- Email: [email protected]
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing Kulvinder K. Gill, Aleksandra Leligdowicz, Ma Luo, Thomas Bielawny, Robert Brunham, and Francis A. Plummer ABSTRACT: We report here four novel human leukocyte antigen (HLA)–A alleles identified among an East African population during sequence-based HLA-A typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products and by molecular cloning and sequencing multiple clones. The new allele A*9202 is identical to A*0202 at exon 2 and exon From the Department of Medical Microbiology, University of Manitoba, Winnipeg, Manitoba, Canada (K.K.G., A.L., M.L, T.B., F.A.P.); the National Microbiology Laboratory, Winnipeg, Manitoba, Canada (M.L., F.A.P.); and BCCDC, Vancouver, British Columbia, Canada (R.B.). Address reprint requests to: Dr. Ma Luo, Department of Medical Microbiology, University of Manitoba, 730 William Avenue, Winnipeg, Manitoba Canada R3E 0W3, ; Fax: (204) 789-3926 E-mail: mluo@cc. umanitoba.ca The names listed for the sequences have been officially assigned by the WHO Nomenclature Committee. This follows the agreed policy that, subject to the conditions stated in the most recent Nomenclature Report [1], names will be assigned to new sequences as they are identified. Lists of such new names will be published in the following WHO Nomenclature Report. Received May 12, 2006; revised June 26, 2006; accepted July 11, 2006.
Human leukocyte antigen (HLA) is the most polymorphic genetic system known in humans. Among HLA loci, HLA-A is the second most polymorphic locus with 429 HLA-A alleles reported in the latest ImMunoGeneTics (IMGT)/HLA database [1]. As the “origin of humanity,” Africa is the most genetically diverse region of the world. A large number of HLA alleles have been identified, and many novel alleles have been reported in the African population [2, 3]. During sequence-based HLA-A typing of an East African population, we identified four novel HLA-A alleles. In this study, we describe the identification, cloning, and sequencing of these four novel alleles. Genomic DNA was prepared from peripheral blood mononuclear cells (PBMCs) using a QIAamp DNA Mini Kit (QIAGEN Inc., Mississauga, Ontario, Canada). Exon 2, intron 2, and exon 3 were amplified for HLA-A genes Human Immunology 67, 833– 838 (2006) © American Society for Histocompatibility and Immunogenetics, 2006 Published by Elsevier Inc.
3 except for a single nucleotide difference at codon 43 (CGG¡CAG), resulting in a coding change from Arginine to Glutamine. The second new allele has a synonymous change at codon 139 (GCA¡GCG), that differentiates it from A*680101. The new allele has been named by the World Health Organization nomenclature committee as A*680105. The novel allele A*2630 is identical to A*2603 at exon 2 and exon 3 except for a nonsynonymous change at codon 90 (GAC¡GCC), changed from Aspartic acid to Alanine. The fourth new allele is identical to A*290201 except for a single nucleotide difference at codon 138 (ATG¡GTG), resulting in a coding change from Methionine to Valine. The new allele has been named by the World Health Organization nomenclature committee as A*2915. Identification of these novel HLA-A alleles reflects the genetic diversity of this East African population. Human Immunology 67, 833– 838 (2006). © American Society for Histocompatibility and Immunogenetics, 2006. Published by Elsevier Inc. KEYWORDS: A*2630; A*2915; A*680105; A*9202; SBT; TBSA; HLA-A
using primers from Cereb et al. [4, 5] by polymerase chain reaction (PCR).The resulting PCR product was purified using Amicon Microcon-PCR Centrifugal filter device (Millipore, Bedford, MA). The purified PCR products were sequenced with gene-specific primers [3] using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits (Applied Biosystems, Foster City, CA). The sequence was analyzed with ABI3100 Genetic Analyzer (Applied Biosystems). HLA-A alleles were typed with computer software, CodonExpress, developed based on a taxonomy-based sequence analysis [6, 7]. The A*9202 allele was identified in a woman from Bukoba, Tanzania. The patient was typed as A*0202 and A*new for a nucleotide difference at codon 43(CGG¡CAG), resulting in a coding change from Arginine to Glutamine (Figure 1). HLA-A was ream0198-8859/06/$–see front matter doi:10.1016/j.humimm.2006.07.007
834
A*9202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*9202 A*9202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202
K.K. Gill et al.
Intron 1 CGGGCCCGCCTGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCTCAGC CACTCCTCGTCCCCAG 5 10 15 GC TCT CAC TCC ATG AGG TAT TTC TTC ACA TCC GTG TCC CGG CCC GGC CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 GGG GAG CCC CGC TTC ATC GCA GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 CGG TTC GAC AGC GAC GCC GCG AGC CGG AGG ATG GAG CCG CGG GCG CCG TGG --- --- --- --- --- --- --- --- -A- --- --- --- --- --- --- --- --55 60 65 ATA GAG CAG GAG GGT CCG GAG TAT TGG GAC GGG GAG ACA CGG AAA GTG AAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 85 GCC CAC TCA CAG ACT CAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --90 AAC CAG AGC GAG GCC G Intron 2 --- --- --- --- --- - GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCTCTCATCCCCCACG GACGGGCCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCTTGC CCCGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCAGGTTGGTC GGGGCGGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGTCCGGGCCAG GT TCT CAC ACC -- --- --- --110 CGC TTC CTC CGC --- --- --- --125 GCC CTG AAA GAG --- --- --- ---
95 100 CTC CAG AGG ATG TAT GGC --- --- --- --- --- --115 GGG TAC CAC CAG TAC GCC --- --- --- --- --- --130 GAC CTG CGC TCT TGG ACC --- --- --- --- --- ---
TGC GAC GTG GGG --- --- --- --120 TAC GAC GGC AAG --- --- --- --135 GCG GCG GAC ATG --- --- --- ---
105 TCG GAC TGG --- --- --GAT TAC ATC --- --- --140 GCA GCT CAG --- --- ---
A*0202 ACC ACC AAG CAC AAG TGG GAG GCG GCC CAT GTG GCG GAG CAG TTG AGA GCC A*9202 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --A*0202 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG A*9202 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --A*0202 AAG GAG ACG CTG CAG CGC ACG G Intron 3 A*9202 --- --- --- --- --- --- --- - GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTA A*9202 GATCTCCCGGGCTGGCCTCCCACAAG
FIGURE 1 Alignment of nucleotide sequences of the new HLA-A allele, A*9202, with A*0202. The Genbank accession number for the new allele is DQ494174. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
plified, and the PCR products were cloned with TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 38 clones sequenced, 21 clones were typed as A*0202 and 17 clones were typed as A*new with a new sequence of CAG at codon 43 (Figure 1). The new HLA-A allele was designated as A*9202 by the World Health Organization (WHO) Nomenclature Commit-
tee (see footnote). The HLA-B alleles of this individual are B*1516 and B*5802, and the HLA-C alleles are Cw*0602 and Cw*140201. The class II alleles of this woman are: DRB1*080401, DRB1*130201, DRB3*030101, DPA1*0301, DPA1*010301, DPB1*020102, DPB1*0402, DQA1*020101, DQA1*040101, DQB1*0401, and DQB1*060401.
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing
835
intron 1 A*680105 GGGGCCCGCCCGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCTGGAGGAGGGTCGGGCGGGTCTCAG A*680105 TCACTCCTCGCCCCCAG 5 10 15 A*680101 GC TCC CAC TCC ATG AGG TAT TTC TAC ACC TCC GTG TCC CGG CCC GGC CGC A*680105 -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 A*680101 GGG GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 A*680101 CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG TGG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 A*680101 ATA GAG CAG GAG GGG CCG GAG TAT TGG GAC CGG AAC ACA CGG AAT GTG AAG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 85 A*680101 GCC CAG TCA CAG ACT GAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --90 A*680101 AAC CAG AGC GAG GCC G intron 2 A*680105 --- --- --- --- --- -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCATCCCCCAC A*680105 GGACGGGCCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCT A*680105 TGCCCCGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGT A*680105 TGGTCGGGGCGGGGCGGGGCTCGGGGGACCGGGCTGACCTCGGGGTCCGGGCCAG 95 100 105 A*680101 GT TCT CAC ACC ATC CAG ATG ATG TAT GGC TGC GAC GTG GGG TCG GAC GGG A*680105 -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 A*680101 CGC TTC CTC CGC GGG TAC CGG CAG GAC GCC TAC GAC GGC AAG GAT TAC ATC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --125 130 135 140 A*680101 GCC CTG AAA GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCA GCT CAG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --G --- --145 150 155 A*680101 ACC ACC AAG CAC AAG TGG GAG GCG GCC CAT GTG GCG GAG CAG TGG AGA GCC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --160 165 170 175 A*680101 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --180 A*680101 AAG GAG ACG CTG CAG CGC ACG G intron 3 A*680105 --- --- --- --- --- --- --- -GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTA A*680105 GATCTCCCGGGCTGGCCTCCCACAAG
FIGURE 2 Alignment of nucleotide sequences of the new HLA-A allele, A*680105, with A*680101. The Genbank accession number for the new allele is DQ494175. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
A*9202 was identified also in another woman from the same region. The class I alleles of this woman are: A*9202, A*03010101, B*1516, B*5801, Cw*1408, and Cw*030201. The class II alleles of this woman are: DRB1*080401, DRB1*130201, DRB3*030101, DQA1*020101, DQA1*040101, DQB1*0401, DQB1*060401, DPA1*0301, DPA1*010301,
DPB1*020102, and DPB1*0402. The allele frequency of HLA-A*0202 in this east African population is 5.56%. The new allele A*9202 is likely the result of a point mutation at codon 43 from A*0202. Since codon 43 is in the alpha 1 chain of the class I molecule and likely involved in antigen recognition [8], the change from a positively charged Arginine to a negatively
836
A*2630 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2630 A*2630 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2630
K.K. Gill et al.
Intron 1 GGGGCCCGCCCGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCTGGAGGAGGGTCGGGCGGGTCTCAGCCA CTCCTCGCCCCCAG 5 10 15 GC TCC CAC TCC ATG AGG TAT TTC TAC ACC TCC GTG TCC CGG CCC GGC CGC GGG -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 35 GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG CGG TTC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --40 45 50 GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG TGG ATA GAG CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 70 GAG GGG CCG GAG TAT TGG GAC CGG AAC ACA CGG AAT GTG AAG GCC CAC TCA CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --75 80 85 90 ACT CAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC AAC CAG AGC GAG GAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -CG intron 2 -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCATCCCCCACGGACGGGCCAGGTCGCCCACAG TCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCTTGCCCCGGGAGAGGCCCAGGCGCC TTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCGGGGCGGGGCTCGGGG GACCGGGCTGACCTCGGGGTCCGGGCCAG 95 100 105 GT TCT CAC ACC ATC CAG AGG ATG TAT GGC TGC GAC GTG GGG CCG GAC GGG CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 125 TTC CTC CGC GGG TAC CAG CAG GAC GCT TAC GAC GGC AAG GAT TAC ATC GCC CTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --130 135 140 AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCG GCT CAG ATC ACC CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --145 150 155 160 CGC AAG TGG GAG ACG GCC CAT GAG GCG GAG CAG TGG AGA GCC TAC CTG GAG GGC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --165 170 175 180 CGG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG AAG GAG ACG CTG CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --182 CGC ACG G intron 3 --- --- -GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTAGATCTCCCGGGCTGGCCTCCCACA AG
FIGURE 3 Alignment of nucleotide sequences of the new HLA-A allele, A*, [3] with A*2603. The Genbank accession number for the new allele is DQ494176. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
charged Glutamine potentially could affect antigen binding. The fact that the A*9202 is identified in two unrelated women from the same region suggests that the mutation might be maintained in the population either through its functional difference or through linkage with nearby genes. The antigen-binding properties of A*9202 will need to be clarified through functional studies. The A*680105 was identified from a woman from Uganda. The patient was typed as A*3009 and
A*680101 except for a single nucleotide change at codon 139 (GCA¡GCG) (Figure 2), resulting in a synonymous mutation. To determine which allele carries the new codons, HLA-A was reamplified and the PCR products were cloned with the TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 18 clones sequenced, 8 clones were typed as A*3009 and the other 10 clones were typed as A*680101 with a new sequence at codon 139 (GCG) (Figure 2). The new HLA-A allele was designated as A*680105 by the WHO Nomenclature Committee
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing
A*2915 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*2915 A*2915 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*2915
837
intron 1 GGGGCCCGCCCGGCGGGGACGCAGGACCCGGGTAGCCGCGCCGGGAGGAGGGTCGGGTGGGTCTCAG CCACTCCTCGCCCCAG 5 10 15 GC TCC CAC TCC ATG AGG TAT TTC ACC ACA TCC GTG TCC CGG CCC GGC CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 GGG GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 CGG TTT GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCA CCG TGG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 ATA GAG CAG GAG GGG CCG GAG TAT TGG GAC CTG CAG ACA CGG AAT GTG AAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 90 GCC CAG TCA CAG ACT GAC CGA GCG AAC CTG GGG ACC CTG CGC GGC TAC TAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --G intron 2 -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCTCTCATCCCCCACGGACGGGCCGGGTCGCCCA CAGTCTCCGGGTCCGAGATCCACCCCGAAGCCGCGGGACCCCGAGACCCTTGCCCCGGGAGAGGCCCA GGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCCGGACGG GGCTCGGGGGACTGGGCTGACCGTGGGGTCGGGGCCAG 95 100 105 GT TCT CAC ACC ATC CAG ATG ATG TAT GGC TGC GAC GTG GGG TCG GAC GGG -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 CGC TTC CTC CGC GGG TAC CGG CAG GAC GCC TAC GAC GGC AAG GAT TAC ATC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --125 130 135 140 GCC TTG AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCG GCT CAG --- --- --- --- --- --- --- --- --- --- --- --- --- G-- --- --- --145 150 155 ATC ACC CAG CGC AAG TGG GAG GCG GCC CGT GTG GCG GAG CAG TTG AGA GCC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --160 165 170 180 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --182 CGC ACG G intron 3 --- --- -GTACCGGGGGCCACGGGGCGCCTCCCTGATCGCCTGTAGATCTCCCGGGCTGGCCTCCC ACAAG
FIGURE 4 Alignment of nucleotide sequences of the new HLA-A allele, A*2915, with A*290201. The Genbank accession number for the new allele is DQ494177. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
(see footnote). The HLA-B alleles of this individual are B*1503 and B*4501, and the HLA-C alleles are Cw*070101 and Cw*0802. The class II alleles of this woman are DRB1*090102, DRB1*030101, DRB3*020201, DQB1*0201, DQB1*0201, DPA1*010301, DPA1*020101, DPB1*010101, and DPB1*0601. The allele frequency of A*680101 in this East African population is 1.1%, and the A*680105 is
likely the result of a point mutation at codon 139 of A*680101. Since there is no coding change, the serologic property of A*680105 should be similar to A*680101. The A*2630 was identified from a woman from Machakos, Kenya. The patient was typed as A*0240 and A*2603 except for a nonsynonymous change at codon 90 (GAC¡GCC), resulting in a coding change from Aspartic acid to Alanine (Figure 3). To confirm the change,
838
HLA-A was reamplified and the PCR products were cloned with the TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 30 clones sequenced, 17 clones were typed as A*0240 and the other 13 clones were typed as A*2603, except for a single nucleotide change at codon 90. The new HLA-A allele was designated as A*2630 by the WHO Nomenclature Committee (see footnote). Other class I alleles of this individual are B*4102, B*4703, Cw*070101, and Cw*1701. The class II alleles of this woman are DRB1*030101, DRB1*030201, DRB3*010101, DRB3*020201, DQA1*040101, DQA1*0504, DQB1*0201, DQB1*0402, DPA1*020202, DPA1*010301. A*2630 is possibly the result of a point mutation from A*2603. Both alleles are rare in this population with frequencies of 0.05% for A*2630 and 0.1% for A*2603. Since codon 90 is next to the identified serologic epitope codon 89 [8], the change from a hydrophilic Aspartic acid to a neutral Alanine might influence the serologic property. The A*2915 allele was identified in a woman from Kericho, Kenya. The patient was typed as A*02010101 and A*290201, except for a single nucleotide difference at codon 138 (ATG¡ GTG), resulting in a coding change from Methionine to Valine (Figure 4). To determine which allele carries the new codon, HLA-A was reamplified and the PCR products were cloned with TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 30 clones sequenced, 21 clones were typed as A*02010101 and 9 clones were typed as A*290201, except that all of the 9 clones have the new sequence “GTG” at codon 138 instead of “ATG ” (Figure 4). The new HLA-A allele was designated as A*2915 by the WHO Nomenclature Committee (see footnote). The HLA-B alleles of this individual are B*4202 and B*5801, and the HLA-C alleles are Cw*0602 and Cw*1701. The class II alleles of this woman are DRB1*08, DRB1*1503, DRB5*010101, DQA1*010201, DQA1*010101, DQB1*0201, DQB1*050101, DPA1*020101, DPA1*010301. DPB1*010101, and DPB1*0401. The A*2915 is likely the result of a point mutation from A*290201, the allele with a frequency at 3.8% in this population. In the current database A*2915 is the only A*29 allele that has a Valine at codon 138 [9]. The influence of the change on the antigen-binding properties will need to be clarified through functional studies. The identification of the four novel HLA-A alleles from this Kenyan population further demonstrates the genetic diversity of this East African population. With
K.K. Gill et al.
high resolution sequence-based typing, more novel alleles are expected to be identified in this population. ACKNOWLEDGMENT The research was funded by grants from the Canadian Institutes of Health Research (#HOP-43135) and National Institutes of Health (#RO1 A1 49383). Dr. F. Plummer was a Canadian Institutes of Health Research Senior Investigator and is currently a Tier I CIHR Canada Research Chair.
REFERENCES 1. Robinson J, Waller MJ, Parham P, de Groot N, Bontrop R, Kennedy LJ, Stoehr P, Marsh SGE: IMGT/HLA and IMGT/MHC: sequence databases for the study of the major histocompatibility complex. Nucleic Acids Res 31:311, 2003. 2. Ellis JM, Mack SJ, Leke RF, Quakyi I, Johnson AH, Hurley CK: Diversity is demonstrated in class I HLA-A and HLA-B alleles in Cameroon, Africa: description of HLAA*03012, *2612, *3006 and HLA-B*1403, *4016, *4703. Tissue Antigens 56:291, 2000. 3. Luo M, Embree J, Ramdahin S, Ndinya-Achola J, Njenga S, Bwayo JB, Pan S, Mao X, Cheang M, Stuart T, Brunham RC, Plummer FA: HLA-A and HLA-A in Kenya, Africa: allele frequencies and identification of HLA-B*1567 and HLA-B*4426. Tissue Antigens 59:370, 2002. 4. Cereb N, Kong Y, Lee S, Maye P, Yang SY: Nucleotide sequences of MHC class I introns 1, 2, and 3 in humans and intron 2 in nonhuman primates. Tissue Antigens 47:498, 1996. 5. Cereb N, Maye P, Lee S, Kong Y, Yang SY: Locus-specific amplification of HLA class I genes from genomic DNA: locus-specific sequences in the first and third introns of HLA-A, -B, and -C alleles. Tissue Antigens 45:1, 1995. 6. Luo M, Blanchard J, Pan Y, Brunham K, Brunham RC: High-resolution sequence typing of HLA-DQA1 and -DQB1 exon 2 DNA with taxonomy-based sequence analysis (TBSA) allele assignment. Tissue Antigens 54:69, 1999. 7. Luo M, Blanchard J, Brunham B, Pan Y, Shen C, Lu H and Brunham RC: Two-step, high resolution sequence-based HLA-DRB typing of exon 2 DNA with taxonomy-based sequence analysis (TBSA) allele assignment. Human Immunol. 62:1294, 2001. 8. Bjorkman PJ, Saper MA, Samraoui B, Bennett WS, Strominger JL, Wiley DC: The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens Nature. 329:512, 1987. 9. IMGT/HLA database, Release 2.13.0. Accessed July 4, 2006. Available from: http://www.ebi.ac.uk/imgt/hla/citations.html.
Human leukocyte antigen (HLA) is the most polymorphic genetic system known in humans. Among HLA loci, HLA-A is the second most polymorphic locus with 429 HLA-A alleles reported in the latest ImMunoGeneTics (IMGT)/HLA database [1]. As the “origin of humanity,” Africa is the most genetically diverse region of the world. A large number of HLA alleles have been identified, and many novel alleles have been reported in the African population [2, 3]. During sequence-based HLA-A typing of an East African population, we identified four novel HLA-A alleles. In this study, we describe the identification, cloning, and sequencing of these four novel alleles. Genomic DNA was prepared from peripheral blood mononuclear cells (PBMCs) using a QIAamp DNA Mini Kit (QIAGEN Inc., Mississauga, Ontario, Canada). Exon 2, intron 2, and exon 3 were amplified for HLA-A genes Human Immunology 67, 833– 838 (2006) © American Society for Histocompatibility and Immunogenetics, 2006 Published by Elsevier Inc.
3 except for a single nucleotide difference at codon 43 (CGG¡CAG), resulting in a coding change from Arginine to Glutamine. The second new allele has a synonymous change at codon 139 (GCA¡GCG), that differentiates it from A*680101. The new allele has been named by the World Health Organization nomenclature committee as A*680105. The novel allele A*2630 is identical to A*2603 at exon 2 and exon 3 except for a nonsynonymous change at codon 90 (GAC¡GCC), changed from Aspartic acid to Alanine. The fourth new allele is identical to A*290201 except for a single nucleotide difference at codon 138 (ATG¡GTG), resulting in a coding change from Methionine to Valine. The new allele has been named by the World Health Organization nomenclature committee as A*2915. Identification of these novel HLA-A alleles reflects the genetic diversity of this East African population. Human Immunology 67, 833– 838 (2006). © American Society for Histocompatibility and Immunogenetics, 2006. Published by Elsevier Inc. KEYWORDS: A*2630; A*2915; A*680105; A*9202; SBT; TBSA; HLA-A
using primers from Cereb et al. [4, 5] by polymerase chain reaction (PCR).The resulting PCR product was purified using Amicon Microcon-PCR Centrifugal filter device (Millipore, Bedford, MA). The purified PCR products were sequenced with gene-specific primers [3] using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits (Applied Biosystems, Foster City, CA). The sequence was analyzed with ABI3100 Genetic Analyzer (Applied Biosystems). HLA-A alleles were typed with computer software, CodonExpress, developed based on a taxonomy-based sequence analysis [6, 7]. The A*9202 allele was identified in a woman from Bukoba, Tanzania. The patient was typed as A*0202 and A*new for a nucleotide difference at codon 43(CGG¡CAG), resulting in a coding change from Arginine to Glutamine (Figure 1). HLA-A was ream0198-8859/06/$–see front matter doi:10.1016/j.humimm.2006.07.007
834
A*9202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202 A*9202 A*9202 A*9202 A*0202 A*9202 A*0202 A*9202 A*0202 A*9202
K.K. Gill et al.
Intron 1 CGGGCCCGCCTGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCTCAGC CACTCCTCGTCCCCAG 5 10 15 GC TCT CAC TCC ATG AGG TAT TTC TTC ACA TCC GTG TCC CGG CCC GGC CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 GGG GAG CCC CGC TTC ATC GCA GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 CGG TTC GAC AGC GAC GCC GCG AGC CGG AGG ATG GAG CCG CGG GCG CCG TGG --- --- --- --- --- --- --- --- -A- --- --- --- --- --- --- --- --55 60 65 ATA GAG CAG GAG GGT CCG GAG TAT TGG GAC GGG GAG ACA CGG AAA GTG AAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 85 GCC CAC TCA CAG ACT CAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --90 AAC CAG AGC GAG GCC G Intron 2 --- --- --- --- --- - GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCTCTCATCCCCCACG GACGGGCCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCTTGC CCCGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCAGGTTGGTC GGGGCGGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGTCCGGGCCAG GT TCT CAC ACC -- --- --- --110 CGC TTC CTC CGC --- --- --- --125 GCC CTG AAA GAG --- --- --- ---
95 100 CTC CAG AGG ATG TAT GGC --- --- --- --- --- --115 GGG TAC CAC CAG TAC GCC --- --- --- --- --- --130 GAC CTG CGC TCT TGG ACC --- --- --- --- --- ---
TGC GAC GTG GGG --- --- --- --120 TAC GAC GGC AAG --- --- --- --135 GCG GCG GAC ATG --- --- --- ---
105 TCG GAC TGG --- --- --GAT TAC ATC --- --- --140 GCA GCT CAG --- --- ---
A*0202 ACC ACC AAG CAC AAG TGG GAG GCG GCC CAT GTG GCG GAG CAG TTG AGA GCC A*9202 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --A*0202 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG A*9202 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --A*0202 AAG GAG ACG CTG CAG CGC ACG G Intron 3 A*9202 --- --- --- --- --- --- --- - GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTA A*9202 GATCTCCCGGGCTGGCCTCCCACAAG
FIGURE 1 Alignment of nucleotide sequences of the new HLA-A allele, A*9202, with A*0202. The Genbank accession number for the new allele is DQ494174. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
plified, and the PCR products were cloned with TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 38 clones sequenced, 21 clones were typed as A*0202 and 17 clones were typed as A*new with a new sequence of CAG at codon 43 (Figure 1). The new HLA-A allele was designated as A*9202 by the World Health Organization (WHO) Nomenclature Commit-
tee (see footnote). The HLA-B alleles of this individual are B*1516 and B*5802, and the HLA-C alleles are Cw*0602 and Cw*140201. The class II alleles of this woman are: DRB1*080401, DRB1*130201, DRB3*030101, DPA1*0301, DPA1*010301, DPB1*020102, DPB1*0402, DQA1*020101, DQA1*040101, DQB1*0401, and DQB1*060401.
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing
835
intron 1 A*680105 GGGGCCCGCCCGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCTGGAGGAGGGTCGGGCGGGTCTCAG A*680105 TCACTCCTCGCCCCCAG 5 10 15 A*680101 GC TCC CAC TCC ATG AGG TAT TTC TAC ACC TCC GTG TCC CGG CCC GGC CGC A*680105 -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 A*680101 GGG GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 A*680101 CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG TGG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 A*680101 ATA GAG CAG GAG GGG CCG GAG TAT TGG GAC CGG AAC ACA CGG AAT GTG AAG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 85 A*680101 GCC CAG TCA CAG ACT GAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --90 A*680101 AAC CAG AGC GAG GCC G intron 2 A*680105 --- --- --- --- --- -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCATCCCCCAC A*680105 GGACGGGCCAGGTCGCCCACAGTCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCT A*680105 TGCCCCGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGT A*680105 TGGTCGGGGCGGGGCGGGGCTCGGGGGACCGGGCTGACCTCGGGGTCCGGGCCAG 95 100 105 A*680101 GT TCT CAC ACC ATC CAG ATG ATG TAT GGC TGC GAC GTG GGG TCG GAC GGG A*680105 -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 A*680101 CGC TTC CTC CGC GGG TAC CGG CAG GAC GCC TAC GAC GGC AAG GAT TAC ATC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --125 130 135 140 A*680101 GCC CTG AAA GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCA GCT CAG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --G --- --145 150 155 A*680101 ACC ACC AAG CAC AAG TGG GAG GCG GCC CAT GTG GCG GAG CAG TGG AGA GCC A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --160 165 170 175 A*680101 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG A*680105 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --180 A*680101 AAG GAG ACG CTG CAG CGC ACG G intron 3 A*680105 --- --- --- --- --- --- --- -GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTA A*680105 GATCTCCCGGGCTGGCCTCCCACAAG
FIGURE 2 Alignment of nucleotide sequences of the new HLA-A allele, A*680105, with A*680101. The Genbank accession number for the new allele is DQ494175. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
A*9202 was identified also in another woman from the same region. The class I alleles of this woman are: A*9202, A*03010101, B*1516, B*5801, Cw*1408, and Cw*030201. The class II alleles of this woman are: DRB1*080401, DRB1*130201, DRB3*030101, DQA1*020101, DQA1*040101, DQB1*0401, DQB1*060401, DPA1*0301, DPA1*010301,
DPB1*020102, and DPB1*0402. The allele frequency of HLA-A*0202 in this east African population is 5.56%. The new allele A*9202 is likely the result of a point mutation at codon 43 from A*0202. Since codon 43 is in the alpha 1 chain of the class I molecule and likely involved in antigen recognition [8], the change from a positively charged Arginine to a negatively
836
A*2630 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2630 A*2630 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2603 A*2630 A*2630
K.K. Gill et al.
Intron 1 GGGGCCCGCCCGGCGGGGGCGCAGGACCCGGGAAGCCGCGCCTGGAGGAGGGTCGGGCGGGTCTCAGCCA CTCCTCGCCCCCAG 5 10 15 GC TCC CAC TCC ATG AGG TAT TTC TAC ACC TCC GTG TCC CGG CCC GGC CGC GGG -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 35 GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG CGG TTC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --40 45 50 GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG TGG ATA GAG CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 70 GAG GGG CCG GAG TAT TGG GAC CGG AAC ACA CGG AAT GTG AAG GCC CAC TCA CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --75 80 85 90 ACT CAC CGA GTG GAC CTG GGG ACC CTG CGC GGC TAC TAC AAC CAG AGC GAG GAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -CG intron 2 -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCATCCCCCACGGACGGGCCAGGTCGCCCACAG TCTCCGGGTCCGAGATCCGCCCCGAAGCCGCGGGACCCCGAGACCCTTGCCCCGGGAGAGGCCCAGGCGCC TTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCGGGGCGGGGCTCGGGG GACCGGGCTGACCTCGGGGTCCGGGCCAG 95 100 105 GT TCT CAC ACC ATC CAG AGG ATG TAT GGC TGC GAC GTG GGG CCG GAC GGG CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 125 TTC CTC CGC GGG TAC CAG CAG GAC GCT TAC GAC GGC AAG GAT TAC ATC GCC CTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --130 135 140 AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCG GCT CAG ATC ACC CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --145 150 155 160 CGC AAG TGG GAG ACG GCC CAT GAG GCG GAG CAG TGG AGA GCC TAC CTG GAG GGC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --165 170 175 180 CGG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG AAG GAG ACG CTG CAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --182 CGC ACG G intron 3 --- --- -GTACCAGGGGCCACGGGGCGCCTCCCTGATCGCCTGTAGATCTCCCGGGCTGGCCTCCCACA AG
FIGURE 3 Alignment of nucleotide sequences of the new HLA-A allele, A*, [3] with A*2603. The Genbank accession number for the new allele is DQ494176. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
charged Glutamine potentially could affect antigen binding. The fact that the A*9202 is identified in two unrelated women from the same region suggests that the mutation might be maintained in the population either through its functional difference or through linkage with nearby genes. The antigen-binding properties of A*9202 will need to be clarified through functional studies. The A*680105 was identified from a woman from Uganda. The patient was typed as A*3009 and
A*680101 except for a single nucleotide change at codon 139 (GCA¡GCG) (Figure 2), resulting in a synonymous mutation. To determine which allele carries the new codons, HLA-A was reamplified and the PCR products were cloned with the TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 18 clones sequenced, 8 clones were typed as A*3009 and the other 10 clones were typed as A*680101 with a new sequence at codon 139 (GCG) (Figure 2). The new HLA-A allele was designated as A*680105 by the WHO Nomenclature Committee
Identification of Four Novel HLA-A Alleles from an East African Population by High-Resolution Sequence-Based Typing
A*2915 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*2915 A*2915 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*290201 A*2915 A*2915
837
intron 1 GGGGCCCGCCCGGCGGGGACGCAGGACCCGGGTAGCCGCGCCGGGAGGAGGGTCGGGTGGGTCTCAG CCACTCCTCGCCCCAG 5 10 15 GC TCC CAC TCC ATG AGG TAT TTC ACC ACA TCC GTG TCC CGG CCC GGC CGC -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --20 25 30 GGG GAG CCC CGC TTC ATC GCC GTG GGC TAC GTG GAC GAC ACG CAG TTC GTG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --35 40 45 50 CGG TTT GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCA CCG TGG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --55 60 65 ATA GAG CAG GAG GGG CCG GAG TAT TGG GAC CTG CAG ACA CGG AAT GTG AAG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --70 75 80 90 GCC CAG TCA CAG ACT GAC CGA GCG AAC CTG GGG ACC CTG CGC GGC TAC TAC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --G intron 2 -GTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCTCTCATCCCCCACGGACGGGCCGGGTCGCCCA CAGTCTCCGGGTCCGAGATCCACCCCGAAGCCGCGGGACCCCGAGACCCTTGCCCCGGGAGAGGCCCA GGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAAATCCCCCCGGGTTGGTCGGGGCCGGACGG GGCTCGGGGGACTGGGCTGACCGTGGGGTCGGGGCCAG 95 100 105 GT TCT CAC ACC ATC CAG ATG ATG TAT GGC TGC GAC GTG GGG TCG GAC GGG -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --110 115 120 CGC TTC CTC CGC GGG TAC CGG CAG GAC GCC TAC GAC GGC AAG GAT TAC ATC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --125 130 135 140 GCC TTG AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCG GCT CAG --- --- --- --- --- --- --- --- --- --- --- --- --- G-- --- --- --145 150 155 ATC ACC CAG CGC AAG TGG GAG GCG GCC CGT GTG GCG GAG CAG TTG AGA GCC --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --160 165 170 180 TAC CTG GAG GGC ACG TGC GTG GAG TGG CTC CGC AGA TAC CTG GAG AAC GGG --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --182 CGC ACG G intron 3 --- --- -GTACCGGGGGCCACGGGGCGCCTCCCTGATCGCCTGTAGATCTCCCGGGCTGGCCTCCC ACAAG
FIGURE 4 Alignment of nucleotide sequences of the new HLA-A allele, A*2915, with A*290201. The Genbank accession number for the new allele is DQ494177. A dash indicates identity between sequences. Codons are numbered according to Marsh et al. [1].
(see footnote). The HLA-B alleles of this individual are B*1503 and B*4501, and the HLA-C alleles are Cw*070101 and Cw*0802. The class II alleles of this woman are DRB1*090102, DRB1*030101, DRB3*020201, DQB1*0201, DQB1*0201, DPA1*010301, DPA1*020101, DPB1*010101, and DPB1*0601. The allele frequency of A*680101 in this East African population is 1.1%, and the A*680105 is
likely the result of a point mutation at codon 139 of A*680101. Since there is no coding change, the serologic property of A*680105 should be similar to A*680101. The A*2630 was identified from a woman from Machakos, Kenya. The patient was typed as A*0240 and A*2603 except for a nonsynonymous change at codon 90 (GAC¡GCC), resulting in a coding change from Aspartic acid to Alanine (Figure 3). To confirm the change,
838
HLA-A was reamplified and the PCR products were cloned with the TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 30 clones sequenced, 17 clones were typed as A*0240 and the other 13 clones were typed as A*2603, except for a single nucleotide change at codon 90. The new HLA-A allele was designated as A*2630 by the WHO Nomenclature Committee (see footnote). Other class I alleles of this individual are B*4102, B*4703, Cw*070101, and Cw*1701. The class II alleles of this woman are DRB1*030101, DRB1*030201, DRB3*010101, DRB3*020201, DQA1*040101, DQA1*0504, DQB1*0201, DQB1*0402, DPA1*020202, DPA1*010301. A*2630 is possibly the result of a point mutation from A*2603. Both alleles are rare in this population with frequencies of 0.05% for A*2630 and 0.1% for A*2603. Since codon 90 is next to the identified serologic epitope codon 89 [8], the change from a hydrophilic Aspartic acid to a neutral Alanine might influence the serologic property. The A*2915 allele was identified in a woman from Kericho, Kenya. The patient was typed as A*02010101 and A*290201, except for a single nucleotide difference at codon 138 (ATG¡ GTG), resulting in a coding change from Methionine to Valine (Figure 4). To determine which allele carries the new codon, HLA-A was reamplified and the PCR products were cloned with TOPO TA cloning Kit (Invitrogen Co. Carlsbad, CA). Among 30 clones sequenced, 21 clones were typed as A*02010101 and 9 clones were typed as A*290201, except that all of the 9 clones have the new sequence “GTG” at codon 138 instead of “ATG ” (Figure 4). The new HLA-A allele was designated as A*2915 by the WHO Nomenclature Committee (see footnote). The HLA-B alleles of this individual are B*4202 and B*5801, and the HLA-C alleles are Cw*0602 and Cw*1701. The class II alleles of this woman are DRB1*08, DRB1*1503, DRB5*010101, DQA1*010201, DQA1*010101, DQB1*0201, DQB1*050101, DPA1*020101, DPA1*010301. DPB1*010101, and DPB1*0401. The A*2915 is likely the result of a point mutation from A*290201, the allele with a frequency at 3.8% in this population. In the current database A*2915 is the only A*29 allele that has a Valine at codon 138 [9]. The influence of the change on the antigen-binding properties will need to be clarified through functional studies. The identification of the four novel HLA-A alleles from this Kenyan population further demonstrates the genetic diversity of this East African population. With
K.K. Gill et al.
high resolution sequence-based typing, more novel alleles are expected to be identified in this population. ACKNOWLEDGMENT The research was funded by grants from the Canadian Institutes of Health Research (#HOP-43135) and National Institutes of Health (#RO1 A1 49383). Dr. F. Plummer was a Canadian Institutes of Health Research Senior Investigator and is currently a Tier I CIHR Canada Research Chair.
REFERENCES 1. Robinson J, Waller MJ, Parham P, de Groot N, Bontrop R, Kennedy LJ, Stoehr P, Marsh SGE: IMGT/HLA and IMGT/MHC: sequence databases for the study of the major histocompatibility complex. Nucleic Acids Res 31:311, 2003. 2. Ellis JM, Mack SJ, Leke RF, Quakyi I, Johnson AH, Hurley CK: Diversity is demonstrated in class I HLA-A and HLA-B alleles in Cameroon, Africa: description of HLAA*03012, *2612, *3006 and HLA-B*1403, *4016, *4703. Tissue Antigens 56:291, 2000. 3. Luo M, Embree J, Ramdahin S, Ndinya-Achola J, Njenga S, Bwayo JB, Pan S, Mao X, Cheang M, Stuart T, Brunham RC, Plummer FA: HLA-A and HLA-A in Kenya, Africa: allele frequencies and identification of HLA-B*1567 and HLA-B*4426. Tissue Antigens 59:370, 2002. 4. Cereb N, Kong Y, Lee S, Maye P, Yang SY: Nucleotide sequences of MHC class I introns 1, 2, and 3 in humans and intron 2 in nonhuman primates. Tissue Antigens 47:498, 1996. 5. Cereb N, Maye P, Lee S, Kong Y, Yang SY: Locus-specific amplification of HLA class I genes from genomic DNA: locus-specific sequences in the first and third introns of HLA-A, -B, and -C alleles. Tissue Antigens 45:1, 1995. 6. Luo M, Blanchard J, Pan Y, Brunham K, Brunham RC: High-resolution sequence typing of HLA-DQA1 and -DQB1 exon 2 DNA with taxonomy-based sequence analysis (TBSA) allele assignment. Tissue Antigens 54:69, 1999. 7. Luo M, Blanchard J, Brunham B, Pan Y, Shen C, Lu H and Brunham RC: Two-step, high resolution sequence-based HLA-DRB typing of exon 2 DNA with taxonomy-based sequence analysis (TBSA) allele assignment. Human Immunol. 62:1294, 2001. 8. Bjorkman PJ, Saper MA, Samraoui B, Bennett WS, Strominger JL, Wiley DC: The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens Nature. 329:512, 1987. 9. IMGT/HLA database, Release 2.13.0. Accessed July 4, 2006. Available from: http://www.ebi.ac.uk/imgt/hla/citations.html.