Identification of Four Novel Mutations in Patients with Carnitine Palmitoyltransferase II (CPT II) Deficiency

MOLECULAR GENETICS AND METABOLISM ARTICLE NO.

64, 229 –236 (1998)

GM982711

Identification of Four Novel Mutations in Patients with Carnitine Palmitoyltransferase II (CPT II) Deficiency Bing-Zhi Yang,1 Jia-Huan Ding, Tracy Dewese, Diane Roe, Guocheng He, Jeff Wilkinson, Donald W. Day,* France Demaugre,† Daniel Rabier,† Michele Brivet,‡ and Charles Roe Kimberly H. Courtwright & Joseph W. Summers Institute of Metabolic Disease, Baylor University Medical Center, Dallas, Texas 75226; *Medical City, Dallas, Texas; †Necker Enfants-Malades, Paris, France; and ‡Hopital de Bicetre, Paris, France Received February 20, 1998, and in revised form April 9, 1998

Carnitine palmitoyltransferase II (CPT II) deficiency is an autosomal recessive disorder of mitochondrial b-oxidation of long-chain fatty acids. Mitochondrial b-oxidation is a complex process which includes many individual steps (1,2). The conversion of longchain acyl-CoA to acylcarnitine is catalyzed by the outer mitochondrial membrane enzyme carnitine palmitoyltransferase I (CPT I). The acylcarnitine is then moved through the inner mitochondrial membrane by the carnitine/acylcarnitine translocase and converted back to an acyl-CoA intermediate by the inner mitochondrial membrane enzyme, CPT II. CPT II deficiency has three distinct clinical forms: an adultonset (muscular) form, a milder infantile form, and a severe neonatal form which results in sudden unexplained death (5–9). Classical adult-onset CPT II deficiency is clinically characterized by recurrent episodes of rhabdomyolysis, muscle pain, and paroxysmal myoglobinuria after prolonged exercise, cold, or fever, while the lethal neonatal form presents with hypoketotic hypoglycemia, cardiomyopathy, and carnitine deficiency. The cloning of the CPT II gene has enabled the identification and analysis of mutations in CPT II patients, as well as the correlation of mutant genotype to clinical phenotype. Several CPT II mutations have been detected. One published mutation in adult CPT II deficiency is the S113L substitution (5,10), while other mutations have also been identified in individual patients (11–14). These reports demonstrate the genetic heterogeneity which may underlie the clinical variation in CPT II patients. We previously reported a nonsense mutation, R124Stop, in two unrelated com-

Carnitine palmitoyltransferase II (CPT II) deficiency, an autosomal recessive disorder of fatty-acid oxidation, presents as three distinct phenotypes (neonatal, infantile, and adult onset). In order to investigate the molecular basis of these three phenotypes, six patients with CPT II deficiency have been studied. All six unrelated patients in this study experienced the clinical symptoms of CPT II deficiency. Three patients had the neonatal form, one had the milder infantile form, and the remaining two had the adultonset form with “muscular” symptoms only. Their diagnoses were based upon in vitro analysis of the mitochondrial b-oxidation pathway in fibroblasts and standard enzyme assays. We devised a method to screen the entire coding sequence and flanking splice junction of the CPT II gene. A total of six different mutations have been identified, including four novel mutations. Among them, the previously reported common mutation, S113L, was only found in 3 of 12 variant alleles. Three of the six mutations have been identified in a few unrelated patients, while the remaining three have been found in single families. This study, as well as those by others, indicates genetic heterogeneity in this disease. In addition to tabulating the mutations, the correlation of mutant genotype to clinical phenotype is briefly discussed. © 1998 Academic Press

Key Words: carnitine palmitoyltransferase II (CPT II); mitochondrial b-oxidation; long-chain fatty acids; mutation.

1

To whom correspondence and reprint requests should be addressed at Institute of Metabolic Disease, Baylor University Medical Center, 3812 Elm Street, Dallas, TX 75226. Fax: (214) 820-4853. 229

1096-7192/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.

230

YANG ET AL.

pound heterozygous patients. In this study, six additional patients have been studied to identify mutations and to establish phenotype/genotype relationships. MATERIAL AND METHODS Study Participants The clinical phenotype of CPT II patients is based on the age of onset of symptoms. Of the six unrelated patients three were neonates, one had the milder late infantile form, and two had adult-onset of symptoms. The diagnosis was based on analysis of the integrity of the mitochondrial b-oxidation pathway in fibroblasts by tandem mass spectrometry (15,16) as well as enzyme assays (15). Normal control subjects were unrelated. In Vitro Analysis of Mitochondrial b-Oxidation by Mass Spectrometry Confluent fibroblasts were incubated in a T-25 flask with 3.5 ml of freshly prepared MEM containing 10% fetal calf serum, 0.4 mM L-carnitine, and 0.2 mM [16-2H3]palmitic acid bound to bovine serum albumin. Cells were incubated for 72 h at 37°C in humidified 5% CO2/95% air. After the incubation period, the incubated medium was removed and the cells were harvested with trypsin– EDTA. The cells were washed in phosphatebuffered saline, centrifuged (2500g) for 5 min, and resuspended in 300 ml water for protein determination. A 100-ml sample consisting of two parts incubated medium and one part cell suspension was mixed with the following internal standards: [2H5]propionylcarnitine, [ 2H9]isovalerylcarnitine (Cambridge Isotopes Laboratories, Andover, MA), [2H6]octanoylcarnitine, and [2H6]palmitoylcarnitine (gift of Dr. Howard Sprecher, Columbus, OH). The samples were then derivatized as methyl esters and the acylcarnitines were analyzed on a Quattro II tandem mass spectrometer (Micromass, Beverly, MA) as previously described (16). PCR Amplification and Sequencing Genomic DNA was isolated from cultured skin fibroblasts and/or whole blood by standard methods using a Blood & Cell Culture DNA MiniKit (Qiagen, Santa Clarita, CA). All exons of the CPT II gene were amplified with modified primers (Table 1) previously described (17). The PCR reaction mixture contained 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 200 mM of each dNTP, 2.5 U of Taq DNA polymerase, and

TABLE 1 List of Primers Used for Amplification of CPT II Exons Exon 1 Sense Antisense Exon 2 Sense Antisense Exon 3 Sense Antisense Exon 4 Sense Antisense Exon 5 Sense Antisense

59 59 59 59 59 59 59 59 59 59

CTTGTGTTTAGACTCCAGAACTCCC 39 GTCATGAGTGACTGCAGTCAGGTT 39 CTTGTAAAGCTAATTAACCTCTTCC 39 TCTTGAACCACCCCAACTATGCTC 39 CATGTATTCCCTACCATGGTTTG 39 CGTTACTTCATTTGCTGGTCTCA 39 GGGACAGCATTAACATTTTATGT 39 GTAGAATGATTTAGGCTTGCTTAC 39 TTTCCTGAGGTCCTTTTCCATCCTG 39 ATGAGGAAGTGATGGTAGCTTTTCA 39

1 mM each pair of the primers in 50 ml. After initial incubation at 94°C for 2 min, 30 cycles of PCR were performed using a GeneAmp PCR system 9600 (Perkin-Elmer, Foster City, CA) according to the following program: 20 s of denaturation at 94°C, 20 s of annealing at 56°C, and 30 s of extension at 72°C. The final extension was for 3 min. The PCR products were directly sequenced on the Applied Biosystems 377 Prism using the Dye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase FS (Perkin-Elmer). Nucleotide changes in heterozygous individuals were detected reliably by manual inspection of characteristic double peaks. The PCR-amplified fragments containing mutations were then subcloned into the T7 Blue vector (Novagen, Madision, WI) and were sequenced in both directions to confirm the mutation(s). Restriction-Endonuclease Analysis of Mutations Genomic DNA was isolated and PCR was carried out in the manner described above. If a mutation did not create or eliminate a restriction site for a suitable endonuclease, PCR amplification was performed with mismatched primers. The primer sequences, locations, and suitable endonuclease are indicated in Table 2. The amplified fragments were then digested with an endonuclease, subjected to electrophoresis on 12% polyacrylamide gel, stained with 0.5 mg/ml ethidium bromide, and visualized with UV light. RESULTS In Vitro Analysis of Mitochondrial b-Oxidation Following incubation of the patient’s fibroblasts with labeled [2H3]palmitate for 72 h, the sample was mixed with internal standards, derivatized, and ana-

231

CPT II DEFICIENCY

TABLE 2 List of Primers Used to Generate PCR Products Which Create or Abolish a Restriction Site Primers R151Q-s R151Q-a F550C-s F550C-ab P604S-s P604S-ab T ins/del 25-s T ins/del 25-a

Localizationa

Sequence 59 59 59 59 59 59 59 59

CTGAGTATAATGACCAGCTCACCC 39 AGCCCGGAGTGTCTTCAGAAAC 39 TTTCCTGAGGTCCTTTTCCATCCTG39 AGAGCAAACAAGTGTCGGTTA39 TGTCCTGTCCACGAGCACACTGAG39 ACACCAAAGCCATCAGAGACCACCG 39 CTGAAGACACTCCGGGCT 39 ACCAGGACAGAGAGGAAG 39

428–451 482–504 Intron 4 256 to 232 1656–1676 1755–1778 1811–1835 487–504 587–604

Restriction enzyme AvaIc MspI MspIc

a

Nucleotide localization is reported with nucleotide position 1 corresponding to nucleotide A of the initiating codon ATG. Mismatched bases are underlined. c Mutations abolish a restriction site. b

lyzed on a Quattro II tandem mass spectrometer. Acylcarnitine profiles (methyl esters) showed elevated amounts of palmitoylcarnitine, consistent with CPT II deficiency. Palmitoylcarnitine was not increased in normal individuals (Fig. 1). This was confirmed by direct assay for CPT II activity. The CPT II enzyme activities ranged from 0.05 to 0.17 with normal range

from 0.85 to 2.13 mmol/min/mg (the CPT II activity was 6–10% of mean control value). DNA Sequencing DNA was sequenced for CPT II mutations in all six patients. By use of flanking intronic primers, each of the five exons and splice junctions were

FIG. 1. Acylcarnitine profile of normal and patient fibroblasts incubated with [2H3]palmitate. The peaks represent the molecular ions of acylcarnitine methylesters. (Top) Normal cells, labeled (*) intermediates detected range from *C4 (butyrylcarnitine) to *C16 (palmitoylcarnitine). (Bottom) CPT II-deficient cells incubated with palmitate. The labeled internal standards are designated IS.

232

YANG ET AL.

FIG. 2. DNA sequence analysis identified the P604S mutation. Sequencing of the CPT II gene cloned from a patient with CPT II deficiency (top) and from normal cells (bottom) were performed in an ABI 377 automated sequencer. A point mutation, C to T transition, was identified at position 1810, which changes the CCT codon of proline 604 to the TCT codon for serine. The arrow indicates the position of the C 1810 to T transition. FIG. 3. Nucleotide sequence analysis of the CPT II gene cloned from patient 6 with the Q550R mutation (top) and from a normal individual (bottom). The arrow indicates the position of the A to G transition at position 1649, which changes the codon CAG of glutamine 550 to CGG for arginine (Q550R). FIG. 4. Partial sequence of exon 4 from genomic DNA cloned from patient with CPT II deficiency and the R151Q mutation (top) and from normal individual (bottom). The arrow indicates the position of the G 452 to A transition. This mutation changes the CGG codon of arginine 151 to the CAG codon for glutamine.

amplified from genomic DNA and sequenced directly. The PCR-amplified fragments containing mutations were then subcloned and sequenced in both directions. Mutations were detected in 9 of the 12 chromosomes examined. Four new mutations, R151Q, Q550R, P604S, and 534T ins/del 25, were identified (Figs. 2–5). In addition, two previously reported mutations, S113R and P227L, were also found. These results are shown in Table 3 together with mutations from 10 previously reported patients. In this study, only 1 patient was

found to be homozygous for the common Ser-113– Leu mutation, while the others were compound heterozygous. Three of the novel mutations found in the present study were single-base substitutions. In addition to these single-base substitutions, a 534T insertion followed by a 25-bp deletion (encompassing bases 534 –558), designated 534T ins/del 25, was also found in two unrelated patients. This mutation causes a leucine to phenylalanine replacement followed by an in-frame deletion (DNPAKSDTI 179 –186).

233

CPT II DEFICIENCY

FIG. 5. Nucleotide sequence analysis of the CPT II gene cloned from patient 5 with a complex insertion/deletion (top) compared to normal (bottom). The arrow indicates the position of the insertion (534T). The sequence of the 25-bp deletion is indicated (lowercase letters) on the top and the insertion T is underlined.

Identification of Mutations in the Genomic DNA A method based on PCR/restriction endonuclease analysis was developed and performed to verify each novel mutation and to screen DNA from normal controls. In patient 6, the P604S (C-1810-T) mutation did not create or abolish a suitable restriction site. Therefore, modified PCR products were generated from genomic DNA with mismatched primers (Table 2) and digested with MspI endonuclease (Fig. 6). The mismatch created a new MspI restriction-enzyme site in the normal DNA. MspI digestion yielded two fragments (38 and 25 bp). The PCR products amplified from the wild-type allele and digested by MspI yielded two bands (38 and 25 bp), while the mutated allele resisted MspI digestion. Patient 6 showed three bands (63, 38, and 25 bp) indicating that this patient was a compound heterozygote for this mutation (Fig. 6, lane 2).

The Q550R (A-1648-G) and R151Q (G-554-A) mutations were identified by a similar approach (Figs. 7 and 8), while the 534T ins/del 25 mutation was detected by direct gel electrophoresis of PCR products without restriction endonuclease digestion (Fig. 9). The PCR products of the genomic DNA produced two closely spaced bands from patients 3 and 5, respectively. The larger product (118 bp) had a normal sequence, while the slightly smaller product contained the 534T ins/25-bp deletion (Fig. 9) indicating that the patients were compound heterozygous for the 534T ins/del 25 mutation. DISCUSSION Deficiency of CPT II presents as three clinically distinct phenotypes: onset and death in the first week of life (neonatal), initial symptoms of hypoglycemia oc-

234

YANG ET AL.

TABLE 3 Summary of Mutations Identified in the Human CPT II Gene Phenotype Neonatal

Infantile

Adult

Patient

Exon

Nucleotide

Mutation

1 4

5 4 4 4 5 5 5 4 4 4 4a 3a 3 4 1a 5 3 4 3

1649 452 680 634–659 2399a 1891a 1810b 621 1249 997 680 388 388 634–659 665 2173 388 370 388

A to G G to A C to T 534T ins/del 25 A to C C to T C to T G to A T to A 11-bp duplic C to T C to T C to T 534T ins/del 25 C to A G to A C to T C to T C to T

5 Bonnefont (18) Taroni (11) 6 Yamamoto (14) Gellera (12) Taroni (13) 2 3 Verderio (17) Verderio (17) Yang (19)

a b

Substitution Q550R R151Q P227L — Y628S R631C P604S E174K F383Y — P227L S113L S113L P50H D553N S113L R124Stop S113L

Homozygous. Heterozygous.

curring later in infancy (late infantile), and adult onset characterized by recurrent rhabdomyolysis. Several pathogenic mutations have been identified in patients with CPT II deficiency, establishing the genetic heterogeneity of the disease. Ten different mutations have been reported previously to be associated with the disease in patients from several ethnic backgrounds. In adult CPT II deficiency, the S113L mutation has been thought to be the “com-

FIG. 6. Detection of the P604S (C-1810-T) mutation. DNA from the patient and normal controls (lanes 1 to 4) were amplified using mismatched primers (Table 2). The mismatch created of a new MspI restriction-enzyme site in the normal DNA. The PCR products (63 bp) are digested with MspI and subjected to electrophoresis on 12% polyacylimade gel. The normal control with MspI digestion yielded two fragments (38 and 25 bp). Lane 1 without MspI digestion remained a single band (63 bp). The compound heterozygous sample (lane 2) showed MspI digestion yielding three fragments (63, 38, and 25 bp). The normal controls, lanes 3 and 4, were digested with MspI and yielded two fragments (38 and 25 bp).

mon” mutation. Most other mutations have been identified in individual patients. We now report four additional mutations. Each of these is found in the coding region suggesting a change in the primary structure of CPT II. None of these newer mutations was observed in healthy controls. Knowledge of these mutations permits us, in principle, to assess possible correlations between the nature or site of the mutations and the resulting phenotype.

FIG. 7. Detection of the Q550R (A-1649-G) mutation. Genomic DNA from the patient and normal controls (lanes 1 to 9) were amplified using mismatched primers (Table 2). The mismatch created a new MspI restriction-enzyme site in the mutant DNA. The Q550R mutation: MspI digestion yielded two fragments (49 and 29 bp). The compound heterozygous sample (lane 3) showed MspI digestion yielding three fragments (78, 49, and 29 bp). Lane 2, the same sample from lane 3 without MspI digestion showed only one band (78 bp). The normal controls, lanes 1, 4, 5, 6, 7, 8, and 9, were digested with MspI and remained uncut, with only one fragment (78 bp).

235

CPT II DEFICIENCY

The S113L mutation was found on both alleles in only one adult patient. The other adult was compound heterozygous for the S113L mutation. The other allele carried an insertion of one base T followed by deletion of 25 bp within exon 4. The frameshift introduced by the first insertion at position 534 (534T ins) is corrected for immediately by the adjacent 25-bp deletion. Thus the transcript encodes a polypeptide in which leucine (L178) was replaced by phenylalanine followed by a deletion of eight amino acid residues (DNPAKSDTI 179 –186). We presume that the 25-bp deletion is indeed the disease mutation, since no other alterations were detected in the remaining four exons or the intron/exon junctions, nor was this deletion detected in 20 control individuals. Among the six mutations identified in this study, two have been reported previously. One is the S113L and the other is the P227L. The P227L mutant allele carries a polymorphism V368L (data not shown). The presence of marker polymorphism V368L in our patient, as well as in the patients reported by others carrying the P227L mutation, suggests (considering the geographic dispersion of these patients) that the P227L mutation may be an old mutation. In contrast, one patient carrying the S113L mutation presented a polymorphism M647V, while another patient’s S113L allele had no such polymorphism (data not shown). The divergent haplotypes reflect the occurrence of an independent mutational event. This study provides additional evidence that CPT II deficiency is quite heterogeneous with regard to the type and location of mutations within

FIG. 9. Detection of the 534T ins/del 25 mutation. Lane 1, amplified from patient plasmid DNA containing the 534T ins/del 25 mutation as a positive control (94 bp). Lanes 2, 3, and 6, amplified from normal control genomic DNA (118 bp). Lanes 4 and 5, amplified from two unrelated patients, respectively; the two fragments (118 and 94 bp) indicate that the patients are compound heterozygous for the 534T ins/del 25 mutation.

the gene (Table 3). Thus, only 2 of the 6 mutations identified have been reported previously. The other four mutations are new and increase the number of different mutations to a current total of 14. The S113L mutation has been identified only in the patients with the adult-onset form of this disease (5,10). To our knowledge, it has not been observed in children with either the neonatal (severe) or late infantile (mild) phenotypes. This observation suggests that correlation of genotype with the different phenotypes of this disease may be possible with a larger patient base. ACKNOWLEDGMENTS This work was supported in part by the Courtwright-Summers Metabolic Disease Fund. We are grateful to Ms. Bonnie Walters for assisting with the database on these patients.

REFERENCES 1. Guzman M, Geelen MJ. Regulation of fatty acid oxidation in mammalian liver. Biochim Biophys Acta 1167:227–241, 1993. 2.

Bieber LL. Carnitine. Annu Rev Biochem 57:261–283, 1988.

3. Woeltje KF, Esser V, Weis BC, Cox WF, Schroeder JG, Liao S-T, Foster DW, McGarry JD. Intertissue and interspecies characteristics of the mitochondrial carnitine palmitoyltransferase enzyme system. J Biol Chem 265:10714 –10719, 1990. FIG. 8. Detection of the R151Q (G-554-A) mutation. Genomic DNA from the patient and normal controls (lanes 1 to 5) were amplified. The PCR products (77 bp) were digested with AvaI and subjected to electrophoresis on 12% polyacylamide gel. The products of the mutant allele remained uncleaved yielding only one fragment, 77 bp. The patient (lanes 1 and 2) was compound heterozygous for R151Q, AvaI digestion yielded three fragments 77, 53, and 24 bp (lane 2). Lane 1, without AvaI digestion showed only one fragment (77 bp). AvaI digestion of the normal controls (lanes 3, 4, and 5) yielded two fragments, 53 and 24 bp.

4.

McGarry JD, Woeltje KF, Kuwajima M, Foster DW. Regulation of ketogenesis and the renaissance of carnitine palmitoyltransferase. Diabetes Metab Rev 5:271–284, 1989.

5.

Taroni F, Verderio E, Dworzak F, Willems PJ, Cavadini P, DiDonato S. Identification of a common mutation in the carnitine palmitoyltransferase II gene in familial recurrent myoglobinuria patients. Nature Genet 4:314 –320, 1993.

6.

Demaugre F, Bonnefont JP, Colonna M, Cepanec C, Leroux JP, Saudubray JM. Infantile form of carnitine palmitoyltransferase II deficiency with hepatomuscular symptoms and sudden death. J Clin Invest 87:859 – 864, 1991.

236 7.

8.

9.

10.

11.

12.

13.

YANG ET AL. Hug G, Bove KE, Soukup S. Lethal neonatal multiorgan deficiency of carnitine palmitoyltransferase II. N Engl J Med 325:1862–1864, 1991. DiMauro S, DiMauro PMM. Muscle carnitine palmitoyltransferase deficiency and myoglobinuria. Science 182:929 – 931, 1973. Singh R, Shephered IM, Derrick JP, Ramsay RR, Sherratt HSA, Turnbull DM. A case of carnitine palmitoyltransferase II deficiency in human skeletal muscle. FEBS Lett 241:126 – 130, 1988. Handig I, Dams E, Taroni F, Laere SV, Barsy TD. Inheritance of the S113L mutation within an inbred family with carnitine palmitoyltransferase enzyme deficiency. Hum Genet 97:291–293, 1996. Taroni F, Verderio E, Fiorucci S, Cavadini P, Finocchiaro G, Uziel G, Lamantea E, Gellera C, DiDonato S. Molecular characterization of inherited carnitine palmitoyltransferase (CPT II) deficiency. Proc Natl Acad Sci USA 89:8429 – 8433, 1992. Gellera C, Witt DR, Verderio E, Cavadini P, DiDonato S, Taroni F. Molecular study of lethal neonatal carnitine palmitoyltransferase (CPT II) deficiency. Am J Genet 51: A168, 1992. Taroni F, Gellera C, Cavadini P, Baratta S, Lamantea E, Dethlefs S, DiDonato S, Reik RA, Benke PJ. Lethal carnitine palmitoyltransferase (CPT) II deficiency in newborns: A molecular genetic study. Am J Hum Genet 55:A245, 1994.

14.

Yamamoto S, Abe H, Kohgo T, Ogawa A, Ohtake A, Hayashibe H, Sakuraba H, Suzuki Y, Aramaki S, Takayanagi M, Hasegawa S, Niimi H. Two novel gene mutations (Glu1743 Lys, Phe3833 Tyr) causing the “hepatic” form of carnitine palmitoyltransferase II deficiency. Hum Genet 98: 116 –118, 1996.

15.

DiMauro S, Miranda AF, Sakoda S, Schon EA, Servidei S, Zeviani M. Metabolic myopathies. Am J Med Genet 25:635– 651, 1986.

16.

Van Hove JLK, Zhang W, Kahler SG, Roe CR, Chen YT, Terada N, Chace DH, Iafolla AK, Ding JH, Millington DS. Medium-chain acyl-CoA dehydrogenase deficiency: Diagnosis by acylcarnitine analysis in blood. Am J Hum Genet 52:958 –966, 1993.

17.

Verderio E, Cavadini P, Montermini L, Wang H, Lamantea E, Finocchiaro G, DiDonato S, Gellera C, Taroni F. Carnitine palmitoyltransferase II deficiency: Structure of the gene and characterization of two novel disease-causing mutations. Hum Mol Genet 4:19 –29, 1995.

18.

Bonnefont J-P, Taroni F, Cavadini P, Cepanec C, Brivet M, Saudubray J-M, Leroux J-P, Demaugre F. Molecular analysis of carnitine palmitoyltransferase II deficiency with hepatocardiomuscular expression. Am J Hum Genet 58:971– 978, 1996.

19.

Yang B-Z, Ding J-H, Roe D, Dewese T, Day DW, Roe C. A novel mutation identified in carnitine palmitoyltransferase II deficiency. Mol Genet Metab 53, 110 –115, 1998.