Identification of CpG oligodeoxynucleotide sequences that induce IFN-γ production in canine peripheral blood mononuclear cells

Veterinary Immunology and Immunopathology 102 (2004) 441–450 www.elsevier.com/locate/vetimm

Identification of CpG oligodeoxynucleotide sequences that induce IFN-g production in canine peripheral blood mononuclear cells Keigo Kurataa, Akira Iwatab, Kenichi Masudaa,d,*, Masahiro Sakaguchic, Koichi Ohnoa, Hajime Tsujimotoa a

Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Nippon Institute for Biological Science, 9-2221-1 Shin-machi, Ome-shi, Tokyo 198-0024, Japan c National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan d Laboratory for Allergy Regulation, Research Center for Allergy and Immunology, Yokohama Institute, RIKEN (The Institute of Physical and Chemical Research), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan Received 2 May 2003; received in revised form 27 April 2004; accepted 11 August 2004

Abstract Oligodeoxynucleotides containing the cytosine-phosphate-guanine (CpG) motif (CpG-ODNs) have been shown to induce TH1 immune responses in animals. Since the sequences of CpG-ODNs that induce TH1 responses are considered to vary among animal species, it is necessary to identify effective CpG-ODNs in each animal. In order to identify the sequences of CpG-ODNs that induce TH1 responses in dogs, mRNA expression and protein production of IFN-g were examined in peripheral blood mononuclear cells (PBMCs) from healthy dogs treated with 11 kinds of synthetic CpG-ODNs. One of the 11 CpG-ODNs (No. 2 CpG-ODN, 50 -GGTGCATCGATGCAGGGGGG-30 ) was shown to significantly increase mRNA expression and protein production of IFN-g in canine PBMCs in a manner dependent on the sequence of the CpG motif. This CpG-ODN also enhanced the expression of IL-12 p40 mRNA in canine PBMCs, whereas expression of IL-12 p35, IL-18, and IL-4 mRNAs was not induced by this CpG-ODN. These results indicate that this CpG-ODN was able to produce IFN-g by induction of TH1skewed immune response in dogs. CpG-ODNs may be useful for inducing prophylactic and therapeutic immunity against allergic diseases, viral infection, and tumors in dogs. # 2004 Elsevier B.V. All rights reserved. Keywords: CpG-ODNs; IFN-g; BMCs; Dogs; TH1 cytokines

1. Introduction * Corresponding author. Tel.: +81 45 503 7051; fax: +81 45 503 7049. E-mail address: [email protected] (K. Masuda).

It has been shown that bacterial DNA activates natural killer (NK) cells to increase their production of IFN-g in mice (Yamamoto et al., 1992b). In the

0165-2427/$ – see front matter # 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2004.08.004

442

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

induction of IFN-g production by bacterial DNA, it was found that sequences containing a cytosinephosphate-guanine (CpG) motif played a major role, and synthetic oligodeoxynucleotides containing the CpG motif (CpG-ODNs) also showed activity similar to bacterial DNA (Tokunaga et al., 1992; Yamamoto et al., 1992a). Moreover, in humans and mice, CpGODNs were shown to induce the production of several other cytokines such as IL-6, IL-12, IL-18, TNF-a and type I IFN by monocytes and dendritic cells (Bohle et al., 1999; Klinman et al., 1996; Kranzer et al., 2000; Krug et al., 2001; Lipford et al., 1997; Sun et al., 1998), and B cell proliferation and production of immunoglobulin by B cells (Krieg et al., 1995). Due to the immunostimulatory effects of CpGODNs, adjuvant immunotherapy using CpG-ODNs has been recognized as a potential therapeutic tool for clinical use against allergic diseases, viral infections, and tumors. For instance, adjuvant effects of CpGODNs were shown in mouse models of asthma, and found to be due to inhibitory effects against the production of TH2 cytokines such as IL-5 and antigenspecific IgE (Kline et al., 1998; Santeliz et al., 2002; Shirota et al., 2000; Sur et al., 1999). Protective immunity against hepatitis B virus infection was enhanced by a CpG-ODN in mice (Davis et al., 1998). Injection of tumor peptides with CpG-ODNs enhanced CTL responses against the respective tumor (Davila and Celis, 2000; Miconnet et al., 2002). Thus, based on these data, specific sequences of CpG-ODNs that induce TH1 cytokine production in an effective manner have been identified in mouse and human cells. The immunostimulatory effects of CpG-ODNs have also been shown in other animals such as cattle (Pontarollo et al., 2002), pigs (Kamstrup et al., 2001), sheep, goats, houses, dogs, cats, and chickens (Rankin et al., 2001). In dogs, sequences of CpG-ODNs that induced proliferation of spleen cells were identified (Wernette et al., 2002); however, cytokine production was not measured. Therefore, it is still not known whether those sequences are able to specifically induce TH1 responses in dogs. In this study, in order to identify the sequences of CpG-ODNs that induce TH1 cytokines in dogs, 11 kinds of synthetic CpG-ODNs were examined for their ability to induce the expression of mRNA and protein of IFN-g in PBMCs obtained from normal dogs. The

expression of IL-4, IL-12, and IL-18 mRNAs was also examined in PBMCs cultured with one specific CpGODN that was found to be effective inducer of IFN-g in this study.

2. Material and methods 2.1. Animals Seventeen beagles at 1 year of age (16 females and 1 male) kept for experimental purposes were used in this study. None of the dogs showed any clinical signs and there were no abnormalities in the general physical condition of these dogs, which were thus considered to be healthy. Six to nine dogs were randomly chosen from the dog group and used for each experiment. 2.2. Oligodeoxynucleotides Eleven kinds of oligodeoxynucleotides (Nos. 1–11) used in this study were designed according to a previous report (Verthelyi et al., 2001) and commercially synthesized (Takara Bio, Kyoto, Japan) (Table 1). In these CpG-ODNs (e.g., 50 -GGtgcatcgatgcagGGGGG-30 ), the bases represented in lowercase letters were modified with phosphorodiester and Table 1 Sequences of CpG-ODNs and GpC-ODNs used in this study CpG-ODNs No. 1 No. 2 No. 3 No. 4 No. 5 No. 6 No. 7 No. 8 No. 9 No. 10 No. 11

GG GG GG GG GG GG GG GG GG GG GG

GpC-ODNs No. 20

GG tgc atgcat gcag GGGGG

tgc tgc tgc tgc tgc tgc tgc tgc tgc tgc tgc

aacgtt gcag GGGGG atcgat gcag GGGGG accggt gcag GGGGG ggcgcc gcag GGGGG gtcgac gcag GGGGG gccggc gcag GGGGG cgcgcg gcag GGGGG ctcgag gcag GGGGG cccggg gcag GGGGG tacgta gcag GGGGG tccgga gcag GGGGG

Bases represented in lower-case letters were modified with phosphorodiester and those in capital letters were modified with phosphorothioate. Squares indicate palindrome sequences containing cytosine-phosphate-guanine (CpG) motif and reversed alignment of CpG motif (GpC).

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

those in capital letters were modified with phosphorothioate. All of the CpG-ODNs consisted of 20 bases containing a palindromic CpG motif. As a control oligodeoxynucleotide (No. 20 ) for No. 2 CpG-ODN, No. 20 GpC-ODN was synthesized in a similar manner, except that the CpG motif (–CG–) was converted to a GpC motif (–GC–). The levels of endotoxin in all of the ODNs were measured to be less than 0.05 ng/mg by Limulus assay (Bio Whittaker, Walkersville, MD). 2.3. Isolation of PBMCs PBMCs were prepared by density gradient centrifugation of heparized peripheral blood samples obtained from dogs as previously reported (Masuda et al., 2000). Briefly, a volume of peripheral blood was diluted with an equal volume of D-PBS and layered on Ficoll-Hypaque (AXIS-SHIELD PoC AS, Oslo, Norway). After centrifugation at 350  g at room temperature for 40 min, the layer containing the PBMC fraction was obtained and suspended in RPMI 1640 (Sigma, St. Louis, MO) containing 10% heatinactivated pooled dog serum, antibiotics (penicillin 100 U/ml and streptomycin 0.1 mg/ml) and L-glutamine (2 mM) at a cell concentration of 2.5  106 cells/ ml. 2.4. A quantitative real-time sequence detection system to measure mRNA expression For examination of IFN-g mRNA expression, PBMCs were stimulated with each oligodexynucleotide at a concentration of 1 mM at 37 8C for 24 h. The concentration of CpG-ODNs and incubation period were determined to be optimal by measuring the expression of IFN-g mRNA in a pilot study in which the effects of various concentrations (0.1, 1, and 10 mM) of CpG-ODNs (Nos. 2, 6, 8, or 10) and of 12and 24-h incubations were examined (data not shown). For examination of the expression of IL-4, IL-12 p35, IL-12 p40, and IL-18 mRNAs, PBMCs were stimulated with each oligodeoxynucleotide at a concentration of 1 mM at 37 8C for 12 h. In a pilot study, the expression of these cytokine mRNAs after 6- and 12-h incubations was examined. It was found that a 12-h incubation was optimal for detection of the mRNA expression of these cytokines.

443

Total RNA samples were extracted from the cultured PBMCs with the acid guanidium-phenolchloroform (AGPC) method with RNAzol (Tel Test, Friendswood, TX). The extracted RNA samples were treated with RNase-free DNase I (Invitrogen, Carlsbad, CA) to remove DNA contamination and then stored at 80 8C until use. A real-time sequence detection system was applied for the quantitative measurement of cytokine mRNAs as we previously reported (Maeda et al., 2002). The amounts of mRNAs of cytokines including IL-4, IL-12 p35, IL-12 p40, IL-18, and IFN-g were measured in comparison to that of b-actin in each sample. For each of the targeted genes (canine IL-4, IL-12 p35, IL-12 p40, IL-18, IFN-g, and b-actin), a pair of oligonucleotide primers and an oligonucleotide probe were designed using a computer software package, Primer Express (Applied Biosystems, Foster City, CA), based on the sequences registered in GenBank database (GenBank/EMBL/DDBJ accession number: IL-4, AF054833; IL-12 p35, U49085; IL-12 p40, U40100-1; IL-18, Y111333; IFN-g, AF126247; b-actin, Z70044) (Table 2). Amplification conditions were identical for all reactions: 30 min at 48 8C, 10 min at 95 8C, and 40 cycles of 15 s at 95 8C and 60 s at 60 8C. The PCR products amplified with each primer pair were sequenced to confirm the amplification of each targeted cytokine cDNA. The both 50 and 30 ends of the internal probes were labeled with a reporter dye, 6-carboxyfluorescein (FAM), and a quencher dye, 6-carboxytetramethylrhodamine (TAMRA), respectively. Quantitative real-time PCR for the target genes was performed with a TaqManTM Gold RT-PCR Kit (Applied Biosystems) and an ABI Prism 7700 Sequence Detection System (Applied Biosystems), using the one-step RT-PCR method. The CT (threshold cycle) value was defined as the number of PCR cycles at which a significant increase in reporter fluorescence was first detected, and was used for quantification of the mRNA expression of cytokines. The CT value of the calibrator (b-actin) was subtracted from that of the target cytokine to calculate the DCT value. All samples were examined in duplicate and the mean value of the DCT was calculated for each sample. The amount of the targeted RNAs was represented as the 2DCT value, resulting in evaluation of the samples as an n-fold difference relative to b-actin.

444

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

Table 2 Sequences of primer pairs and probes for the quantitative real-time sequence detection system used in this study Target gene

Primer probe

Sequence (50 –30 )

Nucleotide position

IL-4

Forward primer Reverse primer Probe Forward primer Reverse primer Probe Forward primer Reverse primer Probe

CATCCTCACAGCGAGAAACG CCTTATCGCTTGTGTTCTTTGGA CATGGAGCTGACTGTCAAGGACGTCTTCA AAGCCACCTGGACCACCTTA AATATTCCTGGGCTCGGTGA TGGGCCAGGAGCCTCCCCA GCCAAGGTCGTGTGCCA CCAGTCGCTCCAGGATGAAC CGTGCAAGCCCGAGACCGC

117–136 177–199 144–172 48–67 94–113 70–88 889–905 956–969 924–942

IL-18

Forward primer Reverse primer Probe

CTrCTCCTGTAAGAACAAAACTATTTCCTT GAACACTTCTCTGAAAGAATATGATGTCA CAGAAAATGAGTCCTCCGGATAGTATCAATGATG

328–356 399–427 358–391

100

IFN-G

Forward primer Reverse primer Probe

GCGCAAGGCGATAAATGAAC CTGACTCCTTTTCCGCTTCCT TGATGAATGATCTCTCACCAAGATCCAACC

336–355 397–417 365–394

82

AF126247

b-Actin

Forward primer Reverse primer Probe

GACCCTGAAGTACCCCATTGAG TTGTAGAAGGTGTGGTGCCAGAT CGTCACCAACTGGGACGACATGGA

131–152 189–211 161–184

81

Z70044

IL-12 p35

IL-12 p40

2.5. Detection of canine IFN-g by sandwich ELISA For measurement of IFN-g in the culture supernatant, PBMCs (2.5  106 cells/ml) were stimulated with each oligodeoxynucleotide at a concentration of 1 mM in the presence of 1 mg/ml of mouse anti-canine CD3 monoclonal antibody (a-cCD3 mAb) (Serotec Ltd., Oxford, UK) at 37 8C for 48 h, according to previous reports (Iho et al., 1999; Kranzer et al., 2000). PBMCs stimulated with only a-cCD3 mAb were used as a negative control. The optimal dosage of a-cCD3 mAb to enhance IFN-g production in PBMC cultures was determined to be 1 mg/ml in a pilot study using various concentrations (0.1, 1 and 5 mg/ml). In the pilot study, isotype control antibody, mouse IgG1 (Serotec Ltd., Oxford, UK), was found not to enhance IFN-g protein from PBMCs in response to any CpGODN stimulation (date not shown). Regarding the incubation period, 24-, 48-, and 72-h incubations were also examined in another pilot study, in which 48-h incubation was determined to be optimal to evaluate IFN-g protein in PBMC culture supernatants (data also not shown).

Length of the PCR product (bp)

GenBank accession number

83

AF054833

66

U49085

81

U40100-1

Y11133

Polyclonal antibody to canine IFN-g was purified from a serum sample from a rabbit immunized with recombinant canine IFN-g (Nishikawa et al., 2001a) using a Protein A column (PerSeptive Biosystem, Cambridge, MA). The polyclonal antibody was used as a primary antibody to capture IFN-g on the bottom of the microtiter plates. On the other hand, the purified polyclonal antibody (5 mg/ml) was labeled with biotin by mixing an equal volume of dimethylsulfoxide solution containing N-hydroxysuccinimide-biotin (1 g/ml) (Sigma, St. Louis, MO) overnight. Unreacted biotin was removed from the solution using an NP-10 column (Amersham Biosciences, Piscataway, NJ). Microtiter plates were coated with 50 ml of the unlabelled polyclonal antibody (10 mg/ml) in 50 mM carbonate buffer (pH 9.6) at 37 8C for 1 h, and then blocked with a blocking buffer containing 1% bovine serum albumin in PBS. After washing with PBS containing 0.05% Tween 80 (PBST), 50-ml aliquots of culture supernatants and standard samples of recombinant canine IFN-g protein were added to each well and incubated at 37 8C for 1 h. After washing, 50 ml of the biotinylated antibody diluted with the blocking

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

buffer at 1:1000 was added to each well, and the plates were further incubated at 37 8C for 1 h. After washing with PBST, 50 ml of horseradish-peroxidase-labeled avidin (Jackson ImmunoResearch Laboratories, West Grove, PA) diluted with the blocking buffer at 1:1000 was added, and the plates were incubated at 37 8C for 1 h. After intensive washing, 50 ml of a substrate solution containing 0.8 mg/ml 2,20 -azino-bis(3-ethylbenzothiazoline-6sulfonic acid) diammonium salt (ABTS) and 0.006% H2O2 in 0.1 M citrate-phosphate buffer were added to each well. After incubation for 30 min, the reaction was stopped by the addition of 1 N NaOH. The absorbance at 415 nm of the solution in each well was measured using a microplate reader (TOSOH, Tokyo, Japan). A standard sample of recombinant canine IFN-g protein expressed by a baculovirus vector (Nishikawa et al., 2001b) was used to generate a standard curve. Bioactivity of the IFN-g was assayed by measuring the inhibition of cytopathic effect in canine A72 cells after vesicular stomatitis virus infection as previously reported (Iwata et al., 1996). The detection range of the assay was from 0.023 to 23000 laboratory units (LU)/ml. The assay was performed for duplicate in each sample. 2.6. Statistical analysis One-way ANOVA and the Dunnett post hoc test were used to analyze the data of mRNA and protein of IFN-g. Student’s t-test was used to compare IFN-g production by No. 2 CpG-ODN versus No. 20 GpC-ODN. In the statistical analysis of IFN-g protein, a value of 0.023 LU/ml, which was the lower limit of detection by the ELISA, was used for samples with undetectable levels of IFN-g. The Mann– Whitney rank sum test was used to analyze the data of the expression of IL-12 p35, IL-12 p40 and IL-18 mRNAs. Since a CT value of 40 was taken to be the undetectable level of mRNA expression in the quantitative real-time PCR used in this study, this value was used to calculate 2DCT value of samples with undetectable levels in the statistical analysis (Maeda et al., 2002). Statistical significance was defined as P < 0.05 for all the analyses. All the statistical analyses in this study were carried out using StatView 4.11 (Abacus Concept, Berkeley, CA) and JMPIN 3.2.1 (SAS Institute, Cary, NC).

445

3. Results 3.1. Identification of CpG-ODNs that increase expression of mRNA and protein of IFN-g in canine PBMCs The expression of IFN-g mRNA in PBMCs stimulated with 11 kinds of CpG-ODNs was measured in 9 dogs. PBMCs not stimulated with CpG-ODNs were used as a negative control. Expression of IFN-g mRNA was detected in all of the PBMCs cultured with CpG-ODNs and in the negative control. The value of 2DCT of IFN-g mRNA ranged from 3.5  106 to 1.2  103 in PBMCs stimulated with the 11 kinds of CpG-ODNs. Notably, five kinds of CpG-ODNs (Nos. 2, 5, 6, 8, and 11) induced high expression of IFN-g mRNA. The mean values of 2DCT of IFN-g mRNA  standard error of mean (SEM) in PBMCs cultured with these five kinds of CpG-ODNs (Nos. 2, 5, 6, 8, and 11) and the negative control were 1.9  103  6  104, 2.2  103  8  104, 2.1  103  8  104, 1.7  103  6  104, 2.5  103  1.2  103, and 4.2  104  1.0  104, respectively. The mean values of 2DCT of IFN-g mRNA induced by the five kinds of CpGODNs were significantly higher than that of the negative control (P < 0.05) (Fig. 1). Production of IFN-g protein in culture supernatants of PBMCs obtained from 9 dogs stimulated with 11 kinds of CpG-ODNs was examined by ELISA using a polyclonal antibody directed against canine IFN-g. The concentration of IFN-g protein in the culture supernatants ranged from 0.023 to 93.71 LU/ml. It was found that one (No. 2) of the11 kinds of CpGODNs could increase the concentration of IFN-g protein in the culture supernatants of PBMCs from all the dogs, and the mean concentration of IFN-g was significantly higher than that of the negative control (P < 0.05) (Fig. 2). Among the samples obtained from PBMCs cultured with the other CpG-ODNs and their negative controls, some values were below the lower detection limit of IFN-g protein; however, all the samples stimulated with No. 2 CpG-ODN showed detectable levels of IFN-g. From these data, it was concluded that No. 2 CpGODN was effective for the induction of both mRNA and protein of IFN-g in canine PBMCs among the CpG-ODNs examined in this study.

446

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

Fig. 1. Expression of IFN-g mRNA in PBMCs from nine dogs stimulated or not stimulated with 11 kinds (Nos. 1–11) of CpGODNs (1 mM) for 24 h. Bars represent mean values of expression of IFN-g mRNA. PBMCs incubated without CpG-ODNs were used as a negative control (). The asterisks indicate significant differences in mean expression of IFN-g mRNA (P < 0.05).

3.2. IFN-g induction specific to CpG motif of No. 2 CpG-ODN in canine PBMCs In order to determine whether IFN-g induction by No. 2 CpG-ODN was specific to the sequence of the CpG motif, the concentrations of IFN-g protein in the culture supernatants of PBMCs stimulated with the CpG-ODN (No. 2, 50 -ATCGAT-30 ) and GpC-ODN (No. 20 , 50 -ATGCAT-30 ) were measured in six dogs. PBMCs cultured without CpG-ODNs were used as a negative control. The concentrations of IFN-g protein in the culture supernatants of PBMCs stimulated with No. 2 CpG-ODN (mean value  S.E.M.: 9.2  5.2 LU/ml) were significantly higher than those of PBMCs stimulated with No. 20 GpC-ODN (0.7  0.6 LU/ml, P = 0.003) and those of the negative control (0.9  0.8 LU/ml, P = 0.005) (Fig. 3).

Fig. 2. Concentrations of IFN-g in culture supernatants of PBMCs from nine dogs incubated with or without 11 kinds (Nos. 1–11) of CpG-ODNs (1 mM) in the presence of a-cCD3 mAb (1 mg/ml) for 48 h. Bars represent mean values of IFN-g concentration. The dotted line indicates the lower limit of detection (0.023 LU/ml) in this assay. Culture supernatants of PBMCs incubated without CpGODNs was used as a negative control (). The asterisk indicates a significant difference in the mean concentration of IFN-g in culture supernatants (P < 0.05).

(Fig. 4A). In comparison with the values obtained with No. 20 GpC-ODN and the negative control, there was no significant difference in the mRNA expression of IL-12 p35 (No. 2 versus No. 20 , P = 0.46; No. 2 versus negative control, P = 0.56) and IL-18 (No. 2 versus No. 20 , P = 0.07; No. 2 versus negative control, P = 0.29) in PBMCs cultured with No. 2 CpG-ODN (Fig. 4B and C). Measurement of IL-4 mRNA was performed in 6 of the 8 dogs that were used for the analysis of the expression of IL-12 and IL-18 mRNAs. The expression of IL-4 mRNA was not detected in any samples cultured with No. 2 CpG-ODN or No. 20 GpCODN or in the negative control (data not shown).

3.3. Expression of IL-4, IL-12, and IL-18 mRNAs in canine PBMCs stimulated with No. 2 CpG-ODN 4. Discussion The expression of IL-12 p35, IL-12 p40, and IL-18 mRNAs in PBMCs cultured with No. 2 CpG-ODN was measured in eight dogs. The expression of IL-12 p40 mRNA in PBMCs cultured with No. 2 CpG-ODN was significantly higher than that with No. 20 GpCODN (P = 0.006) and the negative control (P = 0.036)

Out of 11 kinds of CpG-ODNs examined in this study, one CpG-ODN (No. 2) was found to induce both mRNA and protein of IFN-g in PBMCs obtained from healthy dogs. The induction of IFN-g protein by No. 2 CpG-ODN was abolished by the conversion of

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

Fig. 3. Concentrations of IFN-g produced in PBMCs from six dogs stimulated with CpG-ODN (No. 2) and GpC-ODN (No. 20 ) at a concentration of 1 mM. PBMCs incubated without any ODNs were used as a negative control (). These cultures were carried out in the presence of a-cCD3 mAb (1 mg/ml) for 48 h. Error bars indicate the standard error of the mean concentration of IFN-g in culture supernatants. The asterisk indicates a significant difference in the mean concentration of IFN-g in culture supernatants (P < 0.05).

the CpG motif to GpC, suggesting that the induction of IFN-g by this CpG-ODN was specific for the CpG motif. Therefore, No. 2 CpG-ODN was considered to be effective for the induction of IFN-g in the PBMCs used in this study. The same sequence as that in No. 2 CpG-ODN was also effective for inducing IFN-g in human PBMCs (Verthelyi et al., 2001), interferon in mouse spleen cells (Sonehara et al., 1996), and IL-12 mRNA in porcine PBMCs (Kamstrup et al., 2001). It is conceivable that the sequence of CpG-ODN is

447

effective for the induction of TH1 cytokines in various mammalian species. There was a considerable variation of IFN-g production in PBMCs stimulated with CpG-ODNs among the dogs examined in this study. Various responses to CpG-ODNs were also reported in human (Bohle et al., 1999; Leifer et al., 2003) and porcine (Kamstrup et al., 2001) PBMCs. It can be considered that various conditions might influence the effects of CpG-ODNs on IFN-g production. The cell population in PBMCs would be one of the important factors causing individual variability of IFN-g production; the levels of populations of IFN-g-producing cells such as NK cells and T cells in PBMCs would influence the response to CpG-ODN stimulation. If single types of cell populations such as NK cells or T cells were sorted from PBMCs and used to measure the production of IFN-g induced by CpG-ODNs, a reduction of the variability might be achieved. Activation state of the target cells of CpG-ODNs as well as their population in PBMCs could be considered to influence the individual variability. Furthermore, differences in the expression levels of Toll-like receptor 9, a receptor of CpG-ODNs (Hemmi et al., 2000), in these cells should be considered to obtain consistent results. However, the present study provides fundamental information about the sequences of CpG-ODNs that can induce INF-g production in dogs effectively.

Fig. 4. Expression of IL-12 p40 (A), IL-12 p35 (B) and IL-18 (C) mRNAs in PBMCs from eight dogs stimulated with No. 2 CpG-ODN and No. 20 GpC-ODN at a concentration of 1 mM for 12 h. PBMCs incubated without any ODNs were used as a negative control (). The asterisk indicates a significant difference in the mean expression of mRNAs (P < 0.05). Dotted lines indicate the lower limit of detection in these assays.

448

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

IL-12 is one of the TH1 cytokines; it has a heterodimeric structure composed of p35 and p40 subunits and is known to be a strong inducer of IFN-g production (Trinchieri, 1995). The effective CpGODN (No. 2 CpG-ODN) identified in this study significantly enhanced mRNA expression of IL-12 p40 in dog PBMCs. These findings were consistent with a previous report showing that CpG-ODNs enhanced expression of IL-12 p40 mRNA in a mouse macrophage cell line (Cowdery et al., 1999). Expression of IL-12 p40 transcript was shown to be correlated with the secretion of bioactive IL-12, whereas IL-12 p35 mRNA was constitutively expressed in human PBMCs (D’Andrea et al., 1992). Similarly, in this study, the constitutive expression of IL-12 p35 mRNA was found in canine PBMCs cultured without CpG-ODNs. It can be considered that bioactive IL-12 p70 should be secreted as a result of the increased production of IL-12 p40 in response to the stimulation by the CpG-ODN in this study. IL-18 is also known to be a cytokine that induces IFN-g production (Okamura et al., 1995). Constitutive expression of IL-18 mRNA was observed in cultured PBMCs regardless of stimulation with CpG-ODNs in this study. This was not consistent with a previous report showing that the expression of IL-18 mRNA in human PBMCs was enhanced by stimulation with CpG-ODNs (Bohle et al., 1999). This discrepancy might have been due to several factors such as differences of the sequences of the CpG-ODNs used, of the culture period, and of the animal species. It may be necessary to measure the total amount of de novosynthesized IL-18 protein after CpG-ODN stimulation in order to evaluate whether production of bioactive IL-18 can be induced by CpG-ODNs in dogs. In this study, it was found that No. 2 CpG-ODN induced the mRNA expression of TH1 cytokines such as IFN-g and IL-12 but not IL-4 in canine PBMCs, similar to the findings in human PBMCs (Klinman et al., 1996). The immunostimulatory activity of CpGODNs via their induction of TH1 cytokines will be advantageous for immunotherapy for allergic diseases. In vivo administration of CpG-ODNs was reported to inhibit airway inflammation and hyperreactivity via induction of IFN-g production in a mouse model of asthma (Broide et al., 1998; Kline et al., 1998). Antigen-conjugated CpG-ODNs were

shown to induce antigen-specific TH1 immune responses in a more effective manner than nonconjugated ODNs (Shirota et al., 2000) and to improve the bronchial inflammation in a mouse model of asthma (Santeliz et al., 2002). Since a CpG-ODN sequence that can induce the TH1 cytokines in dogs was identified in this study, the in vivo evidence noted above suggests that therapeutic effects of CpG-ODNs could be expected for allergic diseases in dogs. TH1-type immune responses would also be beneficial for inducing immunity against infectious diseases and tumors. It was reported that the administration of CpGODNs had protective effects against intracellular infection with Listeria monocytogenes in mice (Krieg et al., 1998). When CpG-ODNs were administered together with antigens of a tumor (Davila and Celis, 2000) or virus (Davis et al., 1998), it was shown that adaptive immunity against the antigens was induced. Therefore, the information obtained in this study will be useful for attempts to elicit protective or palliative effects on infectious diseases or tumors as an adjuvant immunotherapy in dogs. In conclusion, a specific sequence of CpG-ODN was found to induce TH1 cytokines in canine PBMCs in this study. This CpG-ODN should be useful to elicit TH1-type immune responses as an adjuvant immunotherapy against allergic diseases, viral infection, or tumors in dogs.

Acknowledgments This work was supported by grants from the Ministry of Education, Science, Sports and Culture of Japanese Government and a Grant-in-Aid from the Recombinant Cytokine Project sponsored by the Japanese Ministry of Agriculture, Forestry and Fisheries (RCP 1998-3110-3240).

References Bohle, B., Jahn-Schmid, B., Maurer, D., Kraft, D., Ebner, C., 1999. Oligodeoxynucleotides containing CpG motifs induce IL-12, IL-18 and IFN-gamma production in cells from allergic individuals and inhibit IgE synthesis in vitro. Eur. J. Immunol. 29, 2344–2353. Broide, D., Schwarze, J., Tighe, H., Gifford, T., Nguyen, M.D., Malek, S., Van Uden, J., Martin-Orozco, E., Gelfand, E.W., Raz,

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450 E., 1998. Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway hyperresponsiveness in mice. J. Immunol. 161, 7054–7062. Cowdery, J.S., Boerth, N.J., Norian, L.A., Myung, P.S., Koretzky, G.A., 1999. Differential regulation of the IL-12 p40 promoter and of p40 secretion by CpG DNA and lipopolysaccharide. J. Immunol. 162, 6770–6775. D’Andrea, A., Rengaraju, M., Valiante, N.M., Chehimi, J., Kubin, M., Aste, M., Chan, S.H., Kobayashi, M., Young, D., Nickbarg, E., 1992. Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells. J. Exp. Med. 176, 1387–1398. Davila, E., Celis, E., 2000. Repeated administration of cytosinephosphorothiolated guanine-containing oligonucleotides together with peptide/protein immunization results in enhanced CTL responses with anti-tumor activity. J. Immunol. 165, 539– 547. Davis, H.L., Weeratna, R., Waldschmidt, T.J., Tygrett, L., Schorr, J., Krieg, A.M., Weeranta, R., 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160, 870–876. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S., 2000. A toll-like receptor recognizes bacterial DNA. Nature 408, 740–745. Iho, S., Yamamoto, T., Takahashi, T., Yamamoto, S., 1999. Oligodeoxynucleotides containing palindrome sequences with internal 50 -CpG-30 act directly on human NK and activated T cells to induce IFN-gamma production in vitro. J. Immunol. 163, 3642– 3652. Iwata, A., Iwata, N.M., Saito, T., Hamada, K., Sokawa, Y., Ueda, S., 1996. Cytopathic effect inhibition assay for canine interferon activity. J. Vet. Med. Sci. 58, 23–27. Kamstrup, S., Verthelyi, D., Klinman, D.M., 2001. Response of porcine peripheral blood mononuclear cells to CpG-containing oligodeoxynucleotides. Vet. Microbiol. 78, 353–362. Kline, J.N., Waldschmidt, T.J., Businga, T.R., Lemish, J.E., Weinstock, J.V., Thorne, P.S., Krieg, A.M., 1998. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J. Immunol. 160, 2555–2559. Klinman, D.M., Yi, A.K., Beaucage, S.L., Conover, J., Krieg, A.M., 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci. U.S.A. 93, 2879–2883. Kranzer, K., Bauer, M., Lipford, G.B., Heeg, K., Wagner, H., Lang, R., 2000. CpG-oligodeoxynucleotides enhance T-cell receptortriggered interferon-gamma production and up-regulation of CD69 via induction of antigen-presenting cell-derived interferon type I and interleukin-12. Immunology 99, 170–178. Krieg, A.M., Love-Homan, L., Yi, A.K., Harty, J.T., 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161, 2428– 2434. Krieg, A.M., Yi, A.K., Matson, S., Waldschmidt, T.J., Bishop, G.A., Teasdale, R., Koretzky, G.A., Klinman, D.M., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374, 546–549.

449

Krug, A., Rothenfusser, S., Hornung, V., Jahrsdorfer, B., Blackwell, S., Ballas, Z.K., Endres, S., Krieg, A.M., Hartmann, G., 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur. J. Immunol. 31, 2154–2163. Leifer, C.A., Verthelyi, D., Klinman, D.M., 2003. Heterogeneity in the human response to immunostimulatory CpG oligodeoxynucleotides. J. Immunother. 26, 313–319. Lipford, G.B., Sparwasser, T., Bauer, M., Zimmermann, S., Koch, E.S., Heeg, K., Wagner, H., 1997. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur. J. Immunol. 27, 3420–3426. Maeda, S., Fujiwara, S., Omori, K., Kawano, K., Kurata, K., Masuda, K., Ohno, K., Tsujimoto, H., 2002. Lesional expression of thymus and activation-regulated chemokine in canine atopic dermatitis. Vet. Immunol. Immunopathol. 88, 79–87. Masuda, K., Sakaguchi, M., Saito, S., Deboer, D.J., Fujiwara, S., Kurata, K., Yamashita, K., Hasegawa, A., Ohno, K., Tsujimoto, H., 2000. In vivo and in vitro tests showing sensitization to Japanese cedar (Cryptomeria japonica) pollen allergen in atopic dogs. J. Vet. Med. Sci. 62, 995–1000. Miconnet, I., Koenig, S., Speiser, D., Krieg, A., Guillaume, P., Cerottini, J.C., Romero, P., 2002. CpG are efficient adjuvants for specific CTL induction against tumor antigen-derived peptide. J. Immunol. 168, 1212–1218. Nishikawa, Y., Iwata, A., Katsumata, A., Xuan, X., Nagasawa, H., Igarashi, I., Fujisaki, K., Otsuka, H., Mikami, T., 2001a. Expression of canine interferon-gamma by a recombinant vaccinia virus and its antiviral effect. Virus Res. 75, 113–121. Nishikawa, Y., Iwata, A., Nagasawa, H., Fujisaki, K., Otsuka, H., Mikami, T., 2001b. Comparison of the growth inhibitory effects of canine IFN-alpha, -beta and -gamma on canine cells infected with Neospora caninum tachyzoites. J. Vet. Med. Sci. 63, 445– 448. Okamura, H., Tsutsi, H., Komatsu, T., Yutsudo, M., Hakura, A., Tanimoto, T., Torigoe, K., Okura, T., Nukada, Y., Hattori, K., et al., 1995. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature 378, 88–91. Pontarollo, R.A., Rankin, R., Babiuk, L.A., Godson, D.L., Griebel, P.J., Hecker, R., Krieg, A.M., van Drunen Littel-van den Hurk, S., 2002. Monocytes are required for optimum in vitro stimulation of bovine peripheral blood mononuclear cells by nonmethylated CpG motifs. Vet. Immunol. Immunopathol. 84, 43–59. Rankin, R., Pontarollo, R., Ioannou, X., Krieg, A.M., Hecker, R., Babiuk, L.A., van Drunen Littel-van den Hurk, S., 2001. CpG motif identification for veterinary and laboratory species demonstrates that sequence recognition is highly conserved. Antisense. Nucl. Acid Drug. Dev. 11, 333–340. Santeliz, J.V., Van Nest, G., Traquina, P., Larsen, E., Wills-Karp, M., 2002. Amb a 1-linked CpG oligodeoxynucleotides reverse established airway hyperresponsiveness in a murine model of asthma. J. Allergy Clin. Immunol. 109, 455–462. Shirota, H., Sano, K., Kikuchi, T., Tamura, G., Shirato, K., 2000. Regulation of murine airway eosinophilia and Th2 cells by antigen-conjugated CpG oligodeoxynucleotides as a novel antigen-specific immunomodulator. J. Immunol. 164, 5575–5582.

450

K. Kurata et al. / Veterinary Immunology and Immunopathology 102 (2004) 441–450

Sonehara, K., Saito, H., Kuramoto, E., Yamamoto, S., Yamamoto, T., Tokunaga, T., 1996. Hexamer palindromic oligonucleotides with 50 -CG-30 motif(s) induce production of interferon. J. Interferon Cytokine Res. 16, 799–803. Sun, S., Zhang, X., Tough, D.F., Sprent, J., 1998. Type I interferonmediated stimulation of T cells by CpG DNA. J. Exp. Med. 188, 2335–2342. Sur, S., Wild, J.S., Choudhury, B.K., Sur, N., Alam, R., Klinman, D.M., 1999. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J. Immunol. 162, 6284–6293. Tokunaga, T., Yano, O., Kuramoto, E., Kimura, Y., Yamamoto, T., Kataoka, T., Yamamoto, S., 1992. Synthetic oligonucleotides with particular base sequences from the cDNA encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells. Microbiol. Immunol. 36, 55–66. Trinchieri, G., 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance

and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13, 251–276. Verthelyi, D., Ishii, K.J., Gursel, M., Takeshita, F., Klinman, D.M., 2001. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166, 2372– 2377. Wernette, C.M., Smith, B.F., Barksdale, Z.L., Hecker, R., Baker, H.J., 2002. CpG oligodeoxynucleotides stimulate canine and feline immune cell proliferation. Vet. Immunol. Immunopathol. 84, 223–236. Yamamoto, S., Yamamoto, T., Kataoka, T., Kuramoto, E., Yano, O., Tokunaga, T., 1992a. Unique palindromic sequences in synthetic oligonucleotides are required to induce IFN and augment IFNmediated natural killer activity. J. Immunol. 148, 4072–4076. Yamamoto, S., Yamamoto, T., Shimada, S., Kuramoto, E., Yano, O., Kataoka, T., Tokunaga, T., 1992b. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36, 983–997.