Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis

Accepted Manuscript Title: Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis Author: Krishnaraj Thirugnanasambantham Subramanian Saravanan Kulandaivelu Karikalan Rajaraman Bharanidharan Perumal Lalitha S. Ilango Villianur Ibrahim Hairul Islam PII: DOI: Reference:

S1476-9271(15)30001-3 http://dx.doi.org/doi:10.1016/j.compbiolchem.2015.04.011 CBAC 6425

To appear in:

Computational Biology and Chemistry

Received date: Revised date: Accepted date:

6-1-2015 4-4-2015 24-4-2015

Please cite this article as: Thirugnanasambantham, Krishnaraj, Saravanan, Subramanian, Karikalan, Kulandaivelu, Bharanidharan, Rajaraman, Lalitha, Perumal, Ilango, S., Islam, Villianur Ibrahim Hairul, Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis.Computational Biology and Chemistry http://dx.doi.org/10.1016/j.compbiolchem.2015.04.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis a,d*

Krishnaraj Thirugnanasambantham

a

, Subramanian Saravanan , Kulandaivelu Karikalanb, Rajaraman Bharanidharana, Perumal Lalithac, S. Ilangoa and Villianur Ibrahim Hairul Islama*

a

Pondicherry Centre for Biological Sciences, Jawahar Nagar, Pondicherry, India

b

School of Bioscience and Technology, Vellore Institute of Technology, VIT University, Vellore, India c

Department of Biotechnology, Pondicherry University, Kalapet, Pondicherry, India

d

State Bio-control Laboratory, Perunthalaivar Kamaraj Krishi Vigyan Kendra (PKKVK), Kurumbapet, Puducherry, India

Corresponding Author * Dr. Villianur Ibrahim Hairul Islam M.Sc., Ph.D Pondicherry Centre for Biological Sciences, Jawahar Nagar, Pondicherry – 605 005, India Email: [email protected] Phone: +91-0413-2203530 Dr. Krishnaraj Thirugnanasambantham M.sc, Ph.D State Bio-control Laboratory, Perunthalaivar Kamaraj Krishi Vigyan Kendra (PKKVK), Kurumbapet, Puducherry, India Email: [email protected]

Phone: +91-9443932405

Graphical abstract Highlights



Twenty four pre-miRNAs were reported from M.charantia developing seed transcriptome



Phylogeny analysis with binary data were unreliable



Identified miRNAs held sequence conservation in mature miRNAs



Phylogeny analysis of pre-miRNA sequences revealed genus specific segregation



Predicted targets revealed role of miRNAs in regulation of developmental process

Abstract

Momordica charantia (bitter gourd, bitter melon) is a monoecious Cucurbitaceae with anti-oxidant, anti-microbial, anti-viral and antidiabetic potential. Molecular studies on this economically valuable plant are very essential to understand its phylogeny and evolution.

MicroRNAs (miRNAs) are conserved, small, non-coding RNA with ability to regulate gene expression by bind the 3’ UTR region of target mRNA and are evolved at different rates in different plant species. In this study we have utilized homology based computational approach and identified 27 mature miRNAs for the first time from this bio-medically important plant. The phylogenetic tree developed from binary data derived from the data on presence/absence of the identified miRNAs were noticed to be uncertain and biased. Most of the identified miRNAs were highly conserved among the plant species and sequence based phylogeny analysis of miRNAs resolved the above difficulties in phylogeny approach using miRNA. Predicted gene targets of the identified miRNAs revealed their importance in regulation of plant developmental process. Reported miRNAs held sequence conservation in mature miRNAs and the detailed phylogeny analysis of pre-miRNA sequences revealed genus specific segregation of clusters. Key Words: microRNA; Momordica charantia; Phylogeny; Short Read Archive; plant develolpment

1. Introduction MicroRNAs are small non-coding RNAs (19–25 nt long) which play major role in post-transcriptional regulation of protein-coding genes (Sekar et al., 2014) and are important for evolution of developmental processes in plants (Jasinski et al., 2010). In plants the prefect homology between the miRNA and its target gene leads to catalytic degradation of the target mRNA. Inspite of this translation repression of target gene expression have also been noticed from plant miRNA-mRNA interaction as a rare event. Using the above two mechanisms plant miRNA are known to act as most important players in the regulation plant growth and development, in response to biotic and abiotic stress. In general plants miRNA are transcribed as long primary transcript (pri-miRNA) by RNA polymerase II. The pri-miRNA are further processed by a Dicer-like RNAse III ribonuclease (DCL1), which yield further shorter miRNA precursor (pre-miRNA) with stem loop structure and miRNA:miRNA* duplex. Unlike the animal, the whole process of plant synthesis starting from transcription to miRNA:miRNA* duplex formation takes place in nucleus and transported to the cytoplasm and methylated. In cytoplasm the methylated mature miRNA is incorporated in the RNA-Induced Silencing Complex (RISC) and recruits the ARGONAUTE1 (AGO1) to silence the target mRNA (Gazzani et al., 2009).

The family Cucurbitaceae which comprises of 800 species in 130 genera is well known for the vegetable crops such as melon, cucumber squash and zucchini (Wang et al., 2010). Momordica charantia (bitter gourd, bitter melon) is a monoecious Cucurbitaceae plant and is mainly cultivated in regions of tropical, subtropical Asia, Africa and South America (Minraj et al., 1993). Bitter gourd is well known for anti-oxidant, anti-microbial, anti-viral, anti-diabetic activities (Joseph and Jini, 2013). Further considering the origin, it have been described that bitter gourd has been cultivated in India as early as <1590 AD (Decker-Walters, 1999), which indicates the level of an extremely ancient attentiveness about this plant species. More recently Schaefer and Renner (2010) reported the origin of Momordica from tropical Africa and that the Asian species has been dispersed about 19 million years ago. Among the Natural products known with pharmaceutical biology, bitter melon is considered as a good source of biologically active compounds (Islam et al., 2011). Further bitter gourd gains economically important morphological diversity and it varies with size, color, surface texture, and edible maturity trait of mature fruit (Robinson and Decker-Walters, 1999). In addition sex expression (i.e., monoecious and gynoecious sex types) is also considered as an economically important trait of the bitter gourd widely cultivated in tropical regions (Behera et al., 2006). Different molecular approaches have been applied to document the genetic diversity associated with economically important traits of bitter melon. Gaikwad et al. (2008) performed AFLP based comprehensive diversity assessment of 38 Indian commercial varieties and cultivated landraces originating from different agroecological zones and reported genetic discrimination among the cultivars. Recently 108 AFLP markers and 5 five qualitative trait loci fruit color, fruit luster, fruit surface structure, stigma color, and seed color has been reported from the first genetic map of bitter melon (Kole et al., 2012). Sixteen polymorphic microsatellite loci from 36 individuals of M. charantia were reported using Fast Isolation by AFLP of Sequence COntaining Repeats (FIASCO) (Wang et al., 2010). Guo et al. (2012) reported genetic diversity of Momordica using 10 FIASCO derived SSR marker. Matsumura et al. (2014) identified GTFL-1 as the closest SNP locus to the putative gynoecious locus and suggested GTFl-1 for marker-assisted selection of gynoecy in bitter melon breeding program. Though there are reports on development of molecular markers for various QTL (Kole et al., 2012) and transcriptomic studies for gene discovery (Yang et al., 2010), up to our knowledge no work has been initiated on discovery of miRNA from this economically valuable plant till date. In this present study we have used the computational approach to identify miRNA from M. charantia by searing the short read archive (SRA) database in NCBI and for the first time we have reported 27 mature miRNA in the bitter melon, M. charantia. Further the phylogenies of the identified miRNAs were compared with the earlier reported miRNAs and the results were discussed in detail.

2. Materials and Methods 2.1. Collection of reference miRNA and EST sequences We used short reads archive (SRA) database from NCBI for the identification of miRNAs from M. charantia using computational approach (Fig.1) as per Thirugnanasambantham et al. (2013). M. charantia SRA sequences (1,05,995 RNA sequences as of reported from developing seeds of bitter melon under the experimental accession SRX330814) were extracted from NCBI using the search term “Momordica charantia”. The pre-miRNA (28,645 as of June 2014) and mature miRNA (35,828 as of June 2014) sequences were retrieved from the miRBase (http://www.mirbase.org/). After eliminating redundant and poor quality sequences, local nucleotide database was created for M. charantia SRA sequences. The created local nucleotide database was searched against the miRNAs dataset for their corresponding homolog sequences.

2.2. Identification of miRNA precursor sequences The mature miRNA sequences were used as a query for homology search against our local M. charantia nucleotide sequence database at e-value threshold <0.01 using BLAST 2.2.22+ program with all other parameters as default (Altschul et al., 1990). The candidate miRNA sequences and their corresponding SRA sequence were collected and archived as FASTA formats. The respective precursor and mature miRNA sequence were aligned against the corresponding nucleotide sequence using ClustalW (Thompson et al., 1994) multiple sequence alignment tool. Selected nucleotide sequence with less than four mismatches with precursor and mature miRNA sequence were validated for their non-protein encoding phenomenon using BLASTx programme with default parameter (Altschul et al., 1997). Selected nucleotide sequences were aligned to reference pre-miRNA sequences, the aligned region were extracted and considered as candidate pre-miRNA sequence.

2.3. Validation of candidate miRNAs sequences and identification of target The candidate pre-miRNAs extracted as above were validated using Mfold v 3.2 (http://www.mfold.rna.albary.edu/). While selecting a RNA sequence from the nucleotide resource as a candidate miRNA precursor, the criteria as reported by Zhang et al. (2006) was followed as specified below: (a) the candidate pre-miRNA sequence must fold into an appropriate stem-loop hairpin secondary structure, (b) mature miRNA sequence must be located in one arm of the hairpin structure, (c) the mature miRNAs should <7 mismatches with the opposite miRNA*

sequence in the other arm, (d) loop or break in miRNA sequences should not be noticed, (e) the MFEs of predicted secondary structures should be ≤−18 kcal/mol and 40–70 % A + U contents. Target of the identified M. charantia miRNA were predicted using psRNATarget with the Cucumis sativus transcriptome sequences (Dai and Zhao, 2011). The identified targets were used as query sequences for BLASTx search (Altschul et al., 1997) and functionally annotated using AmiGO Blast and literature survey. 2.4. Nomenclature of predicted miRNAs and phylogenetic analysis: Predicted miRNAs were named as per the pattern of miRBase Griffiths-Jones et al. (2003). The mature sequences were designated “miR” and the respective precursor hairpins were labeled as “mir” with the prefix “mch” for Momordica charantia. For phylogenetic analysis the precursor sequences of homolog miRNA’s were identified, collected, and aligned with identified M.charantia miRNA using ClustalW (Thompson et al., 1994). Phylogenetic analysis of the aligned miRNA sequences were performed with MEGA5 (Tamura et al., 2004). The evolutionary distances were computed using the maximum composite likelihood method (Tamura et al., 2007) and are in the units of the number of base substitutions per site.

3. Results Totally 1,05,995 SRA sequences of M.charantia were retrieved from the NCBI and used for prediction of miRNAs. From the present study on computational search for conserved miRNAs, 150 SRA sequences alone were recorded with less than four mismatches with the corresponding miRNA sequences. Further analysis of the sequence using blastx programme revealed presence of 52 non protein encoding ESTs. To be final 24 M.charantia pre- miRNAs showing 27 mature miRNA sequences were reported after a careful evaluation of the secondary structure analysis (Fig. 2 - 8). For the predicted miRNAs, Table 1 provides details such as source sequences, length of precursor sequences, minimum free energies of folded miRNA structure and A + U content. Among the predicted miRNAs, 12 miRNAs were notice in 3’ strand and 15 miRNAs were noticed in 5’ strand. The minimum free energy of the predicted miRNAs was noticed with the range of -18.60 to -73.20 kcal/mol with an average of -47.39 kcal/mol. On the other hand A + U percentage of the predicted miRNAs ranged from 40.10 to 61.90 % with an average value of 47.89 %. From the total 27 miRNAs predicted, 22 miRNAs revealed 100 % match with their homologue in miRNA database, while five miRNAs (mch-miR156g, mch-miR166i, mch-miR396a-3p, mch-miR399d and mch-miR2111a-3p) shows difference in the mature miRNA sequence.

Table 2 documented the conservation of the identified miRNA among the various plant species. The miR2915 and miR2018 respectively from Populus euphratica and Vigna unguiculata has not been reported from other plant species till date. As the outcome of the present study, both the miRNAs was report in as the first time from M.charantia. Considering the families of miR156, among 58 plant species selected the miR156d and miR156g has been identified from 27 and 21 plant species respectively. It was observed that the miR166b was the more conserved and was noticed in 38 plant species till date (Fig. 9).

3.1. Phylogeny of miR166b Based on the developed dendrogram, nine distinct clusters were observed among the 38 plants species (Fig. 10). The cluster 1 was dominated with 28 plant species used in the phylogeny analysis, which included the M.charantia miR166b. Whereas the Linum usitatissimum was observed as single cluster 2. Sorghum bicolor and Gossypium hirsutum were notices as cluster-3 and cluster 4 was documented with Pinus taeda and Selaginella moellendorffii. All other remaining plant species namely Amborella trichopoda, Brassica napus, Aegilops tauschii, Physcomitrella patens and Picea abies were resolved each as a separate cluster 5 to 9 respectively. Among the family Brassicaceae, both the species Arabidopsis lyrata and Arabidopsis thaliana were noticed in the large cluster 1, whereas the Brassica napus was observed as a separate cluster 6. All the plant species from the dicotyledonous family Fabaceae and monocotyledonous family Poaceae were documented in the large cluster 1. Thus the present study on phylogenetic analysis of the predicted M.charantia miR166b with other plant species revealed its conservation among the plant species studied.

3.2. Phylogeny of miR168 Unlike the case of miR166b with mixed monocotyledons and dicotyledons plants, phylogeny analysis of miR168 segregated the monocotyledons and dicotyledons into different cluster (Fig. 11). In case of miR168 all the 8 monocotyledon plants of the family Poaceae were found as the cluster 1. The cluster 2 was recorded with a single plant species Amborella trichopoda from the Dicotyledon family Amborellaceae. Among the family Fabaceae Glycine max and Vigna unguiculata were noticed as the cluster 3 and the known model plant of the fabaceae was placed as cluster 4. In case of the family Brassicaceae A.lyrata and A.thaliana from the genus Arabidopsis were observed as cluster 5, whereas the B.napus and B.rapa from the genus Brassica were noticed as a separate cluster 11. Ricinus communis from the Euphorbiaceae family was

noticed as a separate cluster 12 and two plant species from the Rutaceae family (Citrus clementina and Citrus reticulata) were found in a single cluster 13. Plant species such as Theobroma cacao (Malvaceae), Nicotiana tabacum and Solanum lycopersicum (Solanaceae), Manihot esculenta (Euphorbiaceae) and Populus trichocarpa (Salicaceae) were recorded as distinct clusters 6 to 10 respectively. Whereas the Malus domestica and Prunus persica from the family Rosaceae were noticed as separate clusters 14 and 15 respectively. The dicotyledons Vitis vinifera (Vitaceae), Acacia auriculiformis (Fabaceae), Linum usitatissimum (Linaceae), Cynara cardunculus (Asteraceae), Aquilegia caerulea (Ranunculaceae), Cucumis melo and Momordica charantia (Cucurbitaceae) were observed as the cluster 16 to 22 respectively.

3.3. Phylogeny of miR396a Analysis of pre-miRNA sequence of miR396a revealed that it was conserved in majority of the plant species (Fig. 12). The phylogenetic tree derived from the pre-miRNA sequence resulted in 4 major clusters. The cluster 1 was covered with 27 plant species which included both monocot and dicot plants including M.charantia. Whereas the clusters 2 was reported with a single plant species Amborella trichopoda, which was rare understory shrubs endemic to the main island of New Caledonia, located at southwest pacific ocean. The grasses Brachypodium distachyon and Aegilops tauschii were noticed as clusters 3 and 4 respectively.

3.4. Phylogeny of miR2111a Considering the miR2111a, including the present report till date it has been reported specifically from 12 plant species of class Eudicots (Fig. 13). The phylogenetic analysis revealed that 4 plant species (Arabidopsis lyrata, Arabidopsis thaliana, Brassica napus and Brassica rapa) from the family Brassicaceae were documented in a same cluster 1. Whereas, the cluster 2 was documented with Prunus persica of Rosaceae family, Cucumis melo and Momordica charantia from Cucurbitaceae family. Plant species Glycine max and Medicago truncatula from Fabaceae family was observed as cluster 3 and 5 respectively. The remaining 4 plant species Populus trichocarpa (Salicaceae), Malus domestica (Rosaceae) and Manihot esculenta (Euphorbiaceae) were observed as cluster 4.

3.5. Biological role of predicted M.charantia microRNAs

Total of 43 targets were predicted for the 27 miRNAs identified from the Cucumis sativus transcriptomic data (Table 3). Overall targets of the identified miRNAs are noticed to be involved in diverse process ranging from plant development, senescence, fruit ripening, biotic and abiotic stress tolerance. Among the identified miRNAs miR156d, miR159a, miR164d, miR166, miR171d, miR319d, miR394a and miR396a were noticed to be involved in regulation plant developmental process by down regulating the expression of their respective protein targets. Whereas the genes encoding senescence associated proteins were targeted by miR156g and miR172b. 4. Discussion MicroRNAs (miRNAs) are small, non-coding RNA that have ability to bind the 3’ UTR region of target mRNA and regulates its expression either by translational repression or mRNA degradation (Thirugnanasambantham et al., 2013). In this study for the first time we have applied homology based computational approach with M.charantia SRA sequences deposited by Yang et al. (2010) and reported 27 miRNA sequences belonging to 20 different miRNA families from the M.charantia. Detailed sequence analysis of the developed RNA sequence read from developing seeds of M.charantia revealed 50 % of the total sequences with length 200nt revealed no homology to the reported proteins sequences from green plants (Yang et al., 2010). The above scenario confirms the presence of miRNA transcripts in transcriptome of developing seed. Among the miRNAs over 65% of the predicted mature miRNAs was noticed with size 21 nucleotides and morethan 80% of the premature miRNA sequences were noticed with length ranging from 50 to 150 nucleotides. Similar reports have been reported earlier from various species (Cucumis sativus, Cucumis melo, Citrullus lanatus, Siraitia grosvenorii and Cucurbita pepo) of the Cucurbitaceae family (Hu et al., 2014). The average minimum free energy calculated for the predicted pre-miRNA sequences from the present study was greater than those reported from miRNAs of other Cucurbitaceae family (Hu et al., 2014). Plant miRNAs are conserved and evolved at different rates with different plant species (Zhang et al., 2006; Wang et al., 2007). Our study revealed presence/absence of the identified miRNAs varied in wide range of plant species (Table 2). In addition the phylogenetic tree derived from the above binary data were noticed to be uncertain and biased. Recent study of Thomson et al. (2014) reported that the data on presence/absence of microRNA makes inference of phylogeny to be difficult. Inspite of the problem, sequence based phylogeny analysis of miRNAs could resolve the above difficulties. In our study, phylogenetic analysis of miR166b revealed that it was highly conserved in most of the plant species studied and the obtained clusters were mixed with both monocotyledons and dicotyledons plants. Unlike the miR166b which has been identified from large number of plant species, other isoforms of its family miR166h and miR166i has been identified in 15 and 12 plant

species respectively. Whereas, phylogeny analysis of miR168 revealed cluster specific segregation of monocotyledons and dicotyledons. Further the present phylogeny with pre miR168 sequence revealed genus specific segregation of clusters of family Brassicaceae. Existence of miR168 in Brassicaceae has been reported to be happened at least 40 million years ago and evolutionally maintained in Brassicaceae (Gazzani et al., 2009). Zhao et al. (2012) reported that miRNAs have rapid evolution ratios than ribosomal DNA genes. Though the sequences of mature miRNAs were highly conserved, variation in pre-miRNA sequence confirms the role of miRNA evolution in regulation of wide biological process/responses of plants (Hu et al., 2014). MicroRNAs reported from plants were well documented to target the expression of key genes regulating plant developmental process (Hu et al., 2014). Unlike animal miRNAs originated from formation of hairpin structures in the genomes, plant miRNAs are originated by duplication of preexisting miRNA genes or protein-coding genes. The above difference in mode of evolution makes the difference in the binding to target mRNAs and mode of action in plants and animals (Nozawa et al., 2012). Absence of fully annotated M.charantia transcriptomic resource is the bottleneck in identification of M.charantia specific mRNA targets. So we have adopted its close relative Cucumis sativus transcriptomic resource for target prediction. The identified miRNAs were involved in regulation of wide range of biological process (Table 3). The identified miR156d from M.charantia transcriptome was predicted to control the developmental process via targeting the Squamosa promoter-binding-like protein (Yu et al., 2012). While for mch-miR156g three putative targets namely β-galactosidase, early nodulin-like protein and 14 kDa proline-rich protein, playing key role in regulating senescence and fruit ripening, cellular transport, host-bacterial interaction, plant development and root growth were predicted (Figueiredo et al., 2011; Denance et al., 2014; Choi et al., 1996). Since transcription factor MYB29, cell wall protein RBR3, mannan endo-1,4-beta-mannosidase and benzyl alcohol O-benzoyltransferase were observed as targets of mchmiR159a, it could involve in regulation of plant development, biotic stress and fruit ripening (Sonderby et al., 2010; Desvoyes et al., 2014; CruzRamirez et al., 2012; Wang et al., 2014). The mch-miR160a was predicted to target auxin response factor and controls seed germination, postembryonic root development and growth (Liu et al., 2007). Endoribonuclease dicer regulating feedback regulation of miRNA activity and isoflavone 2'-hydroxylase involving in antimicrobial isoflavonoid synthesis were predicted as targets of mch-miR162 (Xie et al., 2003; Akashi et al., 1998). NAC domain-containing protein has been identified as a target of mch-miR164d, which revealed the involvement of miR164d in abiotic stress tolerance and development (Fang et al., 2014). Further Jasinski et al. (2010) reported importance of miR164 gene evolution in evolution of leaf shape and carpel closure in the angiosperms. All three subfamilies of miR166 identified in the present study was predicted to

target mRNA encoding histone deacetylase, homeobox-leucine zipper protein, nicotinamide adenine dinucleotide transporter and abscisic acid insensitive protein involved in biological process such as leaf development, seed development, secondary growth and redox balance of plant development (Ueno et al., 2007; Ko et al., 2006; Palmieri et al., 2009 and Brocard et al., 2002). Two important transcription factors namely ERF and JUNGBRUNNEN 1-like protein involved in signaling pathway related to development and stress response were predicted as targets of mch- miR172b (Thirugnanasambantham et al., 2014; Wu et al., 2012). Similarly mch-miR319d targeted transcripts encoding glucan endo-1,3-beta-glucosidase, β-D-xylosidase, transcription factors GAMYB, TCP2 and MYB29 involving in regulation of plant development, biotic and abiotic stress responses (Beffa et al., 1993; Goujon et al., 2003; Li and Lu., 2014; Woodger et al., 2003). Transcription factor MYB3 responsible for developmental and defense response regulation was predicted as target of mch- miR396a (Yanhui et al., 2006). In conclusion the present study reported 27 mature miRNAs from developing seed specific transcriptome of bitter melon. Identified miRNAs were reported to hold sequence conservation in mature miRNAs and the detailed phylogeny analysis of pre-miRNA sequences revealed genus specific segregation of clusters. The predicted targets of the identified miRNAs from the developing seed transcriptomic resource clarified the importance of miRNA in seed development. Further extended study could explain evolutionary importance of mircoRNA in economically important M.charantia and its related plant species.

Acknowledgments All the authors are thankful to the Pondicherry Centre for Biological Sciences (PCBS) for providing the necessary facility. Financial support as start-up loan from the State Bank of India (RASMECC), Pondicherry, India, to establish the PCBS is also gratefully acknowledged. KT is a recipient of Young Scientist grant (SB/FT/LS-382/2012), Science and Engineering Research Board (SERB), Department of Science and Technology, Government of India, and their financial support is duly acknowledged.

Reference:

1. Akashi, T., Aoki, T., Ayabe, S., 1998. CYP81E1, a cytochrome P450 cDNA of licorice (Glycyrrhiza echinata L.), encodes isoflavone 2′hydroxylase. Biochem Biophys Res Commun. 251, 67–70. 2. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J Mol Biol. 215(3), 403-410. 3. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs." Nucleic Acids Res. 25, 3389-3402. 4. Beffa, R.S., Neuhaus, J.M., Meins, F.Jr., 1993. Physiological compensation in antisense transformants: specific induction of an "ersatz" glucan endo-1,3-beta-glucosidase in plants infected with necrotizing viruses. Proc Natl Acad Sci U S A. 90(19), 8792-8796. 5. Behera, T.K., Dey, S.S., Sirohi, P.S., 2006. ‘DBGy-201’ and ‘DBGy-202’: two gynoecious lines in bitter gourd (Momordica charantia L.) isolated from indigenous source. Indian J Genet Plant Breed 66, 61 - 62. 6. Brocard, I.M., Lynch, T.J., Finkelstein, R.R., 2002. Regulation and role of the Arabidopsis ABA-insensitive 5 gene in ABA, sugar and stress response. Plant Physiol 129, 1533-1543. 7. Choi, D.W., Song, J.Y., Kwon, T.M., Kim, S.G., 1996. Characterization of a cDNA encoding a proline-rich 14 kDa protein in developing cortical cells of the roots of bean (Phaseolus vulgaris) seedlings. Plant Molecular Biology 30, 973–982. 8. Cruz-Ramirez, A., Diaz-Trivino, S., Blilou, I., et al. 2012. A bistable circuit involving SCARECROW-RETINOBLASTOMA integrates cues to inform asymmetric stem cell division. Cell 150, 1002–1015. 9. Dai, X., Zhao, P.X., 2011. psRNAtarget: a plant small RNA target analysis server. Nucleic Acids Res. 39, W115–W159. doi: 10.1093/nar/gkr319. 10. D'Auria, J.C., Chen, F., Pichersky, E., 2002. Characterization of an acyltransferase capable of synthesizing benzylbenzoate and other volatile esters in flowers and damaged leaves of Clarkia breweri. Plant Physiol 130: 466–476. 11. Decker-Walters, D.S., 1999. Cucurbits, Sanskrit and the Indo-Aryans. Economic Botany 53(1), 98-112. 12. Denance, N., Szurek, B., Noel, L.D., 2014. Emerging functions of nodulin-like proteins in non-nodulating plant species. Plant Cell Physiol. 55(3), 469-74. doi: 10.1093/pcp/pct198. 13. Desvoyes, B., de Mendoza, A., Ruiz-Trillo, I., Gutierrez, C., 2014. Novel roles of plant RETINOBLASTOMA-RELATED (RBR) protein in cell proliferation and asymmetric cell division. J Exp Bot. 65(10), 2657-2666. doi: 10.1093/jxb/ert411.

14. Fang, Y., Xie, K., Xiong, L., 2014. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice. J Exp Bot. 65(8), 2119-35. doi: 10.1093/jxb/eru072. 15. Figueiredo, S.A., Lashermes, P., Aragao, F.J., 2011. Molecular characterization and functional analysis of the β-galactosidase gene during Coffea arabica (L.) fruit development. J Exp Bot. 62(8), 2691-703. doi: 10.1093/jxb/erq440. 16. Gaikwad, A.B., Behera, T.K., Singh, A.K., Chandel, D., Karihaloo, J.L., Staub, J.E. 2008. AFLP analysis provides strategies for improvement of bitter gourd (Momordica charantia). HortScience 43, 127–133. 17. Gazzani, S., Li, M., Maistri, S., Scarponi, E., Graziola, M., Barbaro, E., Wunder, J., Furini, A., Saedler, H., Varotto, C., 2009. Evolution of MIR168 paralogs in Brassicaceae. BMC Evol Biol 9, 62. 18. Goujon, T., Minic, Z., El Amrani, A., Lerouxel, O., Aletti, E., Lapierre, C., Joseleau, J.P., Jouanin, L., 2003. AtBXL1, a novel higher plant (Arabidopsis thaliana) putative β-xylosidase gene, is involved in secondary cell wall metabolism and plant development. Plant J. 33, 677– 690. 19. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., 2003. Rfam: an RNA family database. Nucleic Acids Res 31, 439– 441. 20. Guo, D.L., Zhang, J.P., Xue, Y.M., Hou, X.G., 2012. Isolation and characterization of 10 SSR markers of Momordica charantia (Cucurbitaceae). Am J Bot 99, e182–183 doi:10.3732/ajb.1100277. 21. Hu, J., Sun, L., Zhu, Z., Zheng, Y., Xiong, W., Ding, Y., 2014. Characterization of conserved microRNAs from five different cucurbit species using computational and experimental analysis. Biochimie. 102, 137-44. doi: 10.1016/j.biochi.2014.03.002. 22. Islam, S., Jalaludin, M., Hettiarachchy, N.S., 2011. Bio-active Compounds of Bitter Melon Genotypes (Momordica charantia L.) in Relation to Their Physiological Functions. Functional Foods in Heals and Disease 2, 61-74. 23. Jasinski, S., Vialette-Guiraud, A.C.M., Scutt, C.P., 2010. The evolutionary-developmental analysis of plant microRNAs Philos. Trans. R. Soc. London, Ser. B, 365, 469–476. 24. Joseph, B., Jini, D., 2013. Antidiabetic effects of Momordica charantia (bitter melon) and its medicinal potency. Asian Pac J Trop Dis. 3(2), 93–102.

25. Ko, J.H., Yang, S.H., Han, K.H., 2006. Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant J. 47, 343–355 10.1111/j.1365-313X.2006.02782.x. 26. Kole, C., Olukolu, B.A,, Kole, P., Rao, V.K., Bajpai, A., Backiyarani, S., Singh, J., Elanchezhian, R., Abbott, A.G., 2012. The first genetic map and positions of major fruit trait loci of bitter melon (Momordica charantia). J Plant Sci Mol Breed. doi: 10.7243/2050-2389-1-1. http://www.hoajonline.com/journals/jpsmb/content/pdf/1.pdf 27. Li, C., Lu, S., 2014. Genome-wide characterization and comparative analysis of R2R3-MYB transcription factors shows the complexity of MYB-associated regulatory networks in Salvia miltiorrhiza. BMC Genomics. 15, 277. doi: 10.1186/1471-2164-15-277. 28. Liu, P.P., Montgomery, T.A., Fahlgren, N., Kasschau, K.D., Nonogaki, H., Carrington, J.C., 2007. Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J. 52(1), 133-146. 29. Miniraj, N., Prasanna, K.P., Peter, K.V., 1993. Bitter gourd Momordica spp. In: Kalloo G, Bergh BO (eds) Genetic improvement of vegetable plants. Pergamon Press, Oxford. p. 239–246. 30. Nozawa, M., Miura, S., Nei, M,. 2012. Origins and evolution of microRNA genes in plant species. Genome Biol Evol. 4, 230–239. 31. Palmieri, F., Rieder, B., Ventrella, A., Blanco, E., Do, P.T., Nunes-Nesi, A., Trauth, A.U., Fiermonte, G., Tjaden, J., Agrimi, G., Kirchberger, S., Paradies, E., Fernie, A.R., Neuhaus, H.E., 2009. Molecular identification and functional characterization of Arabidopsis thaliana mitochondrial and chloroplastic NAD+ carrier proteins. J. Biol. Chem. 284, 31249–31259. Doi. 10.1074/jbc.M109.041830. 32. Robinson, R.W., Decker-Walters, D.S., 1999. Cucurbits. CAB International, Oxon (GB) pp 226. 33. Schaefer, H., Renner, S.S., 2010. A three-genome phylogeny of Momordica (Cucurbitaceae) suggests seven returns from dioecy to monoecy and recent long-distance dispersal to Asia. Mol Phylogenet Evol. 54, 553–560. 34. Schebeck, T., Stenzel, I., Heilmann, I., 2008. Type B phosphatidylinositol-4-phosphate 5-kinases mediate pollen tube growth in Nicotiana tabacum and Arabidopsis by regulating apical pectin secretion. Plant Cell. 20, 3312-3330. 35. Sekar, D., Hairul Islam, V.I., Thirugnanasambantham, K., Saravanan, S., 2014. Relevance of miR-21 in HIV and non-HIV-related lymphomas. Tumour Biol. 35, 8387–8393. 36. Sonderby, I.E., Burow, M., Rowe, H.C., Kliebenstein, D.J., Halkier, B.A., 2010. A complex interplay of three R2R3 MYB transcription factors determines the profile of aliphatic glucosinolates in Arabidopsis. Plant Physiol. 153(1), 348-363. doi: 10.1104/pp.109.149286.

37. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, 1596–1599. 38. Tamura, K., Nei, M., Kumar, S., 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA 101, 11030–11035. 39. Thirugnanasambantham, K., Hairul-Islam, V.I., Saravanan, S., Subasri, S., Subatri, A., 2013. Computational approach for identification of Anopheles gambiae miRNA involved in modulation of host immune response. Applied Biochemistry and Biotechnology 170, 281–291. 40. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research 22(22), 4673-4680. 41. Thomson, R.C., Plachetzki, D.C., Mahler, D.L., Moore, B.R., 2014. A critical appraisal of the use of microRNA data in phylogenetics. Proceedings of the National Academy of Sciences 111(35), E3659–E3668, doi: 10.1073/pnas.1407207111. 42. Ueno, Y., Ishikawa, T., Watanabe, K., Terakura, S., Iwakawa, H., Okada, K., et al. (2007). Histone deacetylases and ASYMMETRIC LEAVES2 are involved in the establishment of polarity in leaves of Arabidopsis. Plant Cell 19, 445–457. 43. Wang, S., Zhu, Q.H., Guo, X., Gui, Y., Bao, J., Helliwell, C., Fan, L., 2007. Molecular evolution and selection of a gene encoding two randem microRNAs in rice. FEBS Lett 581, 4789-4793. 44. Wang, S.Z.,Pan, L., Hu, K., Chen, C.Y., Ding Y., 2010. Development and characterization of polymorphic microsatellite markers in Momordica charantia (Cucurbitaceae). American Journal of Botany 97, e75–e78. 45. Wang, Y., Vilaplana, F., Brumer, H., Aspeborg, H., 2014. Enzymatic characterization of a glycoside hydrolase family 5 subfamily 7 (GH5_7) mannanase from Arabidopsis thaliana. Planta. 239(3), 653-665. doi: 10.1007/s00425-013-2005-y. 46. Woodger, F.J., Millar, A., Murray, F., Jacobsen, J.V., Gubler, F., 2003. The role of GAMYB transcription factors in GA-regulated gene expression. J Plant Growth Regul 22, 176–184. 47. Wu, A., Allu, A.D., Garapati, P., Siddiqui, H., Dortay, H., Zanor, M.I., et al. (2012). JUNGBRUNNEN1, a reactive oxygen speciesresponsive NAC transcription factor, regulates longevity in Arabidopsis. Plant Cell 24, 482–506. doi: 10.1105/tpc.111.090894. 48. Xie, Z., Kasschau, K.D., Carrington, J.C., (2003). Negative feedback regulation of Dicer-Like1 in Arabidopsis by microRNA-guided mRNA degradation. Curr. Biol. 13, 784–789.

49. Yang, P., Li, X., Shipp, M.J., Shockey, J.M., Cahoon, E.B., 2010. Mining the bitter melon (Momordica charantia l.) seed transcriptome by 454 analysis of non-normalized and normalized cDNA populations for conjugated fatty acid metabolism-related genes. BMC Plant Biology 10, 250 doi:10.1186/1471-2229-10-250. 50. Yanhui, C., Xiaoyuan, Y., Kun, H., Meihua, L., Jigang, L., Zhaofeng, G., Zhiqiang, L., Yunfei, Z., Xiaoxiao, W., Xiaoming, Q., Yunping, S., Li, Z., Xiaohui, D., Jingchu, L., Xing-Wang, D., Zhangliang, C., Hongya, G., Li-Jia, Q., 2006. The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol Biol. 60(1), 107-124. 51. Yu, S., Galvão, V.C., Zhang, Y.C., Horrer, D., Zhang, T.Q., Hao, Y.H., Feng, Y.Q., Wang, S., Schmid, M., Wang, J.W., 2012. Gibberellin regulates the Arabidopsis floral transition through miR156-targeted SQUAMOSA promoter binding-like transcription factors. Plant Cell. 24(8), 3320-3332. 52. Zhang, B., Pan, X., Anderson, T.A., 2006. Identification of 188 conserved maize microRNAs and their targets. FEBS Letter 580, 3753–3762. 53. Zhang, B.H., Pan, X.P., Wang, Q., Cobb, G.P., Anderson, T.A., 2006. Computational identification of microRNAs and their targets, Comput. Biol. Chem. 30, 395e407. 54. Zhao, J.P., Diao, S., Zhang, B.Y., Niu, B.Q., Wang, Q.L., et al. (2012) Phylogenetic Analysis and Molecular Evolution Patterns in the MIR482-MIR1448 Polycistron of Populus L. PLoS ONE 7(10), e47811. doi:10.1371/journal.pone.0047811.

Figure legends:

Fig. 1. A schematic illustration of steps involved in computational identification of Momordica charantia miRNA.

Fig. 2. Secondary structure of identified Momordica charantia premature miRNAs (156d, 156g, 160a, 162 and 164d) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 3. Secondary structure of identified Momordica charantia premature miRNAs (166b, 166i, 167b and 167c) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 4. Secondary structure of identified Momordica charantia premature miRNAs (171d, 172b, 390b, 396a and 399d) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 5. Secondary structure of identified Momordica charantia premature miRNAs (529, 2018, 2111a and 2915) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 6. Secondary structure of identified Momordica charantia premature miRNAs (159a and 166h) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 7. Secondary structure of identified Momordica charantia premature miRNAs (167d, and 168) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 8. Secondary structure of identified Momordica charantia premature miRNAs (319d and 394) showing minimal free energy and mature miRNA sequence in stem region.

Fig. 9. Number of plant species containing the identified Momordica charantia miRNA.

Fig. 10. Conservation and phylogenetic analysis of mch-mir166b with 37 other plant species. (A) Phylogenetic tree of the pre-miRNAs of mchmir166b with other plant species having mir166b. ath, Arabidopsis thaliana; aly, Arabidopsis lyrata; mtr, Medicago truncatula; cme, Cucumis melo; rco, Ricinus communis; nta, Nicotiana tabacum; mch, Momordica charantia; csi, Citrus sinensis; tcc, Theobroma cacao; sly, Solanum lycopersicum; osa, Oryza sativa; bdi, Brachypodium distachyon; crt, Citrus reticulate; vvi, Vitis vinifera; gma, Glycine max; pde, Pinus densata; dpr, Digitalis purpurea; ptc, Populus trichocarpa; hbr, Hevea brasiliensis; ppe, Prunus persica; cpa, Carica papaya; zma, Zea mays; hvu, Hordeum vulgare; stu, Solanum tuberosum; aqc, Aquilegia caerulea; ssl, Salvia sclarea; mdm, Malus domestica; mes, Manihot esculenta; lus, Linum usitatissimum; sbi, Sorghum bicolor; ghr, Gossypium hirsutum; pta, Pinus taeda; smo, Selaginella moellendorffii; atr, Amborella trichopoda; bna, Brassica napus; ata, Aegilops tauschii; ppt, Physcomitrella patens and pab, Picea abies. (B) mch-miR166b-3p aligned with CLUSTAL W. (C) mch-miR166b-5p aligned with CLUSTAL W.

Fig. 11. Conservation and phylogenetic analysis of mch-mir168 with 32 other plant species. (A) Phylogenetic tree of the pre-miRNAs of mchmir168 with other plant species having mir168. zma, Zea mays; ssp, saccharum spontaneum; sof, Saccharum officinarum; sbi, Sorghum bicolor; bdi, Brachypodium distachyon; hvu, Hordeum vulgare; ata, Aegilops tauschii; osa, Oryza sativa; atr, Amborella trichopoda; gma, Glycine max; vun, Vigna unguiculata; mtr, Medicago truncatula; ath, Arabidopsis thaliana; aly, Arabidopsis lyrata; tcc, Theobroma cacao; nta, Nicotiana tabacum; sly, Solanum lycopersicum; mes, Manihot esculenta; ptc, Populus trichocarpa; bna, Brassica napus; bra, Brassica rapa; rco, Ricinus communis; ccl, Citrus clementina; crt, Citrus reticulate; mdm, Malus domestica; ppe, Prunus persica; vvi, Vitis vinifera; aau, Acacia auriculiformis; lus, Linum usitatissimum; cca, Cynara cardunculus; aqc, Aquilegia caerulea; cme, Cucumis melo and mch, Momordica charantia. (B) mch-miR168 aligned with CLUSTAL W.

Fig. 12. Conservation and phylogenetic analysis of mch-mir396a with 27 other plant species. (A) Phylogenetic tree of the pre-miRNAs of mchmir396a with other plant species having mir396a. ath, Arabidopsis thaliana; aly, Arabidopsis lyrata; ptc, Populus trichocarpa; sly, Solanum lycopersicum; mes, Manihot esculenta; aqc, Aquilegia caerulea; bgy, Bruguiera gymnorhiza; bcy, Bruguiera cylindrical; gma, Glycine max; ghr, Gossypium hirsutum; nta, Nicotiana tabacum; sbi, Sorghum bicolor; mdm, Malus domestica; csi, Citrus sinensis; lus, Linum usitatissimum; ppe, Prunus persica; mch, Momordica charantia; zma, Zea mays; cca, Cynara cardunculus; osa, Oryza sativa; vvi, Vitis vinifera; pab, Picea abies;

hbr, Hevea brasiliensis; bna, Brassica napus; mtr, Medicago truncatula; cme, Cucumis melo; tcc, Theobroma cacao; atr, Amborella trichopoda; bdi, Brachypodium distachyon and ata, Aegilops tauschii. (B) mch-miR396a-5p aligned with CLUSTAL W. (C) mch-miR396a-3p aligned with CLUSTAL W.

Fig. 13. Conservation and phylogenetic analysis of mch-mir2111a with 11 other plant species. A. Phylogenetic tree of the pre-miRNAs of mchmir2111a with other plant species having mir2111a. bna, Brassica napus; bra, Brassica rapa; aly, Arabidopsis lyrata; ath, Arabidopsis thaliana; ppe, Prunus persica; cme, Cucumis melo; mch, Momordica charantia; gma, Glycine max; ptc, Populus trichocarpa; mdm, Malus domestica; mes, Manihot esculenta and mtr, Medicago truncatula. B. mch-miR2111a-5p aligned with CLUSTAL W. C. mch-miR2111a-3p aligned with CLUSTAL W.

Fig 1 .

Fig 10 .

Fig 11 .

Fig 12 .

Fig 13 .

Fig 2 .

Fig 3 .

Fig 4 .

Fig 5 .

Fig 6 .

Fig 7 .

Fig 8 .

Fig 9 .

Graphical .

Table 1

Sl. No 1.

M.charantia miRNA mch-miR156d

Source miRNA

2.

mch-miR156g

cme-miR156g

3.

mch-miR159a

cme-miR159a

4.

mch-miR160a

cme-miR160a

5.

mch-miR162

cme-miR162

6.

mch-miR164d

cme-miR164d

7.

mch-miR166b-3p

cme-miR166b

8.

mch-miR166b-5p

ath-miR166b-5p

9.

mch-miR166h

cme-miR166h

10.

mch-miR166i

cme-miR166i

11.

mch-miR167b

cme-miR167b

12.

mch-miR167c

cme-miR167c

13.

mch-miR167d

ath-miR167d

cme-miR156d

Source organism Cucumis melo Cucumis melo Cucumis melo Cucumis melo Cucumis melo Cucumis melo Cucumis melo Arabidops is thaliana Cucumis melo Cucumis melo Cucumis melo Cucumis melo Arabidops is thaliana

PL

MS

ME

ST

Strand

A+U %

100

MFE ∆G -54.70

UGACAGAAGAGAGUGAGCAC

20/20

5’

50.00

104

-53.60

UGACAGAAAGAGAGAAAGCAC

21/18

5’

57.14

190

-64.80

UUUGGAUUGAAGGGAGCUCUA

21/21

3’

57.14

89

-47.40

UGCCUGGCUCCCUGUAUGCCA

21/21

5’

40.00

103

-33.80

UCGAUAAACCUCUGCAUCCAG

21/21

5’

52.38

102

-54.40

UGGAGAAGCAGGGCACGUGCA

21/21

5’

40.00

102

-32.90

UCGGACCAGGCUUCAUUCCCC

21/21

3’

40.00

102

-32.90

GGAAUGUUGUCUGGCUCGAGG

20/21

5’

40.00

125

-39.00

UCGGACCAGGCUUCAUUCCCC

21/21

3’

40.00

90

-46.00

UCGGACCAGGCUUCAUUCCC

20/19

3’

40.00

93

-34.40

UGAAGCUGCCAGCAUGAUCUA

21/21

5’

52.38

105

-36.00

UGAAGCUGCCAGCAUGAUCUU

21/21

5’

52.38

168

-53.40

UGAAGCUGCCAGCAUGAUCUG G

22/22

GANF0 1006197 GANF0 1007314 GANF0 1004092 GANG0 1014655 GANF0 1020987 GANF0 1038540 GANF0 1003781 GANF0 1003781 GANF0 1050753 GANF0 1024617 GANF0 1026116 GANF0 1052609 GANF0 1051440

5’

45.45

PL = Pre-miRNA Length, MEF = Minimal Free Energy, MS = Mature sequence, ME = Match Extent, ST = Source Transcript

Table 1continues ………….. Sl. No 14.

M.charantia miRNA mch-miR168

Source miRNA cme-miR168

Source organism Cucumis melo

PL

MS

ME

ST

Strand

A+U %

202

MFE ∆G -61.30

UCGCUUGGUGCAGGUCGGGA

20/20

5’

40.00

Cucumis melo

98

-41.20

UUGAGCCGUGCCAAUAUCACG

21/21

3’

47.62

cme-miR172b

Cucumis melo

110

-45.40

AGAAUCUUGAUGAUGCUGCAU

21/21

3’

61.90

mch-miR319d

cme-miR319d

Cucumis melo

209

-73.20

UUGGACUGAAGGGAGCUCCU

20/20

3’

45.00

18.

mch-miR390b

cme-miR390b

Cucumis melo

145

-60.63

AAGCUCAGGAGGGAUAGCGCC

21/21

5’

40.00

19.

mch-miR394

bdi-miR394

150

-60.60

UUGGCAUUCUGUCCACCUCC

20/20

5’

45.00

20.

mch-miR396a-5p

cme-miR396a

Brachypodiu m distachyon Cucumis melo

117

-49.40

UUCCACAGCUUUCUUGAACUU

21/21

5’

61.90

21.

mch-miR396a-3p

-49.40

GCUCAAGAAAGCUGUGGGACA

21/20

3’

61.90

mch-miR399d

Medicago truncatula Cucumis melo

117

22.

mtr-miR396a3p cme-miR399d

95

-36.30

UGCCAAAGGAGAGUUGCCCUC

21/20

3’

42.86

23.

mch-miR529

aqc-miR529

128

-53.60

AGAAGAGAGAGAGCACAACCC

21/21

5’

47.62

24.

mch-miR2018

tae-miR2018

77

-18.60

GCCCGUCUAGCUCAGUUGGU

20/20

3’

40.00

25.

mch-miR2111a5p mch-miR2111a3p mch-miR2915

cmemiR2111a athmiR2111a-3p peu-miR2915

Aquilegia caerulea Triticum aestivum Cucumis melo

99

-40.40

UAAUCUGCAUCCUGAGGUUUA

21/21

5’

61.90

Arabidopsis thaliana Populus euphratica

99

-40.40

GCCCUCGGGUUGCAGAUUACC

21/18

3’

61.90

116

-18.80

CCCGUCUAGCUCAGUUGGUA

20/20

GANF0 1008861 GANG0 1022768 GANF0 1003620 GANF0 1037286 GANF0 1037975 GANF0 1044860 GANF0 1037616 GANF0 1037616 GANF0 1053935 GANF0 1010940 GANF0 1052263 GANF0 1015331 GANF0 1015331 GANF0 1052263

15.

mch-miR171d

cme-miR171d

16.

mch-miR172b

17.

3’

45.00

26. 27

PL = Pre-miRNA Length, MEF = Minimal Free Energy, MS = Mature sequence, ME = Match Extent, ST = Source Transcript

Table 2 Conservation chart of the identified M.charantia miRNAs among diverged plant species Sl. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Plant Species Acacia auriculiformis (aau) Aegilops tauschii (ata) Amborella trichopoda (atr) Aquilegia caerulea (aqc) Arabidopsis lyrata (aly) Arabidopsis thaliana (ath) Brachypodium distachyon (bdi) Brassica napus (bna) Brassica rapa (bra) Bruguiera cylindrica (bcy) Bruguiera gymnorhiza (bgy) Carica papaya (cpa) Citrus clementina (ccl) Citrus reticulata (crt) Citrus sinensis (csi) Cucumis melo (cme) Cunninghamia lanceolata (cln) Cynara cardunculus (cca) Digitalis purpurea (dpr) Festuca arundinacea (far) Glycine max (gma) Gossypium hirsutum (ghr) Gossypium raimondii (gra) Helianthus annuus (han) Helianthus exilis (hex) Helianthus petiolaris (hpe) Helianthus tuberosus (htu) Hevea brasiliensis (hbr) Hordeum vulgare (hvu) linum usitatissimum (lus) Lotus japonicus (lja) Malus domestica (mdm) Manihot esculenta (mes) Medicago truncatula (mtr) Momordica charantia (mch) Nicotiana tabacum (nta) Oryza sativa (osa) Phaseolus vulgaris (pvu) Physcomitrella patens (ppt) Picea abies (pab) Pinus densata (pde) Pinus taeda (pta) Populus euphratica (peu) Populus trichocarpa (ptc) Prunus persica (ppe) Ricinus communis (rco) Saccharum officinarum (sof) saccharum spontaneum (ssp) Salvia sclarea (ssl) Selaginella moellendorffii (smo) Solanum lycopersicum (sly) Solanum tuberosum (stu) Sorghum bicolor (sbi) Theobroma cacao (tcc) Triticum aestivum (tae) Vigna unguiculata (vun) Vitis vinifera (vvi) Zea mays (zma)

156d

156g

159a

160a

162

164d

miRNA 166b 166h

166i

167b

167c

167d

168

Table 2 continues …………… Sl. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Plant Species Acacia auriculiformis (aau) Aegilops tauschii (ata) Amborella trichopoda (atr) Aquilegia caerulea (aqc) Arabidopsis lyrata (aly) Arabidopsis thaliana (ath) Brachypodium distachyon (bdi) Brassica napus (bna) Brassica rapa (bra) Bruguiera cylindrica (bcy) Bruguiera gymnorhiza (bgy) Carica papaya (cpa) Citrus clementina (ccl) Citrus reticulata (crt) Citrus sinensis (csi) Cucumis melo (cme) Cunninghamia lanceolata (cln) Cynara cardunculus (cca) Digitalis purpurea (dpr) Festuca arundinacea (far) Glycine max (gma) Gossypium hirsutum (ghr) Gossypium raimondii (gra) Helianthus annuus (han) Helianthus exilis (hex) Helianthus petiolaris (hpe) Helianthus tuberosus (htu) Hevea brasiliensis (hbr) Hordeum vulgare (hvu) linum usitatissimum (lus) Lotus japonicus (lja) Malus domestica (mdm) Manihot esculenta (mes) Medicago truncatula (mtr) Momordica charantia (mch) Nicotiana tabacum (nta) Oryza sativa (osa) Phaseolus vulgaris (pvu) Physcomitrella patens (ppt) Picea abies (pab) Pinus densata (pde) Pinus taeda (pta) Populus euphratica (peu) Populus trichocarpa (ptr) (ptc) Prunus persica (ppe) Ricinus communis (rco) Saccharum officinarum (sof) saccharum spontaneum (ssp) Salvia sclarea (ssl) Selaginella moellendorffii (smo) Solanum lycopersicum (sly) Solanum tuberosum (stu) Sorghum bicolor (sbi) Theobroma cacao (tcc) Triticum aestivum (tae) Vigna unguiculata (vun) Vitis vinifera (vvi) Zea mays (zma)

171d

172b

319d

390b

394

miRNA 396a 399d

529

2111a

2018

2915

Table 3

Sl. No 1

M.charantia miRNA mch-miR156d

Expectati on 0.0

Target protein

2

mch-miR156g

3

mch-miR159a

Functions of target proteins

Squamosa promoter-binding-like protein

PsRNATarget Acc. No. Csa1M015680.1

2.0

Beta-galactosidase

Csa5M623820.1

3.0

Early nodulin-like protein

Csa4M632110.1

3.0

14 kDa proline-rich protein

Csa5M161900.1

Senescence and fruit ripening (Figueiredo et al., 2011) Cellular transport, host-bacterial interaction and plant development (Denance et al., 2014) Root growth (Choi et al., 1996)

1.0

Transcription factor MYB29

Csa4M022940.1

Biotic stress management (Sonderby et al., 2010)

2.5

Cell wall protein RBR3

Csa4M628340.2

2.5

Mannan endo-1,4-beta-mannosidase

Csa6M405340.1

Plant development ( Desvoyes et al., 2014; CruzRamirez et al., 2012) Fruit ripening (Wang et al., 2014)

2.5

Benzyl alcohol O-benzoyltransferase

Csa2M429010.1

4

mch-miR160a

0.0

Auxin response factor

Csa6M405890.1

5

mch-miR162

2.0

Endoribonuclease Dicer

Csa3M116650.1

3.0

Isoflavone 2'-hydroxylase

Csa4M642290.1

1.0

NAC domain-containing protein

Csa3M824990.1

6

mch-miR164d

Plant development (Yu et al., 2012)

Expressed in response to biotic stress (D’Auria et al., 2002) Seed germination and post-embryonic developmental programs; root development and growth (Liu et al., 2007) Homeostasis and feedback regulation of miRNA activity (Xie et al., 2003) Synthesis of antimicrobial isoflavonoid (Akashi et al., 1998) Plant development and abiotic stress tolerance (Fang et al., 2014)

Sl. No 12

M.charantia miRNA mch- miR390b

Expecta tion 2.5 2.5 3.0 1.0 1.5 3.0 3.0

13

mch- miR394a

14

mch- miR396a

3.0

15

mch- miR399d

3.0 3.0

17

mch- miR2111a 0.0

18

mch- miR2915

3.0

Target protein

PsRNATarget Acc. Molecular Function of target protein No. Leucine-rich repeat receptor-like Csa4M166920.1 Signal transduction related to plant development tyrosine-protein kinase and defense against pathogen (Gou et al., 2010) Kinesin-related protein Csa2M354040.1 Cell division (Lee et al., 2001) Cytokinin dehydrogenase Csa5M175820.1 Catabolism of cytokinin (Mrizova et al., 2013) F-box only protein Csa6M087700.2 Protein degradation (Jain et al., 2007) Methyltransferase Csa5M184300.1 Plant development ( Finnegan et al., 1996) Peptide chain release factor 1 Csa7M394660.1 Translation (Frolov et al., 2000) Pentatricopeptide repeat-containing Csa3M126180.1 RNA processing (Yagi et al., 2013) protein Transcription factor MYB3 Csa4M645310.1 Plant development and defense response (Yanhui et al., 2006) Methylthioribose-1-phosphate isomerase Csa1M597100.1 Unknown Laccase Csa3M734150.1 Copper homeostasis, response to water deprivation and cell wall biogenesis F-box/kelch-repeat protein Csa3M586950.1 Induced under root-knot nematode infection (Curtis et al., 2013) protein translocase subunit SECA1

Csa5M585420.1

Intracellular protein transport (Werhahn et al., 2001)