- Email: [email protected]
Identification of Epitopes of Trichosanthin by Phage Peptide Library
Biochemical and Biophysical Research Communications 282, 921–927 (2001) doi:10.1006/bbrc.2001.4643, available online at http://www.idealibrary.com on
Identification of Epitopes of Trichosanthin by Phage Peptide Library Zhongyu Zhu, Yeh Ming, and Bing Sun 1 Laboratory of Molecular Immunology, Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, People’s Republic of China
Received March 5, 2001
The phage displayed random peptide library has recently emerged as a powerful technique for analyzing Ab–Ag interactions. In this study, the method was employed to identify epitopes of trichosanthin. Two monoclonal Abs (4B5, 2E9) which recognized different epitopes of trichosanthin (TCS) were selected and a phage-peptide library with nine amino acids (9 aa) was used to screen the positive phage clones that have high affinity to the mAbs. Two groups of phage clones that carried peptide-specific binding to mAbs were identified by the screen. The identified phage clones carried peptide–specific binding to 4B5 and 2E9 mAbs were immunized in mice. To evaluate mimotope of selected phages, the specific binding activity to TCS was measured in the serum from phage-immunized mice. They all showed positive results. The conserved interaction motifs were deduced from the peptide sequences of each group of selected phage clones. When compared the motif sequence with the sequence of TCS, it was predicted that 4B5-corresponding epitope was located at 27–37 aa of TCS protein and 2E9corresponding epitope was located at 41– 48 aa of TCS. The predicted sequence of 4B5-corresponding epitope was further confirmed by site-directed mutation of TCS protein. The data showed that the expressed TCS protein mutated in 4B5corresponding epitope was unable to bind 4B5 mAb. The results suggested that the phage display peptide library is useful to identify Ag epitopes and to raise Ab in disease diagnosis and treatment. © 2001 Academic Press
Key Words: trichosanthin; antigen epitope; phage display peptide library; site-directed mutation.
Abbreviations used: TCS, trichosanthin; mAb, monoclonal antibody; 9 aa, nine amino acids; IPTG, isopropyl thiogalactoside. 1 To whom correspondence should be addressed at Laboratory of Molecular Immunology, Shanghai Institute of Biochemistry and Cell Biology, 320 Yueyang Road, Shanghai 200031, People’s Republic of China. Fax: 86-21-64331090. E-mail: bingsun@sunm. shcnc.ac.cn.
Trichosanthin, an active protein component isolated from Trichosanthes kirilowii, has been used as a traditional Chinese medicine for inducing abortion for a long time and has a variety of medical functions in clinical practice (1). In recent years it has been demonstrated that trichosanthin is an anti-human immunodeficiency virus agent (2, 3). However, allergic reactions of patients were obviously observed when TCS was used in clinic and therefore limits its therapeutic use due to the allergenicity. Our previous work has demonstrated that TCS is a strong allergen in TCS immunized animal model. In the model TCS can induce TCS-specific IgE in serum without any adjuvant (4). To understand the structure of Ag epitopes of TCS, we have raised 16 monoclonal antibodies and the antibodies can be classified as four groups according to antibody competitive binding assay which imply they recognize different epitopes on TCS (5). The detailed information of epitope sequences of TCS were not clear. Although the sequences of two epitopes of TCS have been predicted by using molecular modeling analysis (6), their functional analysis was difficult. In this study, we are interested in that whether phage peptide library is useful to identify Ag epitopes and whether the epitopes are able to be located on the surface of TCS three-dimensional crystal structure since the technique is easy to manipulate in the experiment and the immunized serum from phage clones is able to evaluate the antigenicity of predicted epitope sequence. The results will allow us to understand antigenicity of TCS whole protein and especially TCS-specific IgE epitopes. In the study, that TCS is selected has another preferential consideration, since the gene of TCS has been cloned and the crystal structure of TCS has also been elucidated (7). This available information is required to do functional analysis and to determine a precise location of epitopes on the surface of TCS protein. Two monoclonal antibodies (4B5 and 2E9) from two different groups were chosen due to their higher affinity to TCS protein.
921
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
mAbs to protein Ags have been widely used in structural and functional analysis. Analysis of Ab–Ag complexes by X-ray crystallography (8, 9), chemical modification (10), or deuterium exchange analysis by nuclear magnetic resonance (11) have provided a detailed picture of the amino acids that comprise a given epitope. Few Ab–Ag complexes have been described in such detail because these methods require substantial effort and are technically difficult. Recent alternative techniques for epitope identification have been established, such as large libraries of random peptides displayed on the surface of filamentous bacteriophage (12, 13) and chemically synthesized (14, 15). However, most studies demonstrated only the sequence of epitopes in given Ag, but rare study provided structure information of Ag due to the lack of a three-dimensional structure of Ag protein. In this report, we described the screening of the epitopes of TCS protein by using a phage display peptide library. The mAb was served as probe to screen positive phage clones. The clones carrying peptide– specific binding to mAb were injected into normal mice and the immunized serum were used to evaluate antigenicity of the sequence of epitopes in selected phage clones. The motif is generated as analyzing conserved amino acid sequence in individual positive clones of each group. The sequence of epitopes and its location on the surface of TCS are predicted compared the sequences between motifs and TCS protein. Finally, to confirm the predicted sequences of epitopes, mutagenesis was performed in the corresponding site of epitope in TCS protein and the epitope-specific binding is determined by ELISA between mAb and expressed mutated TCS protein. The data suggested that phage display peptide library succeeded in identifying the epitopes of TCS, indicating its potential finding of epitopes of Ag in raising Ab for disease diagnosis and treatment. MATERIALS AND METHODS mAb and reagents. Two TCS-specific monoclonal antibodies (4B5 and 2E9) were made by our lab (5). They were purified through affinity chromatography using TCS-Sepharose 4B conjugates column (constructed according to the instructions of Pharmacia Co., U.S.A.) from the ascites. Crystallized TCS in Trichosanthin Injection Solution, produced by Jin-San Pharmaceutical Factory, 1.2 mg/ml, was used as Ag. Random phage peptide library (16) expressing linear (pVIII 9aa) nine peptides fused to pVIII of filamentous bacteriophage fd, vector Pc89, wild type phage f1 and bacterial strain DH5aF⬘ were all kindly provided by Dr. Paolo Monaci of IRBM (Istituto di Ricerche di Biologia Molecolare P. Angeletti SPA, Rome, Italy). Affinity selection. Two rounds of affinity selection were performed as following: 200 l of mAb in coating buffer (50 mM NaHCO 3, pH 9.6) at 2 g/ml were incubated in 96-well plate (Immuno plate Maxisorp, Nunc) at 4°C overnight, then the plate was blocked with blocking buffer (l⫻ PBS, 3% BSA, 0.05%Tween) at 37°C for 1.5 h. Wild type phage f1 (10 11) in 200 l of blocking buffer were added to the well and incubated at room temperature for 1 h. The plate was washed extensively with PBST (1⫻ PBS, 0.1%Tween). The
phages (1 ⫻ 10 10) from 9 aa peptide library in 200 l of blocking buffer were added to the well and incubated at room temperature for 2 h. After washing, the absorbed phages were eluted and neutralized with Tris–HCl as described (17). The eluted phages were amplified by infecting DH5aF⬘ and purified with 20% PEG/2.5 M NaCl precipitation and were stored for latter immunoscreening. The purified phages were used for next round of affinity selection. Immunoscreening. After two rounds of affinity selection, DH5aF⬘ cells were infected with eluted phages at a multiplicity of infection (m.o.i.) of 10 ⫺3. The mixture was incubated at 37°C for 30 min. Then helper phage M13 K07 was added at a m.o.i. of 20 –50, and incubated at 37°C for another 15 min. The infected bacteria were centrifuged for 5 min at 3000g. The supernatant was discarded and bacteria pellet was washed three times in 1 ml of LB medium to eliminate the nonabsorbed phages. 100 l of the resuspended pellet with serial dilutions (10 ⫺3, 10 ⫺4, 10 ⫺5) were plated on LB plates containing Ampicilin (100 g/ml), Kanamycin (50 g/ml) and Isopropyl thiogalactoside (IPTG) (30 g/ml). After incubation at 37°C overnight, the plates containing 200 – 400 separated clones (10 cm plate) were layered with nitrocellulose filters and marked with needle. The filter was took out immediately and blocked with blocking buffer (5% nonfat milk powder, 1⫻ PBS, 0.05% Tween 20, 0.05% NaN 3) at room temperature for 2 h. Ten micrograms of mAb was preincubated with 25 l of bacterial extract and 25 l of f1 Phage (2.3 ⫻ 10 13/m1) in 5 ml blocking buffer at room temperature for 1 h and were then added to the blocked filters. Filter with mAb mixture was then incubated at room temperature for 1.5 h and extensively washed with washing buffer (1⫻ PBS, 0.05% Tween 20). Secondary antibody (alkaline phosphatase conjugated goat anti-mouse Abs, Sigma) diluted to 1/5000 in blocking buffer was incubated with the filter for 1.5 h at room temperature. The filters were then washed as above and developed by incubation with developing solution (330 g/ml nitro blue tetrazolium, 165 g/ml 5-bromo-4-chloro-3-indolyphosphate in l00 mM Tris–HCl, l00 mM NaCl, 5 mM MgCl 2, pH 9.6) at room temperature for 10 min. Reaction was stopped by washing with water. ELISA. In brief, multiwell plates (Immuno plate Maxisorp, Nunc) were coated overnight at 4°C with mAb at a concentration of 2 g/ml in 50 mM NaHCO 3 at pH 9.6. After washing several times with PBS/0.05% Tween 20 (PBST), plates were incubated at 37°C for 60 min with ELISA blocking buffer (5% nonfat dry milk in PBST). Sample phages (4 ⫻ 10 9) were diluted in 100 l of blocking buffer and then added to each well and allowed to bind for 1 h at 37°C. The equal amount of wild type phages was used as a negative control. Plates were then washed with PBST and 100 1/well of goat antiphage HRP-conjugated antibodies (Pharmacia, 1/5000 dilution in ELISA blocking buffer) were added. After incubation for 1 h at room temperature, plates were then washed and developed by adding 100 l of substrate TMB–H 2O 2 and incubated at 37°C in dark for 15 min. Optical density was measured by ELISA reader (Bio-Tek, U.S.A.) at 450 nm. In competitive ELISA, 96-well ELISA plates were coated with mAb at 2 g/ml. 1 ⫻ 10 9 phage/well of f1 or selected positive phage clones were incubated with 5 g/well competitor TCS. After extensively washing, the HRP conjugated secondary antibody (goat anti-M13 IgG, Pharmacia) was added. Following development, the optical density values were measured by ELISA reader at 450 nm. Immunization of mice with selected phage clones. The identified positive phage clones were amplified in DH5aF⬘ and purified by PEG/NaCl precipitation. Then the phage was resuspended in 1⫻ PBS at a concentration of 5 ⫻ 10 12 phage particles/ml (18). Male C57BL/6 mice of 10 –12 weeks of age were immunized by i.p. 250 l of positive phage clones or control wild type phage f1. The immunization was performed at week 1, 4, 7 and 9 and mice were bled on 10 days after fourth immunization. The immunized serum was used to test specific binding activity with TCS protein in ELISA. The serum were diluted at 1:300. DNA sequencing. Single-stranded DNA of the positive clones was extracted from the amplified phage using DNA purification kit ac-
922
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
cording to the instructions (Promega). Sequencing was performed by the Sanger dideoxy method with T7 sequencing kit (Pharmacia) according to the instructions. Site-directed mutagenesis. Site-directed mutagenesis was performed according to the Molecular Cloning (2nd ed.). Briefly, mutated primers were designed according to the experiments. For 4B5 epitope mutation the primers MF and MR were used. The third set of primer FNcoI and R were used to amplify the whole-length TCS gene. MF, (5⬘GGAGGGCTGGGCGATATCCCTCTGTTACGT3⬘); MR, (5⬘ATCGCCCAGCCCTCCTTCATTTGGAAGAGC3⬘); FncoI, (5⬘GATATACCATGGATGTTAGCTTCCG3⬘); R, (5⬘TGCCATATTGTTTCTATTCAGC3⬘). Protein expression and purification. By site-directed mutagenesis, a NcoI site (CCATGG) was created to add a Met codon at the ⫺1 position of the mature protein, then the mutant TCS gene for expression were digested with NcoI and SalI and cloned into pET-2d (Promega). The pET-2d containing the TCS gene was transformed to E. coli BL21 (Pharmacia) and expressed by using E. coli T7 expression system. The transformed E coli strain was cultured at 37°C in M9ZB medium with 50 g/ml ampicillin and 25 g/ml chloramphenicol until the cell density reached OD 6000.8. Then the IPTG was added to a final concentration of 0.4 mM and the cells were cultured for 2 h. The cells were collected and resuspended in 50 mM Tris buffer (pH 7.5) containing 0.1% 2-mercaptoethanol and 0.1 mM PMSF (phenylmethanesulfonyl fluoride) and lysed by sonication. The lysate was centrifuged and the supernatant was loaded onto a CM-Sephadex C-50 (Pharmacia) column. The column was washed with 50 mM Tris buffer (pH 7.5) containing 0.1 mM PMSF until A 280 was back to baseline and then it was eluted with linear gradient of 0 – 0.4 M NaCl in the washing buffer. Fractions of 3 ml were collected.
RESULTS The Phage Clones That Carried Peptide-Specific Binding to mAbs Were Selected from Phage-Peptide Library After two rounds of affinity selection and immunoscreening, two mAbs (4B5 and 2E9) corresponding phage clones were picked out and amplified. It is reasonable to consider that if the peptide sequence of positive clones were similar to the epitopes of TCS. The mAb specific-binding activity to positive clones should be competitively inhibited by TCS protein. To address this question, a competitive ELISA was performed by using TCS as a competitor in the ELISA. The results demonstrated that four positive clones from each of 4B5 and 2E9 mAbs were selected and all of them had relatively high-specific bindings to corresponding antibodies (Fig. 1). The data revealed that peptide sequences of positive phage clones may mimic the epitopes of TCS and therefore they can bind to corresponding TCS-specific mAbs. Immunogenicity of Phage-Peptide of Positive Clones To test whether peptide sequence screened from phage-peptide library had an immunogenicity that mimics the epitopes of TCS, two phage clones from each of 4B5 and 2E9 groups were used to immunize C57BL/6 mice as described in material and methods.
Wild-type phage F1 and TCS protein also were immunized to serve as negative and positive controls respectively. Ten days after the fourth immunization, all the immunized mice were bled, and the serum were collected to determine the cross-reactivity to TCS protein by ELISA (Fig. 2). The results demonstrated that the immunized serum from phage clones were able to bind TCS protein, suggesting that the sequences of peptide in selected phage clones may mimic epitopes of TCS and these epitopes were related to binding sites of 4B5 and 2E9 mAbs. Sequence Analysis of Positive Phage Clones and Prediction of Epitopes Location at TCS Since selected phage clones were able to mimic antigenicity of TCS, it was assumed that the sequence of clones may be similar to epitopes of TCS. If the motif is generated by comparison of conserved DNA sequences from phage clones, it is possible that the motif position in TCS can be predicted by comparison of the sequence between the motif and TCS crystal. Four positive phage clones that had high affinity to each of 4B5 and 2E9 mAbs were sequenced and motifs were deduced and their location in TCS crystal structure were predicted by computer software produced by R. Sayle, which can be freely downloaded from Internet. The peptide sequences of phage clones and the predicted epitopes in TCS-three dimensional structure were shown in Table 1 and Fig. 3. The data showed that 4B5 epitope was predicted to locate at amino acids position 27 to 37 and the sequence was NERKLYDIPLL. The epitope of 2E9 was predicted to locate at position 41 to 48 and the sequence was SLPESQRY. The TCS Protein Mutated at the Binding Site of 4B5 mAb Lost the Binding Activity To confirm whether the predicted epitopes TCS are correct, 4B5 epitope was selected to do site-directed mutagenesis. The TCS mutants were constructed as described under Materials and Methods. Three amino acids in the 4B5 corresponding epitope on TCS were mutated as following: Arg29 3 Gly, Lys30 3 Gly and Tyr32 3 Gly. The DNA sequence of the mutants were verified by DNA sequencing. Then the expressing vector containing the TCS mutant gene were transformed into E. coli. After expression and purification, the TCS mutant protein were used to test the binding activity to 4B5, 2E9 mAbs and to TCS-specific polyclonal Ab by ELISA, respectively. Wild-type TCS protein served as a control. The results showed that the mutated TCS protein in 4B5 epitope significantly lost the binding activity to mAb 4B5, but remained the binding activity to mAb 2E9 and to anti-TCS polyclonal antibodies (Fig. 4). The data suggested that 4B5 epitope that was identified by phage-peptide library was correct.
923
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. ELISA reactivity between isolated phage clones and their corresponding mAbs. The wild-type phage f1 was used as control. Numbers 1– 4 represent individual clones that were screened by each mAb. Competitive ELISA was performed in parallel using 5 g TCS in each well as competitor. (A) 4B5 mAb specific-reactive clones. (B) 2E9 mAb specific-reactive clones.
DISCUSSION TCS protein has a therapeutic use in clinic. Understanding of the distribution of its antigen epitopes in TCS protein will help to use this drug safely. Our previous work has demonstrated that the major epitopes of TCS can be classified into four groups according to TCS-specific mAbs binding assay (5). In this study, two mAbs (4B5 and 2E9) from two different groups were selected and the sequences of their corresponding epitopes in the TCS crystal structure were deduced by a random phage-peptide library. The function of predicted epitopes was confirmed by phage clones-immunized serum and the sequence of 4B5 corresponding epitope was further confirmed by mutagenesis analysis of TCS protein. Initially, after two rounds of selection and immunoscreening, many phage clones binding to 4B5 and 2E9 mAbs were screened by a nine random-peptide library. To our knowledge, some of screened clones revealed nonspecific binding, therefore to evaluate whether the sequences of peptide from the phage clones were sim-
ilar to TCS, competitive ELISA was performed in individual clones with mAbs and TCS. The binding activity to mAbs was significantly inhibited by adding TCS in the ELISA. The results suggested that the binding activity to mAb was TCS specific and the sequences of phage peptide seem to mimic the sequences of epitopes of TCS. Second, to test whether the expressed peptides of phage clones have a immunogenicity in vivo, the selected phage clones that carried the peptides specificbinding to mAb were injected to normal animal and the TCS-specific Ab was measured in phage immunized serum. The data showed that phage clones were able to mimic the epitopes of TCS and to induce detectable levels of Abs that had a reactivity to TCS. Third, to determine whether the peptide sequence of phage clones is similar to epitopes of TCS, all the sequences of selected clones were deduced by DNA sequence analysis. The motif of KXYXXP was generated from 4B5 epitope by comparison of conserved amino acid sequence in the phage clones. The 2E9
924
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Binding activity of antibodies induced by phage-immunization in vivo. The selected two positive phage-clones obtained from each of 4B5 and 2E9 groups were used to immunize mice and serum were collected at time after fourth immunization. F1 phage and TCS immunized serum served as negative and positive controls respectively. Serum antibodies were determined by ELISA with TCS-coated plate.
epitope showed a motif sequence of PXSQ. Based on physical-chemical properties of amino acids, Lysine (K), Tyrosine (Y) and Glutamine (Q) carry a polar group. These residues of amino acids are often located at surface of protein and may contribute to binding activity between Ab-Ag recognition. Although Proline (P) is weakly hydrophobic, it is also located at the surface of the protein, especially, at the turning corner of protein. The data demonstrated that the identified TABLE 1
amino acids residues in the motifs may also locate at binding sites of epitopes of TCS-protein. Next, the locations of motifs were analyzed in the three-dimensional crystal structure of TCS protein. The 4B5 epitope was predicted to locate at amino acids residues 27 to 37 of TCS protein and the sequence was NERKLYDIPLL. The 2E9 epitope was predicted to locate at position 41 to 48 according to sequence analysis. Its sequence was SLPESQRY. Both epitopes were located at the surface of TCS protein. This structure information was consistent with the amino acids resi-
The Sequences of Epitopes Selected from Phage Peptide Libraries by Using 4B5 and 2E9 mAbs mAb
Selected clones
Sequence
Frequency*
4B5 27 37 N E R K L Y D I P L L** 9-aa library No. 1 No. 2 No. 3 No. 4 Predicted motif
H R K K Q K
K K R K K
R S P P X
Y Y Y Y Y
Y Y H Y X
P P K P X
P A P P P
P*** S A T P R
3 4 2 1
2E9 41 48 S L P G S Q R Y A** 9-aa library No. 1 No. 2 No. 3 No. 4 Predicted motif
V P P A S A P I M T P S C F H
P P P P P
Y Y Y G X
S S S T X
Q Q Q R Q
R*** L P G N C R
1 3 2 4
* Number of the identical clones screened from phage library. ** TCS protein sequence shown for comparison. *** The conserved amino acids in phage clones were indicated in boldface.
FIG. 3. The predicted three-dimensional structure of the two epitopes recognized by mAb 4B5 and 2E9 in TCS protein. The structure was generated using software Rasmole. The sequence of 4B5 epitope is NERKLYDIPLL and located position in TCS is 27 to 37 amino acids. The sequence of 2E9 epitope is SLPGSQRYA and located position is 41 to 48 amino acids.
925
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. The binding activity of mAbs to mutated TCS protein. The binding activity of 4B5 mutant TCS protein to mAbs 4B5, 2E9, and anti-TCS polyclonal Ab was determined by ELISA. MTCS: mutated TCS protein in the 4B5 epitope (Arg 29, Lys 30, and Tyr 32 were replaced by Gly). WTCS, wild-type TCS.
dues of motifs that carry a polar group and often located at the surface of protein. To further prove that this speculation was correct, mutagenesis analysis was performed in 4B5 epitope. Since the 4B5 epitopes motif contained amino acids residues (Lysine and Tyrosine) based on predicted sequence of TCS, they should contribute to a specific-binding activity to mAb 4B5. We hypothesized that Lysine and Tyrosine play an important role in determining the antigenicity of 4B5 epitopes. To address this question, the amino acids residues of Lysine and Tyrosine in the position 30 and 32 of TCS amino acids sequence were mutated to Glycine in addition to Arginine in position 29. When expressed TCS-protein mutated at predicted 4B5 epitope was used to test the binding activity to mAbs, only the binding reactivity to 4B5 mAb was lost, but the reactivity was remained to other mAb, such as 2E9. The data suggested that the mutation in 4B5 epitopes of TCS eliminated the 4B5 mAb-specific binding reactivity and confirmed that the predicted 4B5 epitope sequence was correct in three-dimensional structure of TCS-protein. Phage-peptide library has been widely used to study the interaction between Ag–Ab recognition (19), Because the technique has a high efficiency to identify the epitope sequence of given Ag, it has been succeeded to be used to identify mimotopes that recognized by mAbs (20). Our work demonstrated that the epitope for 4B5 mAbs was identified by phage peptide display. The 4B5 corresponding epitope was located on the surface of TCS protein. Immunization of phage-peptide resulted in induction of TCS-specific Ab and the mutated 4B5 epitope in TCS protein lost reactivity to 4B5 mAb. Our experiment suggested that phage display peptide library is useful to identify Ag epitopes and to raise Ab in disease diagnosis and treatment. We are using this technique to identify TCS-specific IgE epitopes and to
explore the structure of IgE epitopes. The study will provide a insight of understanding of pathogenesis of allergy. ACKNOWLEDGMENTS This work was supported by grant (STZ97-2-06) from Chinese Academy of Sciences, 973 project (G1999053907), National Natural Science Foundation of China (30070708) and also supported by World Laboratory. We thank Prof. Ricardo Cortese, Dr. Paolo Monaci and Dr. Franco Felici of IRBM, Italy for providing peptide libraries and Dr. Minenkova Olga for helpful discussion and advice. We are also indebted to Prof. Nie Huining and Huang Aiming for their helpful discussion and assistance on the TCS mutant protein expression and purification.
REFERENCES
926
1. Wang, Y., and Yeh, M. (1996) Molecular characterization of the V regions of four IgE antibodies specific for trichosanthin. Immunology 89, 316 –323. 2. McGrath, M. S., Hwang, K. M., Caldwell, S. E., Gaston, I. Luk, K. C., Wu, P., Crowe, S., Daniels, J., and Marsh, J. (1989) GLQ223: an inhibitor of human immunodeficiency virus replication in acutely and chronically infected cells of lymphocyte and mononuclear phagocyte lineage. Proc. Natl. Acad. Sci. USA 86, 2844 –2848 3. Zhao, J., Ben, L. H., Wu, Y. L., Hu, W., Ling, K., Xin, S. M., Nie, H. L., Ma, L., and Pei, G. (1999) Anti-HIV agent trichosanthin enhances the capabilities of chemokines to stimulate chemotaxis and G protein activation, and this is mediated through interaction of trichosanthin and chemokine receptors. J. Exp. Med. 190, 101–111. 4. Ji, Y. Y., Yang, C. H., and Yeh, M. (1995) The influence of Trichosanthin on the induction of IgE response to ovabumin under adjuvant-free condition. Cell Res. 5, 67–74. 5. Gu, H., Yeh, M., and Yao, Z. (1986) Preparation, purification and characterization of mouse monoclonal antibody against trichosanthin. Acta Biol. Exp. Sin. 19, 109 –119. 6. Li, Z. D., Yuan, Y. R., and Yeh, M. (1997) Structural analysis and
Vol. 282, No. 4, 2001
7.
8.
9.
10.
11.
12. 13.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
molecular modeling of two anti-trichosanthin IgE clones from phage antibody library. Cell Res. 7, 171–178. Gu, Y. J., and Xia, Z. X. (2000) Crystal structures of the complexes of trichosanthin with four substrate analogs and catalytic mechanism of RNA N-glycosidase. Proteins 39, 37– 46. Amit, A. G., Mariuzza, R. A., and Phillips S. E. V. (1986) Threedimensional structure of an antigen antibody complex at 2.8 A resolution. Science 233, 747–753 Colman, P. M., Laver, W. G., and Varghese, J. N. (1986) Threedimensional structure of a complex of antibody with influenza virus neuraminidase. Nature 326, 358 –363. Jemmerson, R., and Patterson, Y. (1986) Mapping antigenic sites on proteins: Implications for the design of synthetic vaccines. BioTechniques 4, 18 –21. Paterson, Y., Englander, S. W., and Roder, H. (1990) An antibody binding site on cytochrome a defined by hydrogen exchange and two dimensional NMR. Science 249, 755–759 Scott, J. K., and Smith, G. P. (1990) Searching for peptides with epitope library. Science 249, 386 –390 Felici, F., Castongnoli, L., and Musacchio, A. (1991) Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector. J. Mol. Biol. 222, 301–310.
14. Lam, K. S., Salmon, S. E., and Hersch, E. M. (1991) A new type of synthetic peptide library for identifying ligand-binding activity. Nature 354, 82– 84 15. Houghton, R. A. Pinilla, C., and Blondelle, S. E. (1991) Generation and use of synthetic peptide combinatorial libraries for basic research and drug discovery. Nature 354, 84 – 86. 16. Luzzago, A., Felici, F., Tramontano, A., Pessi, A., and Cortese, R. (1993) Mimicking of discontinuous epitopes by phage displayed peptides. I. Epitope mapping of human H ferritin using a phage library of constrained peptides. Gene 128, 51–57. 17. Prezzi, C. Nuzzo, M., and Meola, A. (1996) Selection of antigenic and immunogenic mimics of hepatitis C virus using sera from patients. J. Immunol. 156, 4504 – 4513. 18. Galfre, G., Monaci, P., Nicosia, A., Luzzago, A., Felici F., and Cortese, R. (1996) Immunization with phage-displayed mimotopes. Methods Enzymol. 267, 109 –115. 19. Zhu, Z. Y., Zhong, C. P., and Xu, W. F. (1999) PSMA mimotope isolated from phage displayed peptide library can induce PSMAspecific immune response. Cell Res. 9, 271–280. 20. Cook, A. D., Davies, J. M., Myers, M. A., Mackay, I. R., and Rowley, M. J. (1998) Mimotopes identified by phage display for the monoclonal antibody CII–C1 to type II collagen. J. Autoimmun. 11, 205–211.
927
Identification of Epitopes of Trichosanthin by Phage Peptide Library Zhongyu Zhu, Yeh Ming, and Bing Sun 1 Laboratory of Molecular Immunology, Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, People’s Republic of China
Received March 5, 2001
The phage displayed random peptide library has recently emerged as a powerful technique for analyzing Ab–Ag interactions. In this study, the method was employed to identify epitopes of trichosanthin. Two monoclonal Abs (4B5, 2E9) which recognized different epitopes of trichosanthin (TCS) were selected and a phage-peptide library with nine amino acids (9 aa) was used to screen the positive phage clones that have high affinity to the mAbs. Two groups of phage clones that carried peptide-specific binding to mAbs were identified by the screen. The identified phage clones carried peptide–specific binding to 4B5 and 2E9 mAbs were immunized in mice. To evaluate mimotope of selected phages, the specific binding activity to TCS was measured in the serum from phage-immunized mice. They all showed positive results. The conserved interaction motifs were deduced from the peptide sequences of each group of selected phage clones. When compared the motif sequence with the sequence of TCS, it was predicted that 4B5-corresponding epitope was located at 27–37 aa of TCS protein and 2E9corresponding epitope was located at 41– 48 aa of TCS. The predicted sequence of 4B5-corresponding epitope was further confirmed by site-directed mutation of TCS protein. The data showed that the expressed TCS protein mutated in 4B5corresponding epitope was unable to bind 4B5 mAb. The results suggested that the phage display peptide library is useful to identify Ag epitopes and to raise Ab in disease diagnosis and treatment. © 2001 Academic Press
Key Words: trichosanthin; antigen epitope; phage display peptide library; site-directed mutation.
Abbreviations used: TCS, trichosanthin; mAb, monoclonal antibody; 9 aa, nine amino acids; IPTG, isopropyl thiogalactoside. 1 To whom correspondence should be addressed at Laboratory of Molecular Immunology, Shanghai Institute of Biochemistry and Cell Biology, 320 Yueyang Road, Shanghai 200031, People’s Republic of China. Fax: 86-21-64331090. E-mail: bingsun@sunm. shcnc.ac.cn.
Trichosanthin, an active protein component isolated from Trichosanthes kirilowii, has been used as a traditional Chinese medicine for inducing abortion for a long time and has a variety of medical functions in clinical practice (1). In recent years it has been demonstrated that trichosanthin is an anti-human immunodeficiency virus agent (2, 3). However, allergic reactions of patients were obviously observed when TCS was used in clinic and therefore limits its therapeutic use due to the allergenicity. Our previous work has demonstrated that TCS is a strong allergen in TCS immunized animal model. In the model TCS can induce TCS-specific IgE in serum without any adjuvant (4). To understand the structure of Ag epitopes of TCS, we have raised 16 monoclonal antibodies and the antibodies can be classified as four groups according to antibody competitive binding assay which imply they recognize different epitopes on TCS (5). The detailed information of epitope sequences of TCS were not clear. Although the sequences of two epitopes of TCS have been predicted by using molecular modeling analysis (6), their functional analysis was difficult. In this study, we are interested in that whether phage peptide library is useful to identify Ag epitopes and whether the epitopes are able to be located on the surface of TCS three-dimensional crystal structure since the technique is easy to manipulate in the experiment and the immunized serum from phage clones is able to evaluate the antigenicity of predicted epitope sequence. The results will allow us to understand antigenicity of TCS whole protein and especially TCS-specific IgE epitopes. In the study, that TCS is selected has another preferential consideration, since the gene of TCS has been cloned and the crystal structure of TCS has also been elucidated (7). This available information is required to do functional analysis and to determine a precise location of epitopes on the surface of TCS protein. Two monoclonal antibodies (4B5 and 2E9) from two different groups were chosen due to their higher affinity to TCS protein.
921
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
mAbs to protein Ags have been widely used in structural and functional analysis. Analysis of Ab–Ag complexes by X-ray crystallography (8, 9), chemical modification (10), or deuterium exchange analysis by nuclear magnetic resonance (11) have provided a detailed picture of the amino acids that comprise a given epitope. Few Ab–Ag complexes have been described in such detail because these methods require substantial effort and are technically difficult. Recent alternative techniques for epitope identification have been established, such as large libraries of random peptides displayed on the surface of filamentous bacteriophage (12, 13) and chemically synthesized (14, 15). However, most studies demonstrated only the sequence of epitopes in given Ag, but rare study provided structure information of Ag due to the lack of a three-dimensional structure of Ag protein. In this report, we described the screening of the epitopes of TCS protein by using a phage display peptide library. The mAb was served as probe to screen positive phage clones. The clones carrying peptide– specific binding to mAb were injected into normal mice and the immunized serum were used to evaluate antigenicity of the sequence of epitopes in selected phage clones. The motif is generated as analyzing conserved amino acid sequence in individual positive clones of each group. The sequence of epitopes and its location on the surface of TCS are predicted compared the sequences between motifs and TCS protein. Finally, to confirm the predicted sequences of epitopes, mutagenesis was performed in the corresponding site of epitope in TCS protein and the epitope-specific binding is determined by ELISA between mAb and expressed mutated TCS protein. The data suggested that phage display peptide library succeeded in identifying the epitopes of TCS, indicating its potential finding of epitopes of Ag in raising Ab for disease diagnosis and treatment. MATERIALS AND METHODS mAb and reagents. Two TCS-specific monoclonal antibodies (4B5 and 2E9) were made by our lab (5). They were purified through affinity chromatography using TCS-Sepharose 4B conjugates column (constructed according to the instructions of Pharmacia Co., U.S.A.) from the ascites. Crystallized TCS in Trichosanthin Injection Solution, produced by Jin-San Pharmaceutical Factory, 1.2 mg/ml, was used as Ag. Random phage peptide library (16) expressing linear (pVIII 9aa) nine peptides fused to pVIII of filamentous bacteriophage fd, vector Pc89, wild type phage f1 and bacterial strain DH5aF⬘ were all kindly provided by Dr. Paolo Monaci of IRBM (Istituto di Ricerche di Biologia Molecolare P. Angeletti SPA, Rome, Italy). Affinity selection. Two rounds of affinity selection were performed as following: 200 l of mAb in coating buffer (50 mM NaHCO 3, pH 9.6) at 2 g/ml were incubated in 96-well plate (Immuno plate Maxisorp, Nunc) at 4°C overnight, then the plate was blocked with blocking buffer (l⫻ PBS, 3% BSA, 0.05%Tween) at 37°C for 1.5 h. Wild type phage f1 (10 11) in 200 l of blocking buffer were added to the well and incubated at room temperature for 1 h. The plate was washed extensively with PBST (1⫻ PBS, 0.1%Tween). The
phages (1 ⫻ 10 10) from 9 aa peptide library in 200 l of blocking buffer were added to the well and incubated at room temperature for 2 h. After washing, the absorbed phages were eluted and neutralized with Tris–HCl as described (17). The eluted phages were amplified by infecting DH5aF⬘ and purified with 20% PEG/2.5 M NaCl precipitation and were stored for latter immunoscreening. The purified phages were used for next round of affinity selection. Immunoscreening. After two rounds of affinity selection, DH5aF⬘ cells were infected with eluted phages at a multiplicity of infection (m.o.i.) of 10 ⫺3. The mixture was incubated at 37°C for 30 min. Then helper phage M13 K07 was added at a m.o.i. of 20 –50, and incubated at 37°C for another 15 min. The infected bacteria were centrifuged for 5 min at 3000g. The supernatant was discarded and bacteria pellet was washed three times in 1 ml of LB medium to eliminate the nonabsorbed phages. 100 l of the resuspended pellet with serial dilutions (10 ⫺3, 10 ⫺4, 10 ⫺5) were plated on LB plates containing Ampicilin (100 g/ml), Kanamycin (50 g/ml) and Isopropyl thiogalactoside (IPTG) (30 g/ml). After incubation at 37°C overnight, the plates containing 200 – 400 separated clones (10 cm plate) were layered with nitrocellulose filters and marked with needle. The filter was took out immediately and blocked with blocking buffer (5% nonfat milk powder, 1⫻ PBS, 0.05% Tween 20, 0.05% NaN 3) at room temperature for 2 h. Ten micrograms of mAb was preincubated with 25 l of bacterial extract and 25 l of f1 Phage (2.3 ⫻ 10 13/m1) in 5 ml blocking buffer at room temperature for 1 h and were then added to the blocked filters. Filter with mAb mixture was then incubated at room temperature for 1.5 h and extensively washed with washing buffer (1⫻ PBS, 0.05% Tween 20). Secondary antibody (alkaline phosphatase conjugated goat anti-mouse Abs, Sigma) diluted to 1/5000 in blocking buffer was incubated with the filter for 1.5 h at room temperature. The filters were then washed as above and developed by incubation with developing solution (330 g/ml nitro blue tetrazolium, 165 g/ml 5-bromo-4-chloro-3-indolyphosphate in l00 mM Tris–HCl, l00 mM NaCl, 5 mM MgCl 2, pH 9.6) at room temperature for 10 min. Reaction was stopped by washing with water. ELISA. In brief, multiwell plates (Immuno plate Maxisorp, Nunc) were coated overnight at 4°C with mAb at a concentration of 2 g/ml in 50 mM NaHCO 3 at pH 9.6. After washing several times with PBS/0.05% Tween 20 (PBST), plates were incubated at 37°C for 60 min with ELISA blocking buffer (5% nonfat dry milk in PBST). Sample phages (4 ⫻ 10 9) were diluted in 100 l of blocking buffer and then added to each well and allowed to bind for 1 h at 37°C. The equal amount of wild type phages was used as a negative control. Plates were then washed with PBST and 100 1/well of goat antiphage HRP-conjugated antibodies (Pharmacia, 1/5000 dilution in ELISA blocking buffer) were added. After incubation for 1 h at room temperature, plates were then washed and developed by adding 100 l of substrate TMB–H 2O 2 and incubated at 37°C in dark for 15 min. Optical density was measured by ELISA reader (Bio-Tek, U.S.A.) at 450 nm. In competitive ELISA, 96-well ELISA plates were coated with mAb at 2 g/ml. 1 ⫻ 10 9 phage/well of f1 or selected positive phage clones were incubated with 5 g/well competitor TCS. After extensively washing, the HRP conjugated secondary antibody (goat anti-M13 IgG, Pharmacia) was added. Following development, the optical density values were measured by ELISA reader at 450 nm. Immunization of mice with selected phage clones. The identified positive phage clones were amplified in DH5aF⬘ and purified by PEG/NaCl precipitation. Then the phage was resuspended in 1⫻ PBS at a concentration of 5 ⫻ 10 12 phage particles/ml (18). Male C57BL/6 mice of 10 –12 weeks of age were immunized by i.p. 250 l of positive phage clones or control wild type phage f1. The immunization was performed at week 1, 4, 7 and 9 and mice were bled on 10 days after fourth immunization. The immunized serum was used to test specific binding activity with TCS protein in ELISA. The serum were diluted at 1:300. DNA sequencing. Single-stranded DNA of the positive clones was extracted from the amplified phage using DNA purification kit ac-
922
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
cording to the instructions (Promega). Sequencing was performed by the Sanger dideoxy method with T7 sequencing kit (Pharmacia) according to the instructions. Site-directed mutagenesis. Site-directed mutagenesis was performed according to the Molecular Cloning (2nd ed.). Briefly, mutated primers were designed according to the experiments. For 4B5 epitope mutation the primers MF and MR were used. The third set of primer FNcoI and R were used to amplify the whole-length TCS gene. MF, (5⬘GGAGGGCTGGGCGATATCCCTCTGTTACGT3⬘); MR, (5⬘ATCGCCCAGCCCTCCTTCATTTGGAAGAGC3⬘); FncoI, (5⬘GATATACCATGGATGTTAGCTTCCG3⬘); R, (5⬘TGCCATATTGTTTCTATTCAGC3⬘). Protein expression and purification. By site-directed mutagenesis, a NcoI site (CCATGG) was created to add a Met codon at the ⫺1 position of the mature protein, then the mutant TCS gene for expression were digested with NcoI and SalI and cloned into pET-2d (Promega). The pET-2d containing the TCS gene was transformed to E. coli BL21 (Pharmacia) and expressed by using E. coli T7 expression system. The transformed E coli strain was cultured at 37°C in M9ZB medium with 50 g/ml ampicillin and 25 g/ml chloramphenicol until the cell density reached OD 6000.8. Then the IPTG was added to a final concentration of 0.4 mM and the cells were cultured for 2 h. The cells were collected and resuspended in 50 mM Tris buffer (pH 7.5) containing 0.1% 2-mercaptoethanol and 0.1 mM PMSF (phenylmethanesulfonyl fluoride) and lysed by sonication. The lysate was centrifuged and the supernatant was loaded onto a CM-Sephadex C-50 (Pharmacia) column. The column was washed with 50 mM Tris buffer (pH 7.5) containing 0.1 mM PMSF until A 280 was back to baseline and then it was eluted with linear gradient of 0 – 0.4 M NaCl in the washing buffer. Fractions of 3 ml were collected.
RESULTS The Phage Clones That Carried Peptide-Specific Binding to mAbs Were Selected from Phage-Peptide Library After two rounds of affinity selection and immunoscreening, two mAbs (4B5 and 2E9) corresponding phage clones were picked out and amplified. It is reasonable to consider that if the peptide sequence of positive clones were similar to the epitopes of TCS. The mAb specific-binding activity to positive clones should be competitively inhibited by TCS protein. To address this question, a competitive ELISA was performed by using TCS as a competitor in the ELISA. The results demonstrated that four positive clones from each of 4B5 and 2E9 mAbs were selected and all of them had relatively high-specific bindings to corresponding antibodies (Fig. 1). The data revealed that peptide sequences of positive phage clones may mimic the epitopes of TCS and therefore they can bind to corresponding TCS-specific mAbs. Immunogenicity of Phage-Peptide of Positive Clones To test whether peptide sequence screened from phage-peptide library had an immunogenicity that mimics the epitopes of TCS, two phage clones from each of 4B5 and 2E9 groups were used to immunize C57BL/6 mice as described in material and methods.
Wild-type phage F1 and TCS protein also were immunized to serve as negative and positive controls respectively. Ten days after the fourth immunization, all the immunized mice were bled, and the serum were collected to determine the cross-reactivity to TCS protein by ELISA (Fig. 2). The results demonstrated that the immunized serum from phage clones were able to bind TCS protein, suggesting that the sequences of peptide in selected phage clones may mimic epitopes of TCS and these epitopes were related to binding sites of 4B5 and 2E9 mAbs. Sequence Analysis of Positive Phage Clones and Prediction of Epitopes Location at TCS Since selected phage clones were able to mimic antigenicity of TCS, it was assumed that the sequence of clones may be similar to epitopes of TCS. If the motif is generated by comparison of conserved DNA sequences from phage clones, it is possible that the motif position in TCS can be predicted by comparison of the sequence between the motif and TCS crystal. Four positive phage clones that had high affinity to each of 4B5 and 2E9 mAbs were sequenced and motifs were deduced and their location in TCS crystal structure were predicted by computer software produced by R. Sayle, which can be freely downloaded from Internet. The peptide sequences of phage clones and the predicted epitopes in TCS-three dimensional structure were shown in Table 1 and Fig. 3. The data showed that 4B5 epitope was predicted to locate at amino acids position 27 to 37 and the sequence was NERKLYDIPLL. The epitope of 2E9 was predicted to locate at position 41 to 48 and the sequence was SLPESQRY. The TCS Protein Mutated at the Binding Site of 4B5 mAb Lost the Binding Activity To confirm whether the predicted epitopes TCS are correct, 4B5 epitope was selected to do site-directed mutagenesis. The TCS mutants were constructed as described under Materials and Methods. Three amino acids in the 4B5 corresponding epitope on TCS were mutated as following: Arg29 3 Gly, Lys30 3 Gly and Tyr32 3 Gly. The DNA sequence of the mutants were verified by DNA sequencing. Then the expressing vector containing the TCS mutant gene were transformed into E. coli. After expression and purification, the TCS mutant protein were used to test the binding activity to 4B5, 2E9 mAbs and to TCS-specific polyclonal Ab by ELISA, respectively. Wild-type TCS protein served as a control. The results showed that the mutated TCS protein in 4B5 epitope significantly lost the binding activity to mAb 4B5, but remained the binding activity to mAb 2E9 and to anti-TCS polyclonal antibodies (Fig. 4). The data suggested that 4B5 epitope that was identified by phage-peptide library was correct.
923
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. ELISA reactivity between isolated phage clones and their corresponding mAbs. The wild-type phage f1 was used as control. Numbers 1– 4 represent individual clones that were screened by each mAb. Competitive ELISA was performed in parallel using 5 g TCS in each well as competitor. (A) 4B5 mAb specific-reactive clones. (B) 2E9 mAb specific-reactive clones.
DISCUSSION TCS protein has a therapeutic use in clinic. Understanding of the distribution of its antigen epitopes in TCS protein will help to use this drug safely. Our previous work has demonstrated that the major epitopes of TCS can be classified into four groups according to TCS-specific mAbs binding assay (5). In this study, two mAbs (4B5 and 2E9) from two different groups were selected and the sequences of their corresponding epitopes in the TCS crystal structure were deduced by a random phage-peptide library. The function of predicted epitopes was confirmed by phage clones-immunized serum and the sequence of 4B5 corresponding epitope was further confirmed by mutagenesis analysis of TCS protein. Initially, after two rounds of selection and immunoscreening, many phage clones binding to 4B5 and 2E9 mAbs were screened by a nine random-peptide library. To our knowledge, some of screened clones revealed nonspecific binding, therefore to evaluate whether the sequences of peptide from the phage clones were sim-
ilar to TCS, competitive ELISA was performed in individual clones with mAbs and TCS. The binding activity to mAbs was significantly inhibited by adding TCS in the ELISA. The results suggested that the binding activity to mAb was TCS specific and the sequences of phage peptide seem to mimic the sequences of epitopes of TCS. Second, to test whether the expressed peptides of phage clones have a immunogenicity in vivo, the selected phage clones that carried the peptides specificbinding to mAb were injected to normal animal and the TCS-specific Ab was measured in phage immunized serum. The data showed that phage clones were able to mimic the epitopes of TCS and to induce detectable levels of Abs that had a reactivity to TCS. Third, to determine whether the peptide sequence of phage clones is similar to epitopes of TCS, all the sequences of selected clones were deduced by DNA sequence analysis. The motif of KXYXXP was generated from 4B5 epitope by comparison of conserved amino acid sequence in the phage clones. The 2E9
924
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Binding activity of antibodies induced by phage-immunization in vivo. The selected two positive phage-clones obtained from each of 4B5 and 2E9 groups were used to immunize mice and serum were collected at time after fourth immunization. F1 phage and TCS immunized serum served as negative and positive controls respectively. Serum antibodies were determined by ELISA with TCS-coated plate.
epitope showed a motif sequence of PXSQ. Based on physical-chemical properties of amino acids, Lysine (K), Tyrosine (Y) and Glutamine (Q) carry a polar group. These residues of amino acids are often located at surface of protein and may contribute to binding activity between Ab-Ag recognition. Although Proline (P) is weakly hydrophobic, it is also located at the surface of the protein, especially, at the turning corner of protein. The data demonstrated that the identified TABLE 1
amino acids residues in the motifs may also locate at binding sites of epitopes of TCS-protein. Next, the locations of motifs were analyzed in the three-dimensional crystal structure of TCS protein. The 4B5 epitope was predicted to locate at amino acids residues 27 to 37 of TCS protein and the sequence was NERKLYDIPLL. The 2E9 epitope was predicted to locate at position 41 to 48 according to sequence analysis. Its sequence was SLPESQRY. Both epitopes were located at the surface of TCS protein. This structure information was consistent with the amino acids resi-
The Sequences of Epitopes Selected from Phage Peptide Libraries by Using 4B5 and 2E9 mAbs mAb
Selected clones
Sequence
Frequency*
4B5 27 37 N E R K L Y D I P L L** 9-aa library No. 1 No. 2 No. 3 No. 4 Predicted motif
H R K K Q K
K K R K K
R S P P X
Y Y Y Y Y
Y Y H Y X
P P K P X
P A P P P
P*** S A T P R
3 4 2 1
2E9 41 48 S L P G S Q R Y A** 9-aa library No. 1 No. 2 No. 3 No. 4 Predicted motif
V P P A S A P I M T P S C F H
P P P P P
Y Y Y G X
S S S T X
Q Q Q R Q
R*** L P G N C R
1 3 2 4
* Number of the identical clones screened from phage library. ** TCS protein sequence shown for comparison. *** The conserved amino acids in phage clones were indicated in boldface.
FIG. 3. The predicted three-dimensional structure of the two epitopes recognized by mAb 4B5 and 2E9 in TCS protein. The structure was generated using software Rasmole. The sequence of 4B5 epitope is NERKLYDIPLL and located position in TCS is 27 to 37 amino acids. The sequence of 2E9 epitope is SLPGSQRYA and located position is 41 to 48 amino acids.
925
Vol. 282, No. 4, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. The binding activity of mAbs to mutated TCS protein. The binding activity of 4B5 mutant TCS protein to mAbs 4B5, 2E9, and anti-TCS polyclonal Ab was determined by ELISA. MTCS: mutated TCS protein in the 4B5 epitope (Arg 29, Lys 30, and Tyr 32 were replaced by Gly). WTCS, wild-type TCS.
dues of motifs that carry a polar group and often located at the surface of protein. To further prove that this speculation was correct, mutagenesis analysis was performed in 4B5 epitope. Since the 4B5 epitopes motif contained amino acids residues (Lysine and Tyrosine) based on predicted sequence of TCS, they should contribute to a specific-binding activity to mAb 4B5. We hypothesized that Lysine and Tyrosine play an important role in determining the antigenicity of 4B5 epitopes. To address this question, the amino acids residues of Lysine and Tyrosine in the position 30 and 32 of TCS amino acids sequence were mutated to Glycine in addition to Arginine in position 29. When expressed TCS-protein mutated at predicted 4B5 epitope was used to test the binding activity to mAbs, only the binding reactivity to 4B5 mAb was lost, but the reactivity was remained to other mAb, such as 2E9. The data suggested that the mutation in 4B5 epitopes of TCS eliminated the 4B5 mAb-specific binding reactivity and confirmed that the predicted 4B5 epitope sequence was correct in three-dimensional structure of TCS-protein. Phage-peptide library has been widely used to study the interaction between Ag–Ab recognition (19), Because the technique has a high efficiency to identify the epitope sequence of given Ag, it has been succeeded to be used to identify mimotopes that recognized by mAbs (20). Our work demonstrated that the epitope for 4B5 mAbs was identified by phage peptide display. The 4B5 corresponding epitope was located on the surface of TCS protein. Immunization of phage-peptide resulted in induction of TCS-specific Ab and the mutated 4B5 epitope in TCS protein lost reactivity to 4B5 mAb. Our experiment suggested that phage display peptide library is useful to identify Ag epitopes and to raise Ab in disease diagnosis and treatment. We are using this technique to identify TCS-specific IgE epitopes and to
explore the structure of IgE epitopes. The study will provide a insight of understanding of pathogenesis of allergy. ACKNOWLEDGMENTS This work was supported by grant (STZ97-2-06) from Chinese Academy of Sciences, 973 project (G1999053907), National Natural Science Foundation of China (30070708) and also supported by World Laboratory. We thank Prof. Ricardo Cortese, Dr. Paolo Monaci and Dr. Franco Felici of IRBM, Italy for providing peptide libraries and Dr. Minenkova Olga for helpful discussion and advice. We are also indebted to Prof. Nie Huining and Huang Aiming for their helpful discussion and assistance on the TCS mutant protein expression and purification.
REFERENCES
926
1. Wang, Y., and Yeh, M. (1996) Molecular characterization of the V regions of four IgE antibodies specific for trichosanthin. Immunology 89, 316 –323. 2. McGrath, M. S., Hwang, K. M., Caldwell, S. E., Gaston, I. Luk, K. C., Wu, P., Crowe, S., Daniels, J., and Marsh, J. (1989) GLQ223: an inhibitor of human immunodeficiency virus replication in acutely and chronically infected cells of lymphocyte and mononuclear phagocyte lineage. Proc. Natl. Acad. Sci. USA 86, 2844 –2848 3. Zhao, J., Ben, L. H., Wu, Y. L., Hu, W., Ling, K., Xin, S. M., Nie, H. L., Ma, L., and Pei, G. (1999) Anti-HIV agent trichosanthin enhances the capabilities of chemokines to stimulate chemotaxis and G protein activation, and this is mediated through interaction of trichosanthin and chemokine receptors. J. Exp. Med. 190, 101–111. 4. Ji, Y. Y., Yang, C. H., and Yeh, M. (1995) The influence of Trichosanthin on the induction of IgE response to ovabumin under adjuvant-free condition. Cell Res. 5, 67–74. 5. Gu, H., Yeh, M., and Yao, Z. (1986) Preparation, purification and characterization of mouse monoclonal antibody against trichosanthin. Acta Biol. Exp. Sin. 19, 109 –119. 6. Li, Z. D., Yuan, Y. R., and Yeh, M. (1997) Structural analysis and
Vol. 282, No. 4, 2001
7.
8.
9.
10.
11.
12. 13.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
molecular modeling of two anti-trichosanthin IgE clones from phage antibody library. Cell Res. 7, 171–178. Gu, Y. J., and Xia, Z. X. (2000) Crystal structures of the complexes of trichosanthin with four substrate analogs and catalytic mechanism of RNA N-glycosidase. Proteins 39, 37– 46. Amit, A. G., Mariuzza, R. A., and Phillips S. E. V. (1986) Threedimensional structure of an antigen antibody complex at 2.8 A resolution. Science 233, 747–753 Colman, P. M., Laver, W. G., and Varghese, J. N. (1986) Threedimensional structure of a complex of antibody with influenza virus neuraminidase. Nature 326, 358 –363. Jemmerson, R., and Patterson, Y. (1986) Mapping antigenic sites on proteins: Implications for the design of synthetic vaccines. BioTechniques 4, 18 –21. Paterson, Y., Englander, S. W., and Roder, H. (1990) An antibody binding site on cytochrome a defined by hydrogen exchange and two dimensional NMR. Science 249, 755–759 Scott, J. K., and Smith, G. P. (1990) Searching for peptides with epitope library. Science 249, 386 –390 Felici, F., Castongnoli, L., and Musacchio, A. (1991) Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector. J. Mol. Biol. 222, 301–310.
14. Lam, K. S., Salmon, S. E., and Hersch, E. M. (1991) A new type of synthetic peptide library for identifying ligand-binding activity. Nature 354, 82– 84 15. Houghton, R. A. Pinilla, C., and Blondelle, S. E. (1991) Generation and use of synthetic peptide combinatorial libraries for basic research and drug discovery. Nature 354, 84 – 86. 16. Luzzago, A., Felici, F., Tramontano, A., Pessi, A., and Cortese, R. (1993) Mimicking of discontinuous epitopes by phage displayed peptides. I. Epitope mapping of human H ferritin using a phage library of constrained peptides. Gene 128, 51–57. 17. Prezzi, C. Nuzzo, M., and Meola, A. (1996) Selection of antigenic and immunogenic mimics of hepatitis C virus using sera from patients. J. Immunol. 156, 4504 – 4513. 18. Galfre, G., Monaci, P., Nicosia, A., Luzzago, A., Felici F., and Cortese, R. (1996) Immunization with phage-displayed mimotopes. Methods Enzymol. 267, 109 –115. 19. Zhu, Z. Y., Zhong, C. P., and Xu, W. F. (1999) PSMA mimotope isolated from phage displayed peptide library can induce PSMAspecific immune response. Cell Res. 9, 271–280. 20. Cook, A. D., Davies, J. M., Myers, M. A., Mackay, I. R., and Rowley, M. J. (1998) Mimotopes identified by phage display for the monoclonal antibody CII–C1 to type II collagen. J. Autoimmun. 11, 205–211.
927