Identification of environmental strains of Bacillus mycoides by fatty acid analysis and species-specific 16S rDNA oligonucleotide probe

FEMS Microbiology Ecology 24 (1997) 201^209

Identi¢cation of environmental strains of Bacillus mycoides by fatty acid analysis and species-speci¢c 16S rDNA oligonucleotide probe Friedrich von Wintzingerode, Frederick A. Rainey, Reiner M. Kroppenstedt, Erko Stackebrandt * DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Mascheroder Weg 1b, 38124 Braunschweig, Germany

Received 20 February 1997 ; revised 16 June 1997; accepted 7 July 1997

Abstract

Of 131 Gram-positive, aerobic spore-formers, isolated from a peat bog in North Germany, 34 strains were identified as by fatty acid analysis. The identification of many strains as members of B. mycoides was surprising as these strains were non-motile and lacked the typical rhizoid colony morphology. The chemotaxonomic identification was supported by 16S rDNA analysis of a few strains and hybridization with a 16S rDNA oligonucleotide probe derived from sequence information of the type strain of B. mycoides. In addition, the identity of two isolates as strains of B. mycoides was confirmed by DNA-DNA hybridization. While fatty acid analysis and DNA-DNA hybridization confirmed the previously recognized close relatedness between the type strains of B. mycoides, B. cereus, B. thuringiensis and B. anthracis, the 16S rDNA probe was able to clearly discriminate B. mycoides strains from the type strains of the other three species. Bacillus mycoides

Keywords : Bacillus mycoides

;

Bacillus cereus

;

Bacillus thuringiensis

1. Introduction

The relatedness between the species

Bacillus an-

and Bacilconstitutes an interesting taxonomic problem [1]. These organisms, which are members of Bacillus group 1 [2], share very high rDNA sequence similarity as measured by 16S rDNA analysis ( 99.4%) [2], restriction fragment length polymorphism of rRNA genes [3] and analysis of the inter-

thracis, Bacillus cereus, Bacillus mycoides lus thuringiensis

s

* Corresponding author. Tel.: +49 (531) 2616 352; fax: +49 (531) 2616 418; e-mail: [email protected]

; DNA probe; 16S rDNA; Fatty acid analysis

genic spacers [4]. Results of DNA-DNA reassociation studies did not clearly indicate whether the af¢liation of the type strains of certain species into separate species is justi¢ed [5^7], as most values ranged around the 70% similarity value which is considered the threshold value for the delineation of a genospecies [8]. The number of phenotypic di¡erences is small, some of them are plasmid-coded (i.e., toxins of B. anthracis [9]), restricted to the presence of a unique toxin (i.e., the crystal protein toxin in B. thuringiensis [10,11]), or to some morphological differences (e.g., lack of motility and distinctive rhizoid colonies on agar in B. mycoides [11]). The importance of these organisms as pathogens,

0168-6496 / 97 / $17.00 ß 1997 Federation of European Microbiological Societies. Published by Elsevier Science B.V. PII S 0 1 6 8 - 6 4 9 6 ( 9 7 ) 0 0 0 5 7 - 3

FEMSEC 842 6-11-97

202

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

food additives and biological control agents, the ease with which B. cereus and B. mycoides can be isolated from natural habitats as well as the ¢nding that B. thuringiensis strains can produce B. cereus-speci¢c enterotoxin [12,13] and reports on highly pathogenic B. cereus strains [14] make their reliable identi¢cation essential. Phenotypic tests, including colony morphology, hemolysis, motility, susceptibility to penicillin and parasporal crystal inclusion, are the most widely used clinical method in the identi¢cation of the four species [10]. Modern approaches, such as pulsed-¢eld electrophoresis and multilocus enzyme electrophoresis, have failed to detect signi¢cant differences between strains of these species [15,16], while genomic di¡erences between B. anthracis, B. cereus and B. mycoides could be unravelled by arbitrarily primed polymerase chain reaction (PCR) of genomic DNA [17]. Recently, strains B. cereus and B. thuringiensis have been discriminated from each other by the use of speci¢c DNA probes based on variable regions of 16S rRNA [18]. This communication reports on the development and applicability of the same technology to discriminate environmental and culture collection strains of B. mycoides from the type strains of the other three highly related species. 2. Materials and methods

2.1. Bacterial strains

Two hundred strains were isolated in December 1993 from a peat bog `Grosses Moor' near Gifhorn, Lower Saxony, at depths of 20 and 40 cm. Bog samples were collected by horizontal drilling and the cores were kept on ice until aliquots of the sample were spread on agar plates. The following media were used for enrichment. Strains designated G were enriched on GYM medium consisting of glucose 4 g l31 , yeast extract 4 g l31 , malt extract 10 g l31 , calcium carbonate 2 g l31 , solidi¢ed with agar 12 g l31 , pH 7.2. Strains designated F were enriched on TSB medium, consisting of tryptic soy broth 30 g l31 and agar 15 g l31 , pH 8.0. Strains designated M were enriched on Middlebrook medium (Difco 0627-01-2). All media contained 0.5 g l31 cycloheximide to prevent growth of eukaryotic cells. Cultivation was for

1^3 days at 28³C. Four strains were deposited in the German Culture Collection of Microorganisms and Cell Cultures (DSMZ), strain F8/1-2 as DSM 11173, F8/3-3 as DSM 11174, strain F8/1-7 as DSM 11175 and strain M/2-6 as DSM 11176. 2.2. Fatty acid analysis

Fatty acid methylesters were obtained from wet biomass (approx. 40 mg) by saponi¢cation, methylation and extraction as described elsewhere [19,20]. The fatty acid methylester mixtures were separated using a model 5898A microbial identi¢cation system (Microbial ID, Newark, DE, USA) which consisted of a Hewlett-Packard model 3392 gas chromatograph ¢tted with a 5% phenyl-methyl silicone capillary column (0.2 mmU25 m), a £ame ionization detector, a Hewlett-Packard model 3392 integrator, Hewlett-Packard model 7673A automatic sampler and a Hewlett-Packard model 900/300 computer (Hewlett-Packard, Palo Alto, CA, USA). Peaks were automatically integrated and fatty acid names and percentages calculated by the Microbial ID. The gas chromatographic parameters followed described procedures [21]. 2.3. Isolation of DNA and ampli¢cation of 16S rDNA

Genomic DNA was isolated from all organisms by suspending 1 or 2 loops of cells scraped from solid growth media in 400 Wl saline-EDTA (0.15 M NaCl, 0.01 M EDTA disodium salt, pH 8), and adding 5 Wl 1% lysozyme (Boehringer-Mannheim, Mannheim, Germany). Following homogenization by vortexing and incubating at 37³C for 15 min, 5 Wl 1.5% proteinase K (Boehringer-Mannheim) and 10 Wl 25% sodium dodecyl sulfate (SDS) were added and incubated at 50³C for 30 min. Puri¢cation of DNA was performed by extraction with 400 Wl of phenol and chloroform respectively, in sequence and using the Prep-A-Gene, puri¢cation kit (Bio-Rad, Hercules, CA, USA), according to the manufacturer's instructions, performing one elution step in 50 Wl of water. Ampli¢cation of 16S rDNA was done as described by Rainey et al. [22] using Taq polymerase (Boehringer-Mannheim) and the following primers: 10-30 forward 5P-AGAGTTTGATC(A,C)TGGCTCAG-3P (positions 8^27, E. coli numbering) and 1500 reverse

FEMSEC 842 6-11-97

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

5P-AAGGAGGTGATCCA(A,C,T)CC(A,G)CA-3P (positions 1541^1518). Ampli¢cation was carried out in a DNA Thermal cycler (Perkin Elmer Cetus, Norwalk, CT, USA) for 28 cycles with following segments: 52³C for 1 min, 72³C for 2 min and 93³C for 1 min. A ¢nal extension of 72³C for 5 min was performed. Ampli¢cation products were puri¢ed by extraction with chloroform and using the Prep-AGene puri¢cation kit (Bio-Rad), according to the manufacturer's instructions, with elution in 50 Wl of distilled water. 2.4. Sequence analysis and data analysis

Sequence analysis was carried out with the Taq DyeDeoxy1 Terminator Cycle Sequencing Kit (Applied Biosystems, Weiterstadt, Germany) using a DNA Thermal cycler (Perkin Elmer Cetus) for 25 cycles with following segments: 96³C for 30 s, 50³C for 15 s and 60³C for 4 min. Sequencing reactions were puri¢ed with 100 Wl of a phenol:water:chloroform mixture (68:18:14). Nucleic acids were precipitated with 12 Wl 3 M sodium acetate, 300 Wl absolute ethanol on ice and pellets were washed with 500 Wl 70% ethanol. Polyacrylamide electrophoresis of DNA, using an Applied Biosystems 373A electrophoresis system, was performed according to the manufacturer's instructions. Sequences were aligned against the 16S rRNA database of the DSMZ, containing the data of the Ribosomal Database Project (RDP) [23]. 2.5. Oligonucleotide probes

The accessibility of nucleic acids on the membrane was tested by hybridization with a universal probe (5P-CTACCAGGGTATCTAAT-3P, Tm 48³C, E. coli 16S rRNA positions 787^803). A B. mycoides-specific probe was designed on the basis of the almost complete 16S rDNA sequence of the type strain of this species (5P-CTATGCAGTTCAAAATATTA-3P, Tm 50³C, E. coli 16S rRNA positions 180^192 (the stem region positions 184^186/191^193 of B. mycoides are 7 bp longer than those of E. coli, see Table 2)). Probes were labeled using DIG-ddUTP and the DIG Oligonucleotide 3P End Labeling Kit (Boehringer-Mannheim), according to the manufacturer's instructions.

203

2.6. Dot blot hybridization

Puri¢ed ampli¢cation products were incubated for 3 min at 100³C. Denatured nucleic acids were loaded onto a nylon round ¢lter (Amersham) and ¢xed by UV light (2 min at 254 nm, both sides of the ¢lter). Hybridizations were carried out in tubes (Hybaid) and a Hybaid hybridization oven. Prehybridization was for 30 min in 5USSC (1USSC is 0.15 M NaCl, 0.0015 M trisodium citrate, pH 7.2) containing 2% blocking reagens (Boehringer, Mannheim), 0.02% SDS and 0.1% N-lauryl-sarcosine at 37³C. The solution was replaced by 10 ml hybridization solution and ¢lter was for 3 h at 37³C. Filter was washed twice in 6USSC and 0.1% SDS for 15 min each. Probes were removed as recommended for dot blot hybridization in the DIG Systems User's Guide for Filter Hybridization 2003 (Boehringer, Mannheim). Detection of DIG-labeled probes was done according to the instruction of the DIG-Luminescent Detection Kit (Boehringer, Mannheim). 2.7. DNA-DNA hybridization

DNA similarity studies were performed using the thermal renaturation method as described by DeLey et al. [24] and HuM et al. [25]. 3. Results and discussion

Analysis of 131 Gram-positive, aerobic spore-formers, isolated from a peat bog in North Germany, by fatty acid analysis with the MIDI system a¤liated isolates to the reference organisms B. mycoides (Table 1). These reference organisms are represented by an average of about 20 entries of fatty acid patterns in the database. Most similarity index values found for the environmental strains were higher than 0.45 which indicates statistical signi¢cance of the taxon a¤liation. In contrast to the phenotypic description of B. mycoides [11] these isolates were found to be motile and exhibited a non-rhizoid colony morphology. A dendrogram of fatty acid relatedness (Fig. 1), based on Euclidian distances, shows that of the six strains of rhizoidal B. mycoides deposited in DSMZ, only two strains, DSM 299 and DSM 309, clustered with the type strain of the species, DSM 2048. One

FEMSEC 842 6-11-97

204

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

Table 1 Strains investigated, similarity index of fatty acid analysis, taxon a¤liation and position of 16S rDNA on dot blot ¢lter Strain

Fatty acid database

Taxon assignment

Position on dot blot

similarity index

by fatty acid analysis

(Fig. 2)

M/1-1

0.43

1c

F6/1-3

0.48

F6/2-2

0.42

F6/3-2

0.38

F8/1-4

0.46

F8/1-5

0.50

F8/2-1

0.45

F8/3-2b

0.38

F8/3-3, DSM 11174

0.50

F8/3-11

0.39

G/1-2

0.43

G/1-3

0.58

G/1-4

0.50

G/1-6

0.40

G/1-7

0.49

G/1-8

0.34

G/2-2

0.54

G/2-3

0.35

G/2-4

0.49

G/3-1

0.32

M/3-4

0.50

F8/2-5

0.45

F8/3-1

0.20

F8/2-2

0.35

F8/1-1

0.44

F6/2-1

0.59

F8/3-10

0.69

Fs/1-2

0.66

F8/3-8

0.67

F6/3-1

0.62

F8/3-5

0.54

Escherichia coli DSM 498 Bacillus cereus DSM 31T Bacillus mycoides DSM 303* Bacillus mycoides DSM 299* Bacillus mycoides DSM 2048T

0.87

Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus pabuli Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus pabuli Bacillus mycoides Bacillus mycoides Escherichia coli Bacillus cereus Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus mycoides Bacillus subtilis Bacillus thuringiensis Pseudomonas aeruginosa Micrococcus luteus Aureobacterium £avescens Bacillus mycoides Bacillus mycoides Bacillus mycoides

0.84 0.55 0.57 0.76

F8/1-2*, DSM 11173

0.80

F8/1-3*

0.73

F8/1-7*, DSM 11175

0.44

F8/1-9*

0.68

M/2-6*, DSM 11176

0.58

Bacillus subtilis DSM 10T Bacillus thuringiensis DSM 2046T Pseudomonas aeruginosa DSM 1117 Micrococcus luteus DSM 2786 Aureobacterium £avescens DSM 20643 Bacillus mycoides DSM 307* Bacillus mycoides DSM 309* Bacillus mycoides DSM 384*

0.87 0.68 0.66 0.78 0.84 0.45 0.72 0.43

*Strains of which almost complete 16S rDNA sequences were determined.

FEMSEC 842 6-11-97

1d 1e 1f 2b 2c 2d 2e 2f 2g 3a 3b 3c 3d 3e 3f 3g 3h 4a 4b 4c 4d 4e 4f 4g 4h 5a 5b 5c 5d 5e 5f 5g 6b 6c 6d 6e 6f 6g 6h 7b 7c 7d 7e 7f 7g 8d 8e 8f

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

205

Fig. 1. Dendrogram of fatty acid similarities between the peat bog isolates and reference organisms from the German Culture Collection of Microorganisms and Cell Cultures (DSMZ). The dendrogram is based on Euclidian distance values which are generated from the fatty acid similarity index values by the MIDI identi¢cation system. Non-rhizoidal B. mycoides strains are indicated by an asterisk.

strain (DSM 384) showed a moderate fatty acid similarity to the type strains of B. cereus and B. thuringiensis, while the patterns of strains DSM 384 and DSM 307 were more di¡erent. All isolates identi¢ed as B. mycoides clustered together and branched close to the type strain of the species. The clustering of some strains, selected to represent the whole width and depth of the cluster, is shown in Fig. 1.

Analysis of 16S rDNA sequences was performed on ¢ve of the 34 isolates (marked with an asterisk in Table 1) which were tentatively identi¢ed as members of B. mycoides by fatty acid analysis and on the ¢ve culture collection strains assigned to B. mycoides (DSM 299, DSM 303, DSM 307, DSM 309, DSM 384). The almost complete sequences (95% of the E. coli sequence) were aligned to the database of ho-

FEMSEC 842 6-11-97

206

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

Table 2 Position 175^193 of the 16S rDNA sequence (E. coli numbering) of some peat isolates, DSM strains 2048T , 299, 303, 307, 309 and 384, and some related strains Organism Target sequence CCGGATAATATTTTGAACTGCATAGTTCGAA Bacillus mycoides DSM 2048T F8/1-2, DSM 11173 CCGGATAATATTTTGAACTGCATAGTTCGAA F8/1-7, DSM 11175 CCGGATAATATTTTGAACTGCATAGTTCGAA M/2-6, DSM 11176 CCGGATAATATTTTGAACTGCATAGTTCGAA F8/1-9 CCGGATAATATTTTGAACTGCATAGTTCGAA F8/1-3 CCGGATAATATTTTGAACTGCATAGTTCGAA Bacillus mycoides strains DSM 299, DSM 309 and DSM 384 CCGGATAATATTTTGAACTGCATAGTTCGAA Bacillus mycoides DSM 307 CCGGATAACATTTTGCACCGCATGGTTCGAA Bacillus thuringiensis DSM 2046T CCGGATAACATTTTGAACTGCATGGTTCGAA Bacillus cereus DSM 31T CCGGATAACATTTTGAACCGCATGGTTCGAA Bacillus anthracis strain Sterne CCGGATAACATTTTGAACCGCATGGTTCGAA Escherichia coli CCGCATAAC999GUCGCAAGAC9 The sequence of E. coli has been included as a reference. The target region of the oligonucleotide probe is underlined. Nucleotides that di¡er in composition from that found in the target sequence of the type strain of B. mycoides are in bold.

mologous sequences available for Bacillus strains [22]. Sequence similarity values for the ¢ve isolates and strains DSM 299, DSM 309 and DSM 384 ranged between 99.3 and 100% similarity to the sequence of B. mycoides DSM 2048T . The values were slightly lower when strains DSM 303 and DSM 307 were compared to the isolates and the type strain of the species (98.8^99.4%) and this range of similarity

values was also found to separate the type strains of B. anthracis, B. cereus, B. mycoides and B. thuringiensis. Comparison of the 16S rDNA sequence of the type strains of these four species and the ¢ve peat bog isolates indicated that the highest degree of variation of the B. mycoides sequence is located between positions 180 and 192 (E. coli numbering) (Table 2).

Fig. 2. Autoluminogram of PCR dot blots, (a) after hybridization with a bacteria-speci¢c 16S rDNA oligonucleotide probe and (b) after hybridization with the B. mycoides-speci¢c oligonucleotide probe. The coordinates for the dot blots are indicated in Table 1.

FEMSEC 842 6-11-97

207

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

Table 3 DNA-DNA similarity values (in %) as determined by the thermal reassociation method B. mycoides DSM 303 F8/1-7 B. mycoides DSM 2048T F8/1-7 100 71 n.d. M/2-6 67 74 n.d. B. mycoides DSM 2048T 71 100 64 B. mycoides DSM 303 n.d. 64 100 B. mycoides DSM 384 n.d. 60 n.d. B. mycoides DSM 307 n.d. 44 50 B. thuringiensis DSM 2046T 46 57 60 n.d., not determined.

Within this stretch, the sequence of the type strain of B. mycoides is identical to the sequence of the ¢ve isolates analyzed and of strains DSM 299, DSM 309 and DSM 384. In contrast, the sequences of DSM 303 and DSM 307 di¡er in 1 and 4 nucleotides, respectively, as compared to the homologous stretch of the type strain. B. mycoides DSM 2048T di¡ers in 3 nucleotides from the sequences of the type strains of B. anthracis, B. cereus and B. thuringiensis (Table 2). The region selected as probe target is di¡erent from that used by te Gi¡el et al. [18] for the di¡erentiation of strains of B. cereus and B. thuringiensis (positions 76^93, E. coli numbering), which discriminates B. thuringiensis from B. anthracis, B. cereus and B. mycoides. On the basis of the nucleotide sequence of the variable stretch, an oligonucleotide probe with a length of 20 nucleotides was designed to speci¢cally target the complementary region of the type strain of B. mycoides. Probe speci¢city was tested against the RDP database [23] and additional 16S rDNA sequences deposited in the DSMZ database. No complete match to any unrelated sequence has been detected. The probe was tested against a dot blot of 16S rDNA PCR products of all 34 isolates a¤liated to B. mycoides by fatty acid analysis, to the DSM strains of B. mycoides and to strains of other closely related Bacillus species, as well as to some non-Bacillus reference strains. In order to determine whether each blot position contained su¤cient amount of PCR products, a conservative eubacterial probe was used as a positive control (Fig. 2a). Using the B. mycoides-speci¢c 16S rDNA probe in the hybridization assay, positive hybridization signals were obtained with 33 of the 34 isolates and with B. mycoides strains DSM 299 (position 6c), DSM 309

B. cereus

50 60 57 60 56 n.d. 73

DSM 31T

(position 8e) and DSM 384 (position 8f). Weaker signals were obtained with rDNA of isolate G/2-3 (position 3h), G/1-2 (3a), G/2-4 (4a), F6/2-1 (4h) and F8/1-9 (6h). As judged by the presence of a B. mycoides-speci¢c 16S rDNA sequence the latter strain is de¢nitely a member of this species. No signals were detectable with rDNA of the other Bacillus species tested, including B. mycoides strains DSM 303 (position 6b) and DSM 307 (position 8d), as well as with rDNA of the non-Bacillus strains (all Fig. 2b). To determine the speci¢city of the probe in distinguishing B. mycoides strains from other closely related species, DNA-DNA hybridization experiments were carried out using the thermal reassociation method. Two of the isolates that gave a positive signal with the oligonucleotide probe, i.e., isolate F8/1-7 and M/2-6, shared 67.0% DNA-DNA similarity and they had 71.0 and 74% DNA-DNA similarity, respectively, to the type strain of B. mycoides (Table 3). B. mycoides strains DSM 303 and DSM 384 showed less than 64% similarity to the type strains of B. mycoides, B. cereus and B. thuringiensis. Interestingly, as judged from the 16S rDNA sequence, the signature stretch of region 180^192 and the positive probe reaction, strain DSM 384 appears to be a authentic strain of B. mycoides. This conclusion is in contrast to the analysis of its fatty acids which places this strain outside the radiation of the B. mycoides/B. anthracis/B. cereus/B. thuringiensis cluster. The DNA similarity value for strain DSM 384 and the type strain of B. mycoides is 60% which may indicate that despite identity in the primary structure of the 16S rDNA, other parts of the genome have already changed in a way that may be indicative of the evolution of a new species. The

FEMSEC 842 6-11-97

208

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209

values found for the three type strains are very similar to those published in the literature [5^7], except for the study by Nakamura and Jackson [7], who found DNA similarity values between 20 and 40% for strains of the pairs B. mycoides/B. cereus and B. mycoides/B. thuringiensis. 4. Conclusion

This study demonstrates the applicability of a strategy that leads to the unambiguous taxonomic assignment of environmental isolates to the species B. mycoides, irrespective of phenotypic di¡erences previously considered of taxonomic importance, e.g., motility of cells and colony properties. The strategy included the use of several methods. Prescreening of isolates by rapid fatty acid analysis allowed a large number of the strains to be tentatively identi¢ed as strains of B. mycoides. Sequence analysis of 16S rDNA from a selection of these strains con¢rmed this taxonomic identi¢cation, and allowed the de¢nition of an oligonucleotide probe speci¢c for the authentic B. mycoides strains, including the type strain. The speci¢city of the probe, demonstrated by dot blot hybridization, could potentially allow rapid identi¢cation of B. mycoides strains in a large set of isolates. There was generally good agreement between the results of fatty acid and 16S rDNA-based analysis, with only one strain (DSM 384) failing to give a positive match with B. mycoides by fatty acid analysis, but being identi¢ed as B. mycoides by 16S rDNA sequence analysis. The ¢nding of rather low (60^70%) DNA-DNA similarity values between certain strains of B. mycoides, and the slightly separate position in the dendrogram produced by fatty acid analysis, con¢rm previous ¢ndings from genome analysis [7,26] that this species exhibits more genomic and phenotypic diversity than previously recognized. The strategy described above will provide speci¢c tools for exploring this diversity. Acknowledgments

We thank Jutta Burghardt for her valuable contri-

bution to the generation of DNA-DNA similarity values. References

[1] Priest, F.G. (1993) Systematics and ecology of Bacillus. In: Bacillus subtilis and Other Gram-positive Bacteria (Sonenshein, A.L., Hoch, J.A. and Losick, R., Eds.), pp. 3^16. American Society for Microbiology, Washington, DC. [2] Ash, C., Farrow, J.A., Wallbanks, S. and Collins, M.D. (1991) Phylogenetic heterogeneity of the genus Bacillus revealed by comparative analysis of small-subunit ribosomal RNA sequences. Lett. Appl. Microbiol. 13, 202^206. [3] Priest, F.G., Kaji, D.A., Rosato, Y.B. and Canhos, V.P. (1994) Characterization of Bacillus thuringiensis and related bacteria by ribosomal RNA gene restriction fragment length polymorphisms. Microbiology 140, 1015^1022. [4] Bourque, S.N., Valero, J.R., Lavoie, M.C. and Levesque, R.C. (1995) Comparative analysis of the 16S to 23S ribosomal intergenic spacer sequences of Bacillus thuringiensis strains and subspecies and of closely related species. Appl. Environ. Microbiol. 61, 1623^1626. [5] Keneko, T., Nozaki, R. and Aizawa, K. (1978) Deoxyribonucleic acid relatedness between Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis. Microbiol. Immunol. 22, 639^ 641. [6] Seki, T., Chung, C.-W., Mikami, H. and Oshima, Y. (1978) Deoxyribonucleic acid homology and taxonomy of the genus Bacillus. Int. J. Syst. Bacteriol. 28, 182^189. [7] Nakamura, L.K. and Jackson, M.A. (1995) Clari¢cation of the taxonomy of Bacillus mycoides. Int. J. Syst. Bacteriol. 45, 46^49. [8] Wayne, L.G., Brenner, D.J., Colwell, R.R., Grimont, P.A.D., Kandler, O., Krichevsky, M.I., Moore, L.H., Moore, W.E.C., Murray, R.G.E., Stackebrandt, E., Starr, M.P. and Truëper, H.G. (1987) Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Bacteriol. 37, 463^464. [9] Robertson, D.L., Bragg, T.S., Simpson, S., Kaspar, R., Xie, W. and Tippets, M.T. (1990) Mapping and characterization of the Bacillus anthracis plasmids pXO1 and pXO2. In: Proceedings of the International Workshop on Anthrax (Turnbull, P.C.B., Ed.), pp. 55^58. Salisbury Medical Bulletin No. 68, Special Supplement. Salisbury Medical Society, Salisbury. [10] Granum, P.E. (1997) Bacillus cereus. In: Food Microbiology, Fundamentals and Frontiers (Doyle, M.P., Beuchat, L.R. and Montville, T.J. Eds.), pp. 327^336. ASM Press, Washington, DC. [11] Claus, D. and Berkeley, R.C.W. (1996) Genus Bacillus. In: Bergey's Manual of Systematic Bacteriology (Sneath, P.H.A., Mair, N.A., Sharpe, M.E. and Holt, J.G., Eds.), pp. 1105^1139. Williams and Wilkins, Baltimore, MD. [12] Abdel-Hameed, A. and Landen, R. (1994) Studies on Bacillus thuringiensis strains isolated from Swedish soils: insect toxicity

FEMSEC 842 6-11-97

F. von Wintzingerode et al. / FEMS Microbiology Ecology 24 (1997) 201^209 Bacillus cereus-diarrhoeal-type

209

enterotoxin.

rial fatty acid methyl esters including hydroxy acids. J. Clin.

[13] Jackson, S.G., Goodbrand, R.B., Ahmed, R. and Kasatiya, S.

[21] Stackebrandt, E., Kroppenstedt, R.M., Jahnke, K.D., Kem-

and production of

Microbiol. 16, 584^586.

World J. Microbiol. Biotechnol. 10, 406^409.

and related species.

merling, C. and Gu ë rtler, H. (1994) Transfer of Streptosporangium viridogriseum (Okuda et al. 1966), Streptosporangium viridogriseum subsp. kofuense (Nonomura and Ohara 1969) and Streptosporangium albidum (Furumai et al. 1968) to Kutzneria gen. nov. as Kutzneria viridogrisea comb. nov., Kutzneria kofuensis comb. nov., and Kutzneria albida comb. nov., and emendation of the genus Streptosporangium. Int. J. Syst. Bac-

[16] Carlson, C.R., Caugant, D.A. and KolstÖ, A.-B. (1994) Gen-

[22] Rainey, F.A., Dorsch, M., Morgan, H.W. and Stackebrandt,

(1995)

Bacillus cereus

and

Bacillus thuringiensis

isolated in a

gastroenteritis outbreak investigation. Lett. Appl. Microbiol. 21, 103^105. [14] Miller, J.M., Hair, J.G., Hebert, M., Hebert, L. and Roberts Jr., F.J. (1997) Fulminating bacteremia and pneumonia due to

Bacillus cereus.

J. Clin. Microbiol. 35, 504^507.

[15] Drobniewski, F.A. (1993)

Bacillus cereus

teriol. 44, 265^269.

Clin. Microbiol. Rev. 6, 324^338.

otypic diversity among

sis

Bacillus cereus

and

Bacillus thuringien-

[17] Andersen,

G.L.,

Simchock,

J.M.

and

Wilson,

K.H.

(1996)

the order

Spirochaetales.

Syst. Appl. Microbiol. 15, 197^202.

strains and related species. J. Bacteriol. 178, 377^

Olsen, G.J., Fogel, K., Blandy, J. and Woese, C.R. (1994) The Ribosomal Database Project. Nucleic Acids Res. 22, 3485^

[18] te Gi¡el, M.C., Beumer, R.R., Klijn, N., Wagendorp, A. and Rombouts, F.M. (1997) Discrimination between and

Bacillus thuringiensis

using

speci¢c

Bacillus ce-

DNA

probes

based on variable regions of 16S rRNA. FEMS Microbiol.

[19] Kuykendall, L.D., Roy, M.A., O'Neill, J.J. and Devine, T.E. (1988) Fatty acids, antibiotic resistance, and deoxyribonucleic homology

3487. [24] De Ley, J., Cattoir, H. and Reynaerts, A. (1970) The quantitative measurement of DNA hybridisation from renaturation rates. Eur. J. Biochem. 12, 133^142. [25] Huss, V.A.R., Festl, H. and Schleifer, K.-H. (1983) Studies on

Lett. 146, 47^51.

acid

its

[23] Maidak, B.L., Larsen, N., McCaughey, M.J., Overbeek, R.,

384.

reus

Spirochaeta thermophila :

Bacillus

Identi¢cation of a region of genetic variability among

anthracis

E. (1992) 16S rDNA analysis of

phylogenetic position and implications for the systematics of

strains. Appl. Environ. Microbiol. 60, 1719^1725.

groups

of

Bradyrhizobium japonicum.

Int.

the spectrophotometric determination of DNA hybridization from renaturation rates. Syst. Appl. Microbiol. 4, 184^192. [26] Bell, J.A. and Friedman, S.B. (1994) Genetic structure and diversity within local populations of

J. Syst. Bacteriol. 38, 358^361. [20] Miller, L.T. (1982) A single derivatization method for bacte-

tion 48, 1698^1714.

FEMSEC 842 6-11-97

Bacillus mycoides.

Evolu-