, the identity between Pm and lToll was relatively high (96.9% aa) in both amino acid as well as nucleotide level.
Figure 3 Nucleotide sequence alignment of the MjToll, lToll and PmToll. Identical conserved residues are shaded in grey and black outline. The end of each sequence represents nucleotide identities.
Toll receptor in M. japonicus Comparison of the MjToll TIR domain with other known TIRs showed that MjToll was similar to lToll (68.8% identity) followed by yellow fever mosquito A. aegypti AaToll (55.1%), honey bee Apis mellifera AmToll (54.3%) and fruit fly Drosophila melanogaster DmToll (47.5%) (Fig. 4). Moreover, amino acid identity and the similarity of MjToll gene were compared with lToll, DmTolls and MmTLRs (Table 3). MjToll and lToll showed a similar pattern of identity for DmTolls or MmTLRs.
127
Genomic structure of MjToll The genomic sequence of MjToll was composed of 3696 bp nt, which contain four exons and three introns. This genomic organization did not show similarity with Toll’s in fruit fly (Fig. 7).
Expression analysis of MjToll using RT-PCR
The conservation of 12 tandem LRR repeats was observed in MjToll as in a mammal’s consensus sequence. In the LRRs of MjToll, an invariant asparagine residue was identified at position 10, while highly conserved leucine residues were found at positions 2, 5, 7, and 15 in each LRR. In addition, an insertion of seven residues was identified in LRR-10 (Fig. 5).
The quantitative expression of MjToll gene was confirmed using various tissues like gill, gut, lymphoid organ, heart, hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia and brain tissues (Fig. 8). The significant increase of MjToll expression by stimulation with PG was confirmed at 9 and 12 h, which was 26.8and 76.0-fold higher compared to the control, respectively (Fig. 9). However, the expression of MjToll gene was not modulated by the treatment with LPS, CpG DNA, flagellin, Imiquimod, or polyI:C (Table 4).
Phylogenetic analyses of MjToll and other Toll families
Discussion
A phylogenetic tree was constructed with the full length of known Toll/TLRs (Table 2), which showed several distant clusters (Fig. 6). MjToll formed a separate cluster with Toll/TLR of insects and squid away from vertebrate and sea urchin Strongylocentrotus purpuratus. Interestingly, the TLR of sea urchins belonging to invertebrates formed a cluster with TLR3, 7, 8, and 9 in vertebrates.
To date, the Tolls in penaeid shrimp have been isolated from white leg shrimp and black tiger shrimp. In this study, we isolated a new type of Toll (MjToll) with a different structure compared to the other penaeid Tolls. The MjToll showed 59.1% and 59.8% identity to lToll and PmToll, respectively; while the identity between lToll and PmToll was 96.9%. Therefore, the homology analysis suggests that
Analysis of LRRs in MjToll and comparison of MjToll with Toll/TLR homologues
Figure 4 Alignment of the MjToll Toll/IL-1 receptor (TIR) domain with the other TIRs. Identical or highly conserved residues are shaded in black while similar residues are shaded in grey. Sequences for the alignment were obtained from the GenBank (Table 2).
128
T. Mekata et al.
Table 2
Details of genes used for MjToll analysis
Species
Name
Accession number
Homo sapiens
HsTLR1 HsTLR2 HsTLR3 HsTLR4 HsTLR5 HsTLR6 HsTLR7 HsTLR8.1 HsTLR8.2 HsTLR9A HsTLR9B MmTLR MmTLR2 MmTLR3 MmTLR4 MmTLR5 MmTLR6 MmTLR7 MmTLR8 MmTLR9 MmTLR11 MmTLR12 MmTLR13 GgTLR1 GgTLR2 GgTLR5 GgTLR7 DrTLR2 DrTLR3 DrTLR4b OmTLR OmTLR3 SsTLR TtTLR lToll SpTLR1.1 SpTLR1.2 SpTLR2.1 EsTLR DmToll Dm18W DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 DmToll9 AgToll AaToll DyToll DsToll AmToll
NP_003254 NP_003255 NP_003256 AAF05316 NP_003259 NP_006059 NP_057646 NP_057694 NP_619542 AAF72189 AF259263 NP_109607 NP_036035 NP_569054 NP_067272 AAF65625 NP_035734 NP_573474 NP_573475 NP_112455 NP_991388 AAS37673 NP_991389 NP_001007489 NP_989609 NP_001019757 CAG15146 NP_997977 NP_001013287 NP_997978 CAF31506 AAX68425 CAJ80696 BAD12073 ABK58729 NP_999670 NP_999671 AAK21261 AAY27971 AAQ64938 AAA79208 AAF86229 AAF86228 AAF86227 AAF86226 AAF86225 AF247764 NP_649214 AAL37901 EAT48962 AAQ65064 AAQ64875 AAX33677
Mus musculus
Gallus gallus
Danio rerio
Oncorhynchus mykiss Salmo salar Tachypleus tridentatus Litopenaeus vannamei Strongylocentrotus purpuratus Euprymna scolopes Drosophila melanogaster
Anopheles gambiae Aedes aegypti Drosophila yakuba Drosophila simulans Apis mellifera
MjToll belongs to a new class of Toll receptors in shrimp. However, the domain structure of MjToll is similar to that of lToll and DmToll. This might suggest that Tolls in penaeid shrimp were derived from the same ancestral gene as
DmToll, and it expanded to a variety of Toll classes during evolution. All TLRs contain a number of N-linked glycosylation sites that may influence the surface pattern recognition of the receptor. TLR2 and TLR4 were reported to require glycosylation for functional activation [19,20]. When the predicted N-glycosylation sites of the human TLRs were examined, the concave surface formed by LRR residues 2e9 usually contained the glycosylation sites, and was predicted to contain the ligand-binding site of the TLRs [21]. Eleven potential N-linked glycosylation sites were found in the LRRs of the predicted Toll receptor protein sequence in scallop, Chlamys farreri, where Asn409, Asn508, Asn549 and Asn752 were located on a concave surface of this receptor [22]. Although 16 potential N-linked glycosylation sites were identified in the MjToll, the strict positions of important residues in the concave surface of LRRs in MjToll have not been determined. Further study of the active sites for N-glycosylation will be required in order to analyze the receptoreligand binding for biological activity. The LRR domains in mammalian TLRs recognize and respond to many different microbe components [23]. It has been shown that TLR9 affects the cell-mediated immune response for CpG DNA [24]. LRRs in human TLR9-ectodomain (ECD) have an insertion at position 10 [21]. This insertion has a place in a loop that connects the b-face in the convex surface with a CXXC motif. A similar motif was identified in the ligand-binding region of the CpG-binding protein that contains a Zn2þ ion and binds directly to unmethylated CpG dinucleotide sequences [25]. As TLR9 also responds to unmethylated CpG-containing sequences, it has been proposed that this insertion is directly involved in PAMP binding and perhaps coordinates a metal ion [21]. TLR5 is essential for the inflammatory response to flagellin from Gram-negative bacteria [26]. LRRs in TLR5 have also an insertion at position 15 [21]. Recently, it had been demonstrated that flagellin binds directly to the TLR5-ECD [27]. The flagellin-binding site in TLR5 is located between residues 386 and 407, placing it in LRR14. The sequence of LRR14, which is 32 residues in length, reveals a six-residue insertion after position 15. There is a possibility that this insertion in TLR5 contributes to flagellin binding [21]. DmToll and the TtToll do not possess insertions in their LRRs where this Toll may not directly recognize PAMP [28,29]. Therefore, the existence of an insertion in TLR-ECD may be important for the PAMP-binding pattern. The LRR domain of MjToll has insertions that are present in other Toll family genes, including the lToll gene, where LRR-10 has the insertion. This suggests that MjToll could function as a PAMP-binding receptor. However, because only one LRR has been detected with an insertion, no conclusions can be drawn about the function of MjToll with respect to the binding of PAMPs. Phylogenetic analyses showed the MjToll groups to the lToll and insect Toll family maintaining high bootstrap values (DmTolls, AmToll and AeToll). Tolls in vertebrates formed a cluster away from the shrimp and insect Tolls. MjToll forms Toll and clusters with the invertebrates, and might be derived from a common ancestral gene. Genomic organization of the MjToll gene consists of four exons and three introns that are different from the DmToll
Toll receptor in M. japonicus
Table 3
Amino acid identity and similarity of MjToll gene with other known Toll/TLR sequences MjToll lToll DmToll1 DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm Mm TLR1 TLR2 TLR3 TLR4 TLR5 TLR6 TLR7 TLR8 TLR9 TLR11 TLR12 TLR13
MjToll lToll DmToll1 DmToll3 DmToll4 DmToll5 DmToll6 DmToll7 DmToll8 MmTLR1 MmTLR2 MmTLR3 MmTLR4 MmTLR5 MmTLR6 MmTLR7 MmTLR8 MmTLR9 MmTLR11 MmTLR12 MmTLR13
60.2 49.2 40.9 47.1 42.2 35.3 36.3 42 38.9 38.9 40.6 40.1 40.2 37.7 43.2 43.8 41.8 42.7 40.3 43.1
41.7 27.7 27.8 47.6 43.1 39.6 45.7 92.8 47.7 44.7 34.3 37.3 34.5 35.9 38 41.6 41.6 37.6 42 38.1 45.7 41.5 43.5 38.8 44.5 41.1 42.7 37.8 42.7 44.4 40.9 44.2 41 42.6 43.2 39.1 42.4 37.8 44.2 43.1
21.2 24 21.1 38.7 48.6 28.1 30.2 32.8 45 41.8 41.5 43.6 39.5 43.2 38.6 38 39.2 39.1 39.6 41.3
28.4 27.7 92.5 21.7 42.1 38.8 38 43.2 36.8 37.5 38.8 38.4 40.1 35.7 42.9 43.2 41.9 38.7 36.4 42.2
24.6 26.6 27.4 24.7 25.9 29.9 30.2 35.3 46.2 44 41.8 43.8 42.5 44.5 38.9 38.6 37.8 40 39.6 42.1
18.7 18.8 21.1 15.3 21.6 16.6 56.9 57.8 28.3 29.7 31.6 29.8 29.6 27.5 32.9 32.7 33.8 31.8 29.8 33.2
19.9 20 21.5 17.5 22.6 18.3 36.4 56.4 30.8 30.3 32.3 31.2 31.7 28.9 35.1 34 34.4 33.1 32.3 35.7
22.8 23.8 22.1 18.7 23.2 20.4 36.9 34.9 33.6 32.3 35.5 34 33.3 34.3 37.1 37.6 36.2 34.4 34.2 38.6
21.2 21.6 20.4 21.3 19.9 21.7 15.7 16.9 19 53.2 44.1 44.1 45.2 77.4 40.5 39.1 40.7 41.5 41.1 42
21 23.3 19.6 20.3 19.7 21.7 16.1 17.9 17.6 30.2 44 45.6 44.2 54.7 41.1 40.4 40.8 41.6 41.7 41.5
20.9 22.6 20.8 19.9 20.8 20.9 16.6 18.5 21.7 23.8 22.2 44.5 47.2 43.8 45.5 45.2 44.9 45.5 44.7 47.2
20.4 24.1 19.9 20.5 21 23.5 17.2 17.6 20.3 23.5 25.6 25.7 46 45.6 42 43.5 41.7 42.5 42.6 44
20.9 22.3 21 18.5 20.7 22.9 17.1 18.6 18.9 23.1 25.9 24.2 24.1 44.9 42.9 42.1 41.3 44.5 43.6 44.3
21.3 22.5 20.4 21.6 19.7 22.2 16.1 16.5 18.4 64.7 30.9 24.3 24.1 22.6 40 39.4 40.7 42.3 41.4 42.1
21.1 22.2 21.6 19.1 21 20.8 17.9 19 19.7 21.7 22.5 26 23.5 24.2 21.6 61.5 56.7 41.9 41.4 48.4
22.2 22.7 22.2 20.6 21.9 20.7 19 18.8 19.2 22 22.6 25.5 25.1 23.7 22.5 42.2 56 41.4 40.9 47.2
20.6 22.4 21.2 21.2 21.5 22.8 20.3 20.4 20.6 22.3 23.6 24.4 23.6 22.8 23.2 36.1 34.8 40.9 40.1 47
22.7 23.5 20 20.4 20.7 21.6 18.4 19.6 19.9 20.6 21.6 23.4 21.9 24.4 21.6 23.1 23.1 22.8 55.2 45.5
20.8 21 18.6 19.4 19.1 20.5 17.2 19.4 19.9 21.4 22.8 24.1 22 23.1 22.4 22.1 21.7 23.9 37.4
21.9 23.4 22.2 21.5 21.2 22.4 18.5 19.9 21.6 24.2 24 26.5 27 24.4 25.4 27.2 26.5 25.6 25.4 26.6
44.7
Upper triangle: identity, lower triangle: similarity.
129
130
T. Mekata et al.
Figure 5
Alignment of the ectodomain of MjToll gene to the consensus sequences of leucine-rich repeats (LRRs).
MmTLR11 MmTLR12
Vertebrate TLR5 Vertebrate OmTLR3 TLR3 DrTLR3
HsTLR5 MmTLR5 GgTLR5 MmTLR13
Sea urchin TLR SpTLR2.1
Vertebrate TLR11,12,13
HsTLR3 MmT3
OmTLR1 SsTLR1
MmTLR4
Vertebrate TLR4
HsTLR4
SpTLR1.2
DrTLR4b
SpTLR1.1
MmTLR2
Vertebrate TLR1,2,6
HsTLR2 HsTLR9B HsTLR9A
Gg TLR2 DrTLR2
MmTLR9
DrTLR1 HsTLR8.2 GgTLR1
HsTLR8
MmTLR1
MmTLR8
HsTLR1 GgTLR7
Vertebrate TLR7,8,9
MmTLR6 HsTLR6
HsTLR7 MmTLR7
DmToll4 Dm Toll1 Ds Toll
Es TLR Dm Toll5
Dy Toll Aa Toll
DmToll8 Lv Toll
Mj Toll
Tt TLR
Am Toll Dm Toll6
Dm Toll7
Invertebrate Toll/TLR
Figure 6 Phylogenetic tree of TLRs. The full length amino acid sequences of TLRs from different organisms are aligned using the CLUSTAL X (version 1.83) program [40]. The phylogenetic tree was constructed using the Bootstrap NJ method with using the program MEGA 4 [17] . The scale bar indicates a branch length of 0.2 amino acid sequences and was obtained from the GenBank (Table 2).
Toll receptor in M. japonicus
131 123 294
252
MjToll 2273
149
403
202
117
DmToll1 1220
2071 53
1189
DmToll4
740
124
109
682
2464
DmToll6 4987
DmToll7 4271 103
DmToll9 295
231
70
216
727
222
1620
61
128 207
1128
Tehao
1342
1046
Intron Exon
18W 4158
Figure 7 Comparison of the genomic structure of MjToll to DmTolls. Boxes indicate exon-coding regions while bars indicate introns. Numbers indicate the length of the nucleotide sequences in each region. Nucleotide sequences were obtained from the GenBank (Table 2).
Figure 8 Expression analysis of MjToll in tissues. Specific-PCR was performed using the MjToll gene-specific primers, MjToll-F and MjToll-R, with cDNA from several tissues and was synthesized by RT-PCR. The b-actin gene was used as a control to determine the amount and quality of the cDNA. Abbreviations used: 1, stomach; 2, gill; 3, gut; 4, lymphoid organ; 5, muscle; 6, heart; 7, hepatopancreas; 8, hematopoietic organ; 9, hemocytes; 10, ventral abdominal nerve cord; 11, eyestalk neural ganglia; and 12, brain.
Figure 9 Quantitative real-time PCR analysis of the MjToll gene in lymphoid organ culture using LPS, CpG DNA, flagellin, Imiquimod, PG, polyI:C at 0, 1.5, 3, 6, 9 and 12 h. Quantitative MjToll mRNA levels were determined using real-time PCR and standardized with b-actin mRNA levels. Data are presented as means SE of triplicate tests.
132
T. Mekata et al.
Table 4 12 h
Copy numbers of MjToll mRNA in the lymphoid organ using several immunostimulants at 0 (control), 1.5, 3, 6, 9 and Control
CpGDNA Flagellin Imiquimod LPS Peptidoglycan PolyI:C a
2.80E þ 04 2.30E þ 04 4.80E þ 04 2.70E þ 04 1.40E þ 04 1.10E þ 04
1.5 h 7.8E þ 04 1.9E þ 04 7.1E þ 04 2.2E þ 04 5.2E þ 03 1.9E þ 04
3h (2.8) (0.8) (1.5) (0.8) (0.4) (1.8)
a
4.7E þ 04 1.5E þ 04 7.0E þ 04 4.9E þ 04 1.5E þ 04 7.0E þ 04
6h (1.7) (0.6) (1.5) (1.8) (1.1) 6.5)
1.7E þ 04 1.7E þ 04 6.9E þ 04 2.0E þ 04 8.9E þ 03 9.3E þ 03
9h (0.6) (0.7) (1.4) (0.7) (0.6) (0.9)
2.0E þ 05 2.7E þ 04 8.3E þ 04 3.8E þ 04 3.8E þ 05 7.0E þ 04
12 h (7.2) (1.2) (1.7) (1.4) (26.8) (6.6)
3.3E þ 04 3.8E þ 04 1.5E þ 05 5.5E þ 04 1.1E þ 06 6.6E þ 03
(1.2) (1.6) (3.2) (2.0) (76.0) (0.6)
Fold to control.
family genes. An intron exists in the TIR domain of MjToll and PmToll [30]; while no introns are found in most TIR domains of Tolls and TLRs. In the Toll/TLR genes that contain introns, the locations and phases are different which suggests that the TIR domain may have been subjected to many events of intron invasion during evolution [31,32]. This suggests that MjToll, like other shrimp and invertebrate Tolls and Vertebrate TLR genes, may also have had intron invasion. MjToll gene was expressed in a variety of tissues including the gill, gut, lymphoid organ, heart, hematopoietic organ, hemocytes, ventral abdominal nerve cord, eyestalk neural ganglia, and brain. Constitutive expression of MjToll gene in tissues is similar to that of lToll [33] and TtToll [29]. Members of the human TLR (HsTLR) family have been reported to differentially express in several tissues. Especially, HsTLR2, HsTLR4 or HsTLR8 are expressed in abundant tissues [34e36] and are involved with systemic biophylactic response. The expression of MjToll gene in a variety of tissues suggests these tissues have the possibility to react to an invasion by a pathogen where MjToll may be responsible for systemic innate immunity. Expression of MjToll gene was increased by stimulation with 10 mg/mL of PG at 9 and 12 h, and its levels were 26.8and 76.0-fold higher compared to the control. TLR2 in humans plays a major role in detecting Gram-positive bacteria and is also involved in the recognition of other microbial components such as LPS from Gram-negative bacteria or lipoteichoic acid from Gram-positive bacteria [37e39]. Although it is difficult to draw firm conclusions from the expression analysis, the similarity of ligand-recognition suggests that kuruma shrimp has a TLR homologue with the same ligandereceptor binding pattern to human TLR2. Therefore, further work will be required to isolate the other classes of Tolls and signaling molecules involved in Toll pathway and to compare expression profiles of penaeid shrimp Tolls in order to determine the biological functions. However, the discovery of a new type of Toll gene in penaeid shrimp will allow more detailed investigation into innate immune responses in shrimp.
Acknowledgements This study was supported in part by a grant from Research Fellowships of the Japan Society for the Promotion of Science (JSPS) for Young Scientists and Research and Development Program for New Bio-industry Initiatives.
References [1] Nusslein-Volhard C, Lohs-Schardin M, Sander K, Cremer C. A dorso-ventral shift of embryonic primordia in a new maternal-effect mutant of Drosophila. Nature 1980;283: 474e6. [2] Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 1996;86:973e83. [3] Hopkins PA, Sriskandan S. Mammalian toll-like receptors: to immunity and beyond. Clinical and Experimental Immunology 2005;140:395e407. [4] Yamamoto M, Akira S. TIR domain-containing adaptors regulate TLR signaling pathways. Advances In Experimental Medicine and Biology 2005;560:1e9. [5] Akira S. Mammalian toll-like receptors. Current Opinion In Immunology 2003;15:5e11. [6] Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nature Immunology 2001;2:675e80. [7] Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature 2000;406:782e7. [8] Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RA. Phylogenetic perspectives in innate immunity. Science 1999;284: 1313e8 [New York, NY]. [9] Wilson K, Cahill V, Ballment E, Benzie J. The complete sequence of the mitochondrial genome of the crustacean Penaeus monodon: are malacostracan crustaceans more closely related to insects than to branchiopods? Molecular Biology and Evolution 2000;17:863e74. [10] Zambon RA, Nandakumar M, Vakharia VN, Wu LP. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 2005;102:7257e62. [11] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 1997;10:1e6. [12] Pearson WR, Lipman DJ. Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences of the United States of America 1988;85:2444e8. [13] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology 1990;215: 403e10. [14] Needleman SB, Wunsch CD. A general method applicable to the search for similarities in the amino acid sequence of two proteins. Journal of Molecular Biology 1970;48:443e53. [15] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994;22:4673e80.
Toll receptor in M. japonicus [16] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 1987;4:406e25. [17] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. molecular biology and evolution 2007;24:1596e9. [18] Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985;39:783e91. [19] Weber AN, Morse MA, Gay NJ. Four N-linked glycosylation sites in human toll-like receptor 2 cooperate to direct efficient biosynthesis and secretion. Journal of Biological Chemistry 2004; 279:34589e94. [20] Ohnishi T, Muroi M, Tanamoto K. MD-2 is necessary for the tolllike receptor 4 protein to undergo glycosylation essential for its translocation to the cell surface. Clinical and Diagnostic Laboratory Immunology 2003;10:405e10. [21] Bell JK, Mullen GE, Leifer CA, Mazzoni A, Davies DR, Segal DM. Leucine-rich repeats and pathogen recognition in toll-like receptors. Trends in Immunology 2003;24:528e33. [22] Qiu L, Song L, Xu W, Ni D, Yu Y. Molecular cloning and expression of a toll receptor gene homologue from Zhikong scallop, Chlamys farreri. Fish & Shellfish Immunology 2007; 22:451e66. [23] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [24] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A toll-like receptor recognizes bacterial DNA. Nature 2000;408:740e5. [25] Lee JH, Voo KS, Skalnik DG. Identification and characterization of the DNA binding domain of CpG-binding protein. Journal of Biological Chemistry 2001;276:44669e76. [26] Takeda K, Kaisho T, Akira S. Toll-like receptors. Annual Review of Immunology 2003;21:335e76. [27] Mizel SB, West AP, Hantgan RR. Identification of a sequence in human toll-like receptor 5 required for the binding of Gram-negative flagellin. Journal of Biological Chemistry 2003;278:23624e9. [28] Levashina EA, Langley E, Green C, Gubb D, Ashburner M, Hoffmann JA, et al. Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 1999;285:1917e9. New York, NY.
133 [29] Inamori K, Ariki S, Kawabata S. A toll-like receptor in horseshoe crabs. Immunological Reviews 2004;198:106e15. [30] Arts JA, Cornelissen FH, Cijsouw T, Hermsen T, Savelkoul HF, Stet RJ. Molecular cloning and expression of a toll receptor in the giant tiger shrimp, Penaeus monodon. Fish & Shellfish Immunology 2007;23:504e13. [31] Kanzok SM, Hoa NT, Bonizzoni M, Luna C, Huang Y, Malacrida AR, et al. Origin of toll-like receptor-mediated innate immunity. Journal of Molecular Evolution 2004;58:442e8. [32] Rogers JH. The role of introns in evolution. FEBS Letters 1990; 268:339e43. [33] Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, Weng SP, et al. A toll receptor in shrimp. Molecular Immunology 2007;44: 1999e2008. [34] Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proceedings of the National Academy of Sciences of the United States of America 1998;95:588e93. [35] Chaudhary PM, Ferguson C, Nguyen V, Nguyen O, Massa HF, Eby M, et al. Cloning and characterization of two toll/interleukin-1 receptor-like genes TIL3 and TIL4: evidence for a multigene receptor family in humans. Blood 1998;91:4020e7. [36] Chuang TH, Ulevitch RJ. Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9. European Cytokine Network 2000;11:372e8. [37] Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, et al. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 1999;11:443e51. [38] Heine H, Kirschning CJ, Lien E, Monks BG, Rothe M, Golenbock DT. Cutting edge: cells that carry A null allele for toll-like receptor 2 are capable of responding to endotoxin. Journal of Immunology 1999;162:6971e5. [39] Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. Journal of Biological Chemistry 1999;274:17406e9. [40] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 1997;25:4876e82.