Identification of immunodominant T-cell epitopes in membrane protein of highly pathogenic porcine reproductive and respiratory syndrome virus

Virus Research 158 (2011) 108–115

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Identification of immunodominant T-cell epitopes in membrane protein of highly pathogenic porcine reproductive and respiratory syndrome virus Ya-xin Wang, Yan-jun Zhou, Guo-xin Li, Shan-rui Zhang, Yi-feng Jiang, Ao-tian Xu, Hai Yu, Meng-meng Wang, Li-ping Yan, Guang-zhi Tong ∗ Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai 200241, China

a r t i c l e

i n f o

Article history: Received 29 November 2010 Received in revised form 20 March 2011 Accepted 22 March 2011 Available online 31 March 2011 Keywords: PRRSV Membrane protein ELIspot T-cell epitope IFN-␥

a b s t r a c t The development of cell-mediated immunity has been known extremely important in clearing porcine reproductive and respiratory syndrome virus (PRRSV) in infected pigs. However, the PRRS immunology regarding the interaction of T-cells and PRRSV proteins is poorly understood. To identify the T-cell immunodominant epitopes on the membrane (M) protein of PRRSV, a series of 31 overlapping pentadecapeptides covering the entire M protein were designed and synthesized. These peptides were screened by ELIspot analysis for their capabilities to elicit interferon-gamma (IFN-␥) responses in the peripheral blood mononuclear cells (PBMCs), which were collected from pigs immunized with a ttenuated PRRSV HuN4-F112 strain and challenged with highly pathogenic HuN4 strain. After three rounds of screening, 4 peptides (M3, M6, M8 and M12) were shown to elicit high expression of IFN␥. The stimulation of high IFN-␥ transcription in PBMCs by these 4 peptides was further confirmed in real-time PCR. The sequence alignment revealed that the epitope represented by peptide M6 was fully conserved in all of examined 42 North American genotype II PRRSV isolates and the epitopes represented by peptides M3, M8 and M12 showed 2–4 amino acid replacements. The finding of 4 T-cell immunodominant epitopes in the M protein of PRRSV will be beneficial to the understanding of the development of cell-mediated immunity. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Porcine reproductive and respiratory syndrome (PRRS) was first recognized in 1987 in North America and soon later in Europe (Keffaber, 1989; Wensvoort, 1993). The disease is characterized with severe reproductive failure in sows and gilts and respiratory problems in young pigs (Grebennikova et al., 2004; Stadejek et al., 2002; Wensvoort, 1993). The PRRS has become one of the most important swine diseases all over the world, resulting in tremendous economic loss in the pig industry each year (Albina, 1997; Polson et al., 1992). The causative agent PRRS virus (PRRSV) belongs to the family of Arteriviridae (Cavanagh, 1997; Thiel et al., 1993). The PRRSV has a single stranded, positive-sense RNA (+ssRNA) genome with approximately 15 kb in length, consisting of 9 open reading frames (ORFs) (Meulenberg et al., 1993; Thiel et al., 1993). The ORF1a and ORF1b situated at the 5 end of the genome encode non-structural proteins. The ORF2–ORF7 located at the 3 end of

∗ Corresponding author at: Division of Swine Infectious Diseases, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, No. 518, Ziyue Road, Minhang District, Shanghai 200241, China. Tel.: +86 21 34293436; fax: +86 21 54081818. E-mail addresses: [email protected], [email protected] (G.-z. Tong). 0168-1702/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2011.03.018

the genome encode structural glycoproteins (GP2–5), membrane protein (M) and nucleocapsid protein (N) (Murtaugh et al., 1995; Thiel et al., 1993). The PRRS has been one of the most challenging research topics in veterinary viral immunology. The PRRS viraemia was found in blood of pigs with neutralizing antibodies, indicating the humoral immune response alone did not confer solid protection (Lopez et al., 2007; Lopez and Osorio, 2004; Ostrowski et al., 2002; Vezina et al., 1996). The cell-mediated immunity (CMI) has been shown to play important role in clearing PRRSV (Diaz et al., 2006; Mateu and Diaz, 2008). Significant lymphocyte proliferative responses were detected in pigs that were recovered from PRRSV infection. The development of the CMI response as determined by lymphocyte blastogenesis and adaptive cytokine production was delayed, primarily detectable in the in vitro recall response of PBMCs around 4–8 weeks post infection, which correlated with the development of neutralizing antibodies (Bassaganya-Riera et al., 2004; Bautista and Molitor, 1997; Charerntantanakul et al., 2006; Lopez Fuertes et al., 1999; Lopez et al., 2007; Meier et al., 2003). The interferon gamma (IFN-␥) plays a key role in cell-mediated immune responses against a variety of cytopathic viral infections in animals (Zinkernagel et al., 1996). In PRRSV-infected pigs, the IFN-␥ mRNA was detected in the lymph nodes, lungs and peripheral blood mononuclear cells (Lopez Fuertes et al., 1999; Rowland

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

et al., 2001). Therefore, the presence of PRRSV-specific IFN-␥ secreting cells in peripheral blood can be considered as an evidence of immunological activity. The localization of T-cell epitopes in PRRSV proteins is important for the understanding of the development of the CMI. The IFN-␥ ELIspot assay was used to detect antigen-specific T cell responses in human immunodeficiency virus (HIV) vaccine research (Streeck et al., 2009) and identify T-cell epitopes in classical swine fever virus (Armengol et al., 2002), foot and mouth disease virus (Blanco et al., 2001) and HIV-1 Gag (Murakoshi et al., 2009). The peptide library method was also used to identify T-cell epitopes in previous studies (Leen et al., 2008; Semeniuk et al., 2009). The availability of information on the roles of PRRSV proteins in inducing T-cell responses is limited. Two immunodominant T-cell epitopes were identified in GP5 of the North American genotype II of PRRSV (Vashisht et al., 2008). Potential T-cell epitopes in GP4, GP5 and N protein of European genotype I of PRRSV were predicted and evaluated (Diaz et al., 2009). The M protein of PRRSV was shown to induce virus-specific T-cell response and involve in the CMI (Bautista et al., 1999; Jeong et al., 2010). In the present study, we identified 4 novel T-cell epitopes in M protein of PRRSV by screening a series of 31 overlapping pentadecapeptides for their capabilities to stimulate IFN-␥ response in peripheral blood mononuclear cells (PBMCs) in ELIspot assay. 2. Materials and methods 2.1. Virus strains The virulent PRRSV HuN4 strain and attenuated HuN4-F112 strain were used in this study. The PRRSV HuN4 strain was isolated from a pig with “high fever syndrome” in China (Tong et al., 2007; Zhou et al., 2008). The HuN4-F112 strain was attenuated by passing the HuN4 strain in Marc-145 cells for 112 passages (Tian et al., 2009). 2.2. Pig vaccination and challenge Five one-month-old Mini piglets were purchased from an established PRRS-negative herd and randomly selected from the same litter. The PRRSV-negative status was confirmed prior to immunization by RT-PCR and antibody ELISA kit (IDEXX, USA). Each of piglets was vaccinated intramuscularly with 103.0 TCID50 of HuN4-F112 strain. At day 21 post vaccination, each of piglets was challenged with 3 × 104.0 TCID50 of HuN4 strain by the intramuscular (1 mL) and intranasal (2 mL) routes. One week later, blood samples were collected from these piglets. 2.3. Preparation of PBMCs The peripheral blood mononuclear cells were isolated from piglet blood samples by density gradient centrifugation using Histopaque 1.077 (Sigma, USA). The PBMCs from each animal were resuspended in RPMI-1640 supplemented with 10% fetal calf serum, 50,000 IU/L penicillin and 50 mg/L streptomycin. The purified PBMCs were cryopreserved in liquid nitrogen till use.

109

Table 1 Synthetic peptides used in this study. Peptide no.

Amino acid sequence

Position of residues

M1 M2 M3 M4 M5 M6 M7 M8-H M8-Va M8-Cb M9 M10 M11 M12 M13 M14 M15 M16 M17 M18 M19 M20 M21 M22 M23 M24 M25 M26 M27 M28 M29

MGSSLDDFCNDSTAP LDDFCNDSTAPQKVL CNDSTAPQKVLLAFS AFSITYTPVMIYALK VMIYALKVSRGRLLG ALKVSRGRLLGLLHL SRGRLLGLLHLLIFL FGYMTFVHFESTNRV FGYMTFAHFESTNRV FGYMTFVHFQSTNRV FESTNRVALTMGAVV LLWGVYSAIETWKFI IETWKFITSRCRLCL KFITSRCRLCLLGRK SRCRLCLLGRKYILA LCLLGRKYILAPAHH GRKYILAPAHHVESA ILAPAHHVESAAGFH AHHVESAAGFHPIAA ESAAGFHPIAANDNH GFHPIAANDNHAFVV IAANDNHAFVVRRPG DNHAFVVRRPGSTTV FVVRRPGSTTVNGTL RPGSTTVNGTLVPGL TTVNGTLVPGLKSLV GTLVPGLKSLVLGGR PGLKSLVLGGRKAVK SLVLGGRKAVKQGVV GGRKAVKQGVVNLVK AVKQGVVNLVKYAK

1–15 5–19 9–23 21–35 29–43 33–47 37–51 57–71 57–71 57–71 65–79 81–95 89–103 93–107 97–111 101–115 105–119 109–123 113–127 117–131 121–135 125–139 129–143 133–147 137–151 141–155 145–159 149–163 153–167 157–171 161–174

Notes: All peptides consisted of 15 amino acids and overlapped with adjacent peptides by 11 amino acids. a Peptide M8-V was composed of the corresponding sequence of M8 with one amino acid replacement (A for V) at position 63 of HuN4-F112 strain. b Peptide M8-C was composed of the corresponding sequence of M8 with one amino acid replacement (Q for E) at position 66 of Ch-1a strain. All peptides (5 mg/mL) were dissolved in 1% DMSO-water as a stock solution, stored at −80 ◦ C and further diluted in culture medium when needed. Working solutions of peptides at a final concentration of 5 ␮g/mL were prepared in RPMI-1640 supplemented with 10% fetal calf serum. The maximal response was observed at 5 ␮g/mL of peptides in preliminary experiments. In the following experiments, the total concentrations of peptides in each pool were adjusted to 5 ␮g/mL no matter how many peptides were used to make the pools.

of screening. The sequence alignment indicated that amino acid differed between the HuN4-F112 strain and representative field strain Ch-1a. Then, two peptides M8-V and M8-C in the position of 57–71 were designed on the basis of sequences of HuN4-F112 strain and Ch-1a strain. The effect of these amino acid changes on the immunogenicity of target peptides was evaluated in ELIspot assay. As a result, 31 peptides were synthesized in carboxyl N-terminal and carboxamide C-terminal forms by solid-phase peptide synthesis using Fmoc/tBu chemistry (ChinaTech Peptide Co., Ltd). All pentadecapeptides except M4 were confirmed to have more than 95% purity using reversed-phase high pressure liquid chromatography (HPLC) and mass spectrometry. The peptide M4 exhibited 85% purity by HPLC and MS. 2.5. IFN- ELIspot assay

2.4. Design and synthesis of peptides A total of 31 pentadecapeptides were designed based on the sequence of 174 amino acids of M protein of PRRSV HuN4 strain to cover the full length of M protein. All peptides overlapped each other by 11 residues. The positions and amino acid sequences of these peptides are shown in Table 1. Among these peptides, two peptides M8-V and M8-C were specially designed. The peptide M8-H was revealed as a potential epitope through two cycles

Peptide-specific IFN-␥-secreting cells were analyzed using an ELIspot kit (R&D systems, USA) by following the manufacturer’s instructions. All tests were performed in triplicate. To perform the assays, 100 ␮L of 5 × 105 PBMCs and an equal volume of individual or pooled peptides (5 ␮g/mL) were added to 96-well plates precoated with anti-IFN-␥ antibody. The positive controls included 200 TCID50 of HuN4 and 5 ␮g/mL of phytohemagglutinin (PHA). The culture medium was used as negative control. After incuba-

110

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

Table 2 A: First distribution of peptide pools. B: Second distribution of peptide pools. Groups

Peptides

Pools

Distribution

A 1 2 3 4 5 6

M1, M2, M3, M4, M5 M6, M7, M8, M9, M10 M11, M12, M13, M14, M15 M16, M17, M18, M19, M20 M21, M22, M23, M24, M25 M26, M27, M28, M29

I1 II1 III1 IV1 V1 VI1

Groups 1, 2 Groups 2, 3 Groups 3, 4 Groups 4, 5 Groups 5, 6 Groups 6, 1

B IV2 V2 VI2 VII2 VIII2

I2

II2

III2

M1 M4 M7 M10 M13

M2 M5 M8 M11 M14

M3 M6 M9 M12 M15

Notes: For the first distribution of peptide pools (A), individual peptides consisting of 15 amino acids were distributed into 6 groups. Each group was composed of 5 different peptides, except for Group 6, which contained 4 different peptides. All groups were redistributed into 6 pools, which were subsequently overlapped each other. For example, pool I1 was composed of Group 1 (overlapped with pool VI1 ) and Group 2 (overlapped with pool II1 ). Finally, the first round of selection showed that pool I1 and pool II1 contained PRRSV M epitopes. By cross-matching analysis for the members of peptides in 2 pools, five peptides, M6, M7, M8, M9 and M10 in Group 1 were selected to conduct the second round of ELIspot assay. For the second distribution of peptide pools (B), peptides selected as potential stimulator based on the first round analysis of the peptide pool data were redistributed into 8 pools. Pools I2 , II2 , and III2 were composed of 5 different peptides arranged in the corresponding row. Pools IV2 , V2 , VI2 , VII2 , and VIII2 were composed of 3 different peptides arranged in the corresponding columns.

tion for 18 h at 37 ◦ C, PBMCs were removed and the plates were developed with a biotinylated anti-IFN-␥ detecting antibody and streptavidin–alkaline phosphatase. A blue-black colored precipitate formed at the sites of cytokine localization and appeared as spots, with each of spots representing individual IFN-␥ secreting cells. The number of spots displayed on the plate membranes was automatically counted using a computer-assisted video image analyzer (Sage Creation, Beijing). Frequencies of IFN-␥ producing cells were expressed as responding cells in one million PBMCs. The frequency of antigen-specific IFN-␥ secreting cells in each PBMC population was determined by the average number of spots in triplicated PBMC cultures stimulated with virus or peptide substracting the number of background spots in triplicated PBMC cultures exposed to the culture medium. The data was expressed as the number of IFN-␥ secreting cells per one million PBMCs (ISC/million PBMCs). 2.6. Stimulation of PBMCs with PRRSV peptides The peptide concentrations were optimized in the preliminary experiments. The maximal response was observed at 5 ␮g/mL of peptides. Accordingly, this concentration was used in later tests. Initially, all peptides were distributed into 6 pools (I1 to VI1 ) as shown in Table 2A. Each pool was screened in the IFN-␥ ELIspot

assay. Fresh PBMCs (5 × 105 cells/well) were stimulated with 6 peptide pools (I1 to VI1 ). Based on the first round of screening, some peptides were selected for further evaluation. These peptides were redistributed into 8 pools (I2 to VIII2 ) as shown in Table 2B. At last, based on two rounds of screening, those peptides identified as potential epitopes were screened again for their ability to stimulate the IFN-␥ response. 2.7. Detection of IFN- by TaqMan fluorescent quantitative real-time PCR Detection of porcine IFN-␥ mRNAs by real-time PCR was performed as described by Wei et al. (2009). Briefly, 100 ␮L of 5 × 105 PBMCs was incubated with equal volume of 5 ␮g/mL of individual peptides in 96-well plates. After incubation for 18 h at 37 ◦ C, PBMCs were harvested and RNAs were extracted according to the manufacturer’s protocol (QIAGEN, USA). The cDNAs were prepared from total RNAs by reverse transcription using random nonamers as primers (Takara). In order to monitor non-specific stimulation by peptides, two conserved peptides M19 and M21 that were selected from PRRSV M peptide library were used as the mocks. Cyclophilin A (CyPA) was used as the house keeping gene to normalize the expression level of IFN-␥. Real-time quantitative PCR (qPCR) was performed on the Mastercycler® eppendorf realplex4 (Eppendorf AG 22331 Hamburg, Germany). All samples were tested in triplicate. The primers, probes and conditions used for the multiplex real-time PCR are listed in Table 3. After the standard curve of fluorescent quantitative RT-PCR was determined, the exponential values were calculated based on the amplification rate of the primers. The relative ratio of the sample cDNA/house keeping template DNA was determined. Finally, the relative ratio of an examined mRNA/CyPA mRNA was calculated. 2.8. Statistical analysis All data were presented as the averages ± standard error (SE). The statistical analysis was performed by SPSS 13.0 statistical software. One-way ANOVA was used to evaluate the significant difference among groups through LSD test and Dunnett (double side) test. Difference was considered statistically significant at P < 0.05. 3. Results 3.1. Identification of T-cell epitopes by ELIspot assay In the present study, T-cell immunodominant peptides were identified based on the following criteria: (1) the maximum response was the largest number of IFN-␥ producing cells detected in PBMCs among all 5 pigs tested, (2) the average response was the sum of all IFN-␥ producing cells detected in 5 PBMC samples performed in triplicated cultures divided by 15 (the number of pigs tested multiplied the number of assay repeat times), and (3) the average response per pig was the sum of all of the peptide specific IFN-␥ response of PBMC sample detected in triplicated cultures

Table 3 Primers and conditions of real-time PCR for amplification of IFN-␥ and house keeping genes. Gene source

Primer sequence (5 –3 )

Annealing temperature (◦ C)

Optical plate reading temperature (◦ C)

Products (bp)

IFN-␥ (DQ839398)

Forward: TCAGAGCCAAATTGTCTCCTTC Probe: (FAM)-AACCAGGCCATTCAAAGGAGCA-(TAMRA) Reverse: AAGTCATTCAGTTTCCCAGAGC Forward: GGTCCTGGCATCTTGTCCA Probe: (FAM)-TGCTGGCCCCAACACAAACGGT-(TAMRA) Reverse: TGGCAGTGCAAATGAAAAACTG

95

54

141

95

54

73

CyPA (F14571)

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

111

Table 4 PRRSV isolates and GenBank accession numbers used in this study. Isolates

GenBank accession no.

Origin

Year of isolation

Isolates

GenBank accession no.

Origin

Year of isolation

CH-1a BJ-4 S1 HB-2(sh)2002 HN1 NB/04 SHB JX143 JXwn06 CC-1 HEB1 HUB1 JXA1 HuN HB-1 3.9 VR-2332 16244B NVSL 97-7985 IA 1-4-2 P129 RespPRRS MLV MN184A

AY032626 AF331831 DQ459471 AY262352 AY457635 FJ536165 EU864232 EU708726 EF641008 EF153486 EF112447 EF075945 EF112445 EF517962 EU360130 U87392 AF046869 AY545985 AF494042 AF066183 DQ176019

China China China China China China China China China China China China China China China USA USA USA USA USA USA

1996 1996 1996 2002 2003 2004 2005 2006 2006 2006 2006 2006 2006 2007 2008 1993 1999 2001 2002 2005 2006

SHH HUB2 Henan-1 HUN4 07BJ LN 07NM 07HEN 07QN BJ SY0608 GD NM1 SD-CXA TJ IngeIvac ATP PA8 01NP1.2 Pl97-1 LMY SP

EU106888 EF112446 EU200962 EF635006 FJ393459 EU109502 FJ393456 FJ393457 FJ394029 EU825723 EU144079 EU109503 EU860249 GQ359108 EU860248 DQ988080 AF176348 DQ056373 AY585241 DQ473474 AF184212

China China China China China China China China China China China China China China China USA (Vaccine) Canada Thailand Korea Korea Singapore (Vaccine)

2007 2007 2007 2007 2007 2007 2007 2007 2007 2007 2007 2007 2007 2008 2008 2006 2002 2005 2004 2006 2000

divided by 3. Following these criteria, all data were measured and analyzed using SPSS 13.0 statistical software. Pigs were vaccinated with HuN4-F112 and challenged 28 days later with HuN4 strain. The PBMCs were isolated on day 7 post challenge. In the first round of screening by IFN-␥ ELIspot assay, 6 peptide pools were used to stimulate PBMCs (I1 to VI1 ). As a result, 4 peptide pools (I1 , II1 , III1 and VI1 ) were found to generate equal or even larger values than the averages of the above selection criteria. These data are shown in Fig. 1 and Table 5A. The pool VI1 elicited significantly higher IFN-␥ secreting cells than pool IV1 and pool V1 (P < 0.05). By cross-matching the peptides in 4 pools, 15 peptides M1–M15 were selected to be further evaluated by IFN-␥ ELIspot assay. For the second round of screening, peptides selected as potential stimulators were redistributed into 8 pools as seen in Table 2B. The same screening procedure was carried out as the first round. The results corresponding to the immune response of PBMCs stimulated by 8 peptide pools are summarized in Table 5B and Fig. 1. The

IFN-␥ secreting cells stimulated by peptide pools III2 , IV2 , V2 , VI2 and VII2 were significantly (P < 0.05) higher than those of peptide pools I2 and VIII2 as shown in Fig. 1 and Table 5B. Subsequently, 8 peptides (M2, M3, M5, M6, M8, M9, M11 and M12) were further evaluated for their ability to stimulate PBMCs. In addition, 2 peptides M8-V and M8-C in the position of 57–71 were synthesized based on the sequence difference between the vaccine strain HuN4-F112 and Ch-1a strain and added to the last round of ELIspot assay. In the last round of screening, 4 out of these 10 peptides were identified as the optimal epitope peptides. Peptides M3, M6, M8 and M12 elicited high expression of IFN-␥ and the average numbers of stimulated cells per million PBMCs were 77.9, 92.7, 88.6 and 75.7, respectively, which were significantly (P < 0.05) higher than peptide M2, M5 and M9. However, no significant difference (P > 0.05) was observed between the numbers of IFN-␥ secreting cells elicited by peptides M8, M8-V and M8-C as shown in Fig. 1 and Table 5C. The amino acid changes on position 63 (V to A) and position 66 (E to Q) had no effect on PBMC stimulation.

Fig. 1. Overview of three rounds of screening of peptides by IFN-␥ ELIspot Assay. The capability of each of pools or peptides to stimulate the IFN-␥ production was expressed as the number of IFN-␥ secreting cells per one million PBMCs (ISC/million PBMCs). The maximum response was the highest number of IFN-␥ producing cells detected in PBMCs among all 5 pigs. The average response was the sum of IFN-␥ producing cells in all 5 PBMC samples in triplicate after divided by 15. The white columns represent the maximum response and the shaded columns represent the average response.

112

Table 5 Screening of peptides of PRRSV membrane protein by ELIspot assay. The number of IFN-␥-secreting cells per one million PBMCsa

Selection criteria

II1 f

I1 f A: The first round of screening of 6 peptide pools (I1 to VI1 ) Maximum responseb 29 11.33 ± 1.91 Average responsec No. 1 6.67 ± 2.33 No. 2 15 ± 4.62 d Avg. response/pig No. 3 6.67 ± 3.05 No. 4 19 ± 5.13 No. 5 9.33 ± 3.48

IV1

V1

VI1

f

Averagee

34 16.07 ± 2.60 8.33 ± 2.19 15.33 ± 0.33

23 12.8 ± 1.82 8 ± 1.73 18.67 ± 0.88

37 8.27 ± 2.37 6.33 ± 1.85 23 ± 7.02

16 8.47 ± 0.95 6.33 ± 0.88 11.33 ± 2.60

25 15.53 ± 1.87 18.33 ± 2.03 17 ± 2.08

27.33 12.08 ± 0.85 9 ± 1.21 16.72 ± 1.54

4.67 ± 0.67 24.67 ± 4.41 27.33 ± 4.06

4 ± 1.53 18 ± 3.61 15.33 ± 3.53

3±1 5 ± 1.73 4 ± 0.58

4 ± 1.15 9.67 ± 1.45 11 ± 0.58

3.67 ± 1.67 23.33 ± 1.20 15.33 ± 2.03

4.33 ± 0.54 16.61 ± 2.06 13.72 ± 1.99

The number of IFN-␥-secreting cells per one million PBMCsa

Selection criteria

B: The second round of screening of the redisbuted 8 peptide pools (I2 to VIII2 ) 20 43 Maximum responseb 9.27 ± 1.68 21.6 ± 3.53 Average responsec No. 1 5 ± 1.15 8.67 ± 0.33 No. 2 18.33 ± 0.88 41.33 ± 0.88 Avg. response/pigd No. 3 0.33 ± 0.33 12.67 ± 0.67 No. 4 11 ± 1.15 25.33 ± 6.39 No. 5 11.67 ± 0.88 20 ± 8.14

III2 f

IV2

58 34.67 ± 3.70 33.33 ± 2.73 55.33 ± 1.45

29 17.4 ± 1.65 12 ± 1.53 15.67 ± 3.84

17.33 ± 1.20 43.33 ± 2.33 24 ± 1.73

12.33 ± 1.45 25.67 ± 1.76 21.33 ± 1.45

V2 f

VI2 f

VII2 f

VIII2

Averagee

35 20.8 ± 2.75 15 ± 2.88 29 ± 3.46

39 20.8 ± 2.50 13 ± 0.58 29.33 ± 2.73

49 29.33 ± 3.30 29.33 ± 2.33 47 ± 1.15

16 9.6 ± 1.42 3.67 ± 1.45 13.67 ± 0.33

36.125 20.43 ± 1.19 15 ± 2.18 31.21 ± 3.07

4.67 ± 0.88 29 ± 2.65 26.33 ± 2.73

11.33 ± 0.88 30.67 ± 5.61 19.67 ± 4.26

13.33 ± 0.88 37.33 ± 3.18 19.67 ± 1.20

3 ± 1.15 13.33 ± 0.33 14.33 ± 0.88

9.38 ± 1.19 26.96 ± 2.37 19.63 ± 1.40

The number of IFN-␥-secreting cells per one million PBMCsa M2

M3f

M5

C: Final identification of peptides representing T-cell immunodominant epitopes Maximum responseb 31 170 48 12.1 ± 2.69 77.9 ± 19.58 14.1 ± 5.21 Average responsec No. 1 10.5 ± 3.5 24 ± 6 6±3 No. 2 12.5 ± 2.5 44.5 ± 7.5 5±1 d Avg. response/pig No. 3 7±0 164 ± 6 44.5 ± 3.5 No. 4 26 ± 5 131.5 ± 8.5 11.5 ± 2.5 No. 5 4.5 ± 1.5 25.5 ± 2.5 3.5 ± 1.5

M6f 198 92.7 ± 21.04 38 ± 3 46 ± 3 194 ± 4 138.5 ± 16.5 47 ± 1

M8f

M8-Vf

M8-Cf

M9

M11

261 88.6 ± 29.79 31.5 ± 6.5 39 ± 1

147 68.1 ± 14.16 29.5 ± 9.5 46 ± 7

128 66.9 ± 12.69 34 ± 6 43.5 ± 1.5

25 11.3 ± 2.51 8.5 ± 0.5 5.5 ± 1.5

87 44.1 ± 8.02 29.5 ± 9.5 26 ± 3

259 ± 2 93 ± 22 20.5 ± 1.5

143 ± 4 84.5 ± 8.5 37.5 ± 0.5

109 ± 19 114 ± 12 34 ± 1

14.5 ± 3.5 24 ± 1 4±1

86 ± 1 54.5 ± 1.5 24.5 ± 2.5

M12f 171 75.7 ± 16.36 44 ± 4 36 ± 7 152 ± 19 112.5 ± 9.5 34 ± 6

Averagee 126.6 55.15 ± 5.63 25.55 ± 3.14 30.4 ± 3.81 117.3 ± 17.76 79 ± 10.52 23.5 ± 3.39

Notes: Pigs were vaccinated with attenuated strain HuN4-F112 and challenged 28 days later with highly pathogenic strain HuN4. On day 7 post challenge, PBMCs were isolated. a In the first round of screening (A), PBMCs (5 × 105 cells/well) were stimulated with 5 ␮g/mL of the first 6 peptides pools. In the second (B) and last round (C) of screening, PBMCs were stimulated with the second 8 peptide pools. The data represented in Table 5 were IFN-␥-secreting cells per one million PBMCs detected by ELIspot assay, and the average number of IFN-␥-secreting cells in triplicated PBMC cultures stimulated with peptide pool. In all cases, the background response to mock stimulation with the culture medium was less than 3 IFN-␥-secreting cells. Distribution of peptide pools in Table 2 exhibited the identity of the peptide pools containing PRRSV M epitopes. b The maximum response was the highest number of IFN-␥-secreting cells detected in PBMCs among all 5 tested pigs. c The average response was the sum of IFN-␥-secreting cells in PBMCs of all 5 tested pigs in triplicated cultures divided by 15. d The average response per pig was the sum of the peptide-specific IFN-␥-secreting cells in PBMC sample from each pig detected in triplicated cultures divided by 3. e The average in the far right column of each table represents the number for the corresponding row. f Peptide pools or peptide selected as potential epitopes. The bolded numbers represented the values greater than or nearly equal to the average according to three selection criteria.

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

II2 f

I2

Selection criteria

III1 f

113

14 12 10 8 6 4 2

M3

M6

.4

.3

.5 O N

O N

.2

O N

.1 O

O N

N

.4

.5 O N

O

.3

M8

N

.2

O N

.1 O

O N

N

.5

.3

.4

N

O

O N

.2

O N

.1 O

O N

N

.4

.5 O N

.2

.3 O

O N

N

O

O N

.1

0 N

Relative Ratio of IFN-_ mRNA/CyPA mRNA

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

M12

Fig. 2. Detection of IFN-␥ mRNA levels in PBMCs stimulated by peptides M3, M6, M8 and M12. A total of 5 × 105 PBMCs from individual pigs (No. 1 to No. 5) were incubated with 5 ␮g/mL of each of peptides M3, M6, M8 and M12. PBMCs were collected at 18 h after the stimulation. The IFN-␥ mRNA and CyPA mRNA stimulated by these 4 peptides were measured by RT-PCR (). The mock peptides M19 and M21 were used to monitor non-specific stimulation ().

Finally, 4 peptides M3, M6, M8 and M12 were identified as the potential T-cell epitopes of M protein of the highly pathogenic PRRSV HuN4 strain. 3.2. Detection of IFN- mRNA/CyPA mRNA Real-time PCR results showed that the expression levels of IFN-␥ mRNA/CyPA mRNA of the PBMCs stimulated by 4 epitope peptides (M3, M6, M8 and M12) were significantly (P < 0.05) higher than those by mock peptides M19 and M21 (Fig. 2), which indicated that these 4 peptides elicited high transcription of IFN-␥ in PBMCs. 3.3. Conservation of the identified M protein epitopes in genotype II PRRSV strains In order to determine the sequence conservation of 4 identified epitope peptides, nucleotide sequences and their corresponding amino acid sequences of M protein of 42 North American genotype II PRRSV strains (Table 4) were retrieved from GenBank, including 30 strains from China, 7 strains from the United States and 5 strains from other countries. Multiple sequence alignments were conducted by sequence analysis software Lasergene710Win (DNASTAR Inc., Madison) and ClustalW. The alignment results revealed that these PRRSV strains shared high homology at positions corresponding to each of peptides M3, M6, M8 and M12 (Fig. 3). The sequence of epitope peptide M6 was conserved among all PRRSV strains examined in the study. However, some amino acid replacements were found at other locations. For example, 3 amino acids (N, Q and L) at positions 10, 16 and 19 in peptide M3 were replaced by amino acids H/Y, E and I, respectively. The same amino acid replacements (R for K) occurred at both positions 93 and 107 in epitope peptide M12. As for epitope peptide M8, the replacements of 4 amino acids were found at positions 62, 63, 66 and 70. 4. Discussion Although extensive research has been carried out to study PRRS since its emergence as a devastating swine disease more than 15 years ago, the mystery surrounding the disease and its immunology remains to be resolved (Mateu and Diaz, 2008). Due to the variable features of immune responses to PRRSV, the control of PRRS is a challenge. The development of neutralizing antibody responses is

not only delayed but also may be insufficient to clear the viruses from infected pigs (Mateu and Diaz, 2008). Previous studies have revealed a critical role of the CMI in clearing the viruses. In pigs that recovered from experimental PRRSV infection, lymphocyte proliferative responses were detected by 4 weeks post infection (Bautista and Molitor, 1997; Lopez Fuertes et al., 1999). The IFN-␥ was a main cytokine detected in these pigs (Bautista and Molitor, 1997; Lopez Fuertes et al., 1999). Published accounts have also documented the importance of cytotoxic T cells in clearing other viral infections (Callan et al., 1996; Riddell et al., 1991; Riddell et al., 1992). In the present study, we attempted to locate T-cell epitopes in the M protein of PRRSV. A total of 4 highly conserved epitopes in the M protein of PRRSV strain HuN4 were identified using the IFN-␥ ELIspot assay. The highly pathogenic PRRSV HuN4 strain was selected in this research for its high morbidity and mortality, which was different from the strains reported previously (Li et al., 2007; Tian et al., 2007; Tong et al., 2007). The HuN4-F112 strain is a live vaccine attenuated from HuN4 strain and can effectively protect pigs from a lethal challenge (Tian et al., 2009). The M protein was chosen based on previous studies in which the M polypeptide played a major role in stimulating cellular immunity (Bautista et al., 1999; Jeong et al., 2010). Besides, the M polypeptide gene is the most conserved among all of tested PRRSV isolates. For the identification of epitopes in PRRSV, previous studies have focused on neutralizing epitopes. A main neutralizing epitope designated as epitope B was identified in GP5 (amino acids 37–44) in both American and European strains (Ostrowski et al., 2002; Plagemann, 2004; Plagemann et al., 2002; Wissink et al., 2003). Another immunodominant epitope designated as epitope A was also identified in GP5 (amino acids 27 and 31) and demonstrated to have the characteristics of a decoy epitope (Ostrowski et al., 2002). The decoy epitope may interfere with the immune response of the main neutralizing epitope B, resulting in a delay in the development of neutralizing antibody response. Other neutralizing epitopes were found in GP4 and maybe in GP3 and M (Cancel-Tirado et al., 2004; Meulenberg et al., 1997; Yang et al., 2000). Regarding the CMI to PRRSV, the identification of distinct regions in ORF5 that contained immunodominant T-cell epitopes was based on their ability to induce IFN-␥ secreting cells (Vashisht et al., 2008). Potential T-cell epitopes in GP4, GP5 and N protein of European genotype I of PRRSV were predicted using bioinformatics and tested by IFN-␥ ELIspot assay in pigs immunized with a mod-

114

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115

Fig. 3. Locations of 4 T-cell immunodominant epitopes in membrane protein of North American genotype II PRRSV strains. The amino acid sequences of the membrane protein of 42 North American genotype II PRRSV strains were aligned to show the locations of the 4 epitopes represented by M3, M6, M8 and M12. The identified epitopes with consensus sequences are shown in the box. The dots represent the consensus matches among amino acids.

ified live vaccine or DNA (ORFs 4, 5 or 7) (Diaz et al., 2009). The predicted epitopes included the peptides 5 and 9 for GP4, peptides 7 and 8 for N protein, and peptide 3 for GP5. The location of the 4 T-cell epitopes will contribute to better understanding of the role of the M protein in PRRS immunology. The conservation of identified epitopes was investigated by aligning amino acid sequences of the M protein of North American genotype II PRRSV strains. The epitope represented by peptide M6 was conserved among all of examined 42 strains while epitopes represented by peptides M3, M8 and M12 showed 2–4 amino acid replacements. To investigate the effect of amino acid variations on PBMC stimulation, peptides M8-V and M8-C with amino acid replacements at positions 63 and 66 were synthesized and tested by ELIspot assay. Results indicated that these amino acid changes did not exhibit any effect on their ability to stimulate PBMCs. However, it is uncertain whether or not other changes affect the immunogenicity of peptides. Therefore, additional studies are required to determine the relationship between amino acid changes and the antigenicity of peptides. It has been noted that there are some deficiency in the method and design of the present experiment. The IFN-␥ ELIspot assay is a validated technique for cost-effectively detecting and mapping T-cell responses (Streeck et al., 2009) and has been used to detect antigen-specific T cell responses in human immunodeficiency virus vaccine research (Streeck et al., 2009) and screen immune responses in other diseases (Armengol et al., 2002; Blanco et al., 2001; Leen et al., 2008; Murakoshi et al., 2009; Vashisht et al., 2008). However, no link has been shown between CD8+ T-cell cytolytic activity and IFN-␥ secretion and the responses detected are less antigen-specific. A more comprehensive screening method including several cytokines and/or chemokines is desirable, which allows the detection and screening of additional responses other than IFN-␥ release (Streeck et al., 2009). In addition, the ELIspot assay is not able to directly and definitely show its correlation with

vaccine efficacy or protection in virus infection. For the design of the experiment, there is no standard to discriminate specific peptide from non-specific peptide. A more compelling threshold needs to be set for the judgement of epitopes in the IFN-␥ ELIspot assay. In summary, 4 T-cell epitopes in M protein of HP-PRRSV have been identified. All of these epitopes are highly conserved among PRRSV strains. These findings will contribute to the further understanding of the interaction between antigen and specific T cells and function of the M protein in the development of the CMI. Conflict of interest There is no declared conflict of interest in this study. Acknowledgements The study was supported by grants from NSFC-Guangdong Joint Foundation (U0931003), the Excellent Scientist Program of Shanghai (09XD1405400), the National Basic Research Program of China (973 Program) (no. 2005CB523200), and the National Scientific Supporting Program of China (no. 2006BAD06A04/03/01). References Albina, E., 1997. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): an overview. Vet. Microbiol. 55 (1–4), 309–316. Armengol, E., Wiesmuller, K.H., Wienhold, D., Buttner, M., Pfaff, E., Jung, G., Saalmuller, A., 2002. Identification of T-cell epitopes in the structural and nonstructural proteins of classical swine fever virus. J. Gen. Virol. 83 (Pt 3), 551–560. Bassaganya-Riera, J., Thacker, B.J., Yu, S., Strait, E., Wannemuehler, M.J., Thacker, E.L., 2004. Impact of immunizations with porcine reproductive and respiratory syndrome virus on lymphoproliferative recall responses of CD8+ T cells. Viral Immunol. 17 (1), 25–37. Bautista, E.M., Molitor, T.W., 1997. Cell-mediated immunity to porcine reproductive and respiratory syndrome virus in swine. Viral Immunol. 10 (2), 83–94.

Y.-x. Wang et al. / Virus Research 158 (2011) 108–115 Bautista, E.M., Suarez, P., Molitor, T.W., 1999. T cell responses to the structural polypeptides of porcine reproductive and respiratory syndrome virus. Arch. Virol. 144 (1), 117–134. Blanco, E., Garcia-Briones, M., Sanz-Parra, A., Gomes, P., De Oliveira, E., Valero, M.L., Andreu, D., Ley, V., Sobrino, F., 2001. Identification of T-cell epitopes in nonstructural proteins of foot-and-mouth disease virus. J. Virol. 75 (7), 3164–3174. Callan, M.F., Steven, N., Krausa, P., Wilson, J.D., Moss, P.A., Gillespie, G.M., Bell, J.I., Rickinson, A.B., McMichael, A.J., 1996. Large clonal expansions of CD8+ T cells in acute infectious mononucleosis. Nat. Med. 2 (8), 906–911. Cancel-Tirado, S.M., Evans, R.B., Yoon, K.J., 2004. Monoclonal antibody analysis of porcine reproductive and respiratory syndrome virus epitopes associated with antibody-dependent enhancement and neutralization of virus infection. Vet. Immunol. Immunopathol. 102 (3), 249–262. Cavanagh, D., 1997. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 142 (3), 629–633. Charerntantanakul, W., Platt, R., Johnson, W., Roof, M., Vaughn, E., Roth, J.A., 2006. Immune responses and protection by vaccine and various vaccine adjuvant candidates to virulent porcine reproductive and respiratory syndrome virus. Vet. Immunol. Immunopathol. 109 (1–2), 99–115. Diaz, I., Darwich, L., Pappaterra, G., Pujols, J., Mateu, E., 2006. Different Europeantype vaccines against porcine reproductive and respiratory syndrome virus have different immunological properties and confer different protection to pigs. Virology 351 (2), 249–259. Diaz, I., Pujols, J., Ganges, L., Gimeno, M., Darwich, L., Domingo, M., Mateu, E., 2009. In silico prediction and ex vivo evaluation of potential T-cell epitopes in glycoproteins 4 and 5 and nucleocapsid protein of genotype-I (European) of porcine reproductive and respiratory syndrome virus. Vaccine 27 (41), 5603–5611. Grebennikova, T.V., Clouser, D.F., Vorwald, A.C., Musienko, M.I., Mengeling, W.L., Lager, K.M., Wesley, R.D., Biketov, S.F., Zaberezhny, A.D., Aliper, T.I., Nepoklonov, E.A., 2004. Genomic characterization of virulent, attenuated, and revertant passages of a North American porcine reproductive and respiratory syndrome virus strain. Virology 321 (2), 383–390. Jeong, H.J., Song, Y.J., Lee, S.W., Lee, J.B., Park, S.Y., Song, C.S., Ha, G.W., Oh, J.S., Oh, Y.K., Choi, I.S., 2010. Comparative measurement of cell-mediated immune response of swine to the M and N proteins of porcine reproductive and respiratory syndrome virus (PRRSV). Clin. Vaccine Immunol. 17 (4), 503–512. Keffaber, K.K., 1989. Reproductive failure of unknown etiology. Am. Assoc. Swine Pract. Newsl. 1, 1–10. Leen, A.M., Christin, A., Khalil, M., Weiss, H., Gee, A.P., Brenner, M.K., Heslop, H.E., Rooney, C.M., Bollard, C.M., 2008. Identification of hexon-specific CD4 and CD8 T-cell epitopes for vaccine and immunotherapy. J. Virol. 82 (1), 546–554. Li, Y., Wang, X., Bo, K., Tang, B., Yang, B., Jiang, W., Jiang, P., 2007. Emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet. J. 174 (3), 577–584. Lopez Fuertes, L., Domenech, N., Alvarez, B., Ezquerra, A., Dominguez, J., Castro, J.M., Alonso, F., 1999. Analysis of cellular immune response in pigs recovered from porcine respiratory and reproductive syndrome infection. Virus Res. 64 (1), 33–42. Lopez, O.J., Oliveira, M.F., Garcia, E.A., Kwon, B.J., Doster, A., Osorio, F.A., 2007. Protection against porcine reproductive and respiratory syndrome virus (PRRSV) infection through passive transfer of PRRSV-neutralizing antibodies is dose dependent. Clin. Vaccine Immunol. 14 (3), 269–275. Lopez, O.J., Osorio, F.A., 2004. Role of neutralizing antibodies in PRRSV protective immunity. Vet. Immunol. Immunopathol. 102 (3), 155–163. Mateu, E., Diaz, I., 2008. The challenge of PRRS immunology. Vet. J. 177 (3), 345– 351. Meier, W.A., Galeota, J., Osorio, F.A., Husmann, R.J., Schnitzlein, W.M., Zuckermann, F.A., 2003. Gradual development of the interferon-gamma response of swine to porcine reproductive and respiratory syndrome virus infection or vaccination. Virology 309 (1), 18–31. Meulenberg, J.J., Hulst, M.M., de Meijer, E.J., Moonen, P.L., den Besten, A., de Kluyver, E.P., Wensvoort, G., Moormann, R.J., 1993. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192 (1), 62–72. Meulenberg, J.J., Petersen den Besten, A., de Kluyver, E., van Nieuwstadt, A., Wensvoort, G., Moormann, R.J., 1997. Molecular characterization of Lelystad virus. Vet. Microbiol. 55 (1–4), 197–202. Murakoshi, H., Kitano, M., Akahoshi, T., Kawashima, Y., Dohki, S., Oka, S., Takiguchi, M., 2009. Identification and characterization of 2 HIV-1 Gag immunodominant epitopes restricted by Asian HLA allele HLA-B*4801. Hum. Immunol. 70 (3), 170–174. Murtaugh, M.P., Elam, M.R., Kakach, L.T., 1995. Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus. Arch. Virol. 140 (8), 1451–1460.

115

Ostrowski, M., Galeota, J.A., Jar, A.M., Platt, K.B., Osorio, F.A., Lopez, O.J., 2002. Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J. Virol. 76 (9), 4241–4250. Plagemann, P.G., 2004. The primary GP5 neutralization epitope of North American isolates of porcine reproductive and respiratory syndrome virus. Vet. Immunol. Immunopathol. 102 (3), 263–275. Plagemann, P.G., Rowland, R.R., Faaberg, K.S., 2002. The primary neutralization epitope of porcine respiratory and reproductive syndrome virus strain VR-2332 is located in the middle of the GP5 ectodomain. Arch. Virol. 147, 2327–2347. Polson, D.D., Marsh, W.E., Dial, G.D., 1992. Financial evaluation and decision making in the swine breeding herd. Vet. Clin. North Am. Food Anim. Pract. 8 (3), 725–747. Riddell, S.R., Reusser, P., Greenberg, P.D., 1991. Cytotoxic T cells specific for cytomegalovirus: a potential therapy for immunocompromised patients. Rev. Infect. Dis. 13 (Suppl. 11), S966–S973. Riddell, S.R., Watanabe, K.S., Goodrich, J.M., Li, C.R., Agha, M.E., Greenberg, P.D., 1992. Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones. Science 257 (5067), 238–241. Rowland, R.R., Robinson, B., Stefanick, J., Kim, T.S., Guanghua, L., Lawson, S.R., Benfield, D.A., 2001. Inhibition of porcine reproductive and respiratory syndrome virus by interferon-gamma and recovery of virus replication with 2-aminopurine. Arch. Virol. 146 (3), 539–555. Semeniuk, C.A., McKinnon, L., Peters, H.O., Gubbins, M., Mao, X., Ball, T.B., Luo, M., Plummer, F.A., 2009. Multiple T-cell epitopes overlap positively-selected residues in the p1 spacer protein of HIV-1 Gag. AIDS 23 (7), 771–777. Stadejek, T., Stankevicius, A., Storgaard, T., Oleksiewicz, M.B., Belak, S., Drew, T.W., Pejsak, Z., 2002. Identification of radically different variants of porcine reproductive and respiratory syndrome virus in Eastern Europe: towards a common ancestor for European and American viruses. J. Gen. Virol. 83 (Pt 8), 1861–1873. Streeck, H., Frahm, N., Walker, B.D., 2009. The role of IFN-gamma ELIspot assay in HIV vaccine research. Nat. Protoc. 4 (4), 461–469. Thiel, H.J., Meyers, G., Stark, R., Tautz, N., Rumenapf, T., Unger, G., Conzelmann, K.K., 1993. Molecular characterization of positive-strand RNA viruses: pestiviruses and the porcine reproductive and respiratory syndrome virus (PRRSV). Arch. Virol. Suppl. 7, 41–52. Tian, K., Yu, X., Zhao, T., Feng, Y., Cao, Z., Wang, C., Hu, Y., Chen, X., Hu, D., Tian, X., Liu, D., Zhang, S., Deng, X., Ding, Y., Yang, L., Zhang, Y., Xiao, H., Qiao, M., Wang, B., Hou, L., Wang, X., Yang, X., Kang, L., Sun, M., Jin, P., Wang, S., Kitamura, Y., Yan, J., Gao, G.F., 2007. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS One 2 (6), e526. Tian, Z.J., An, T.Q., Zhou, Y.J., Peng, J.M., Hu, S.P., Wei, T.C., Jiang, Y.F., Xiao, Y., Tong, G.Z., 2009. An attenuated live vaccine based on highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) protects piglets against HP-PRRS. Vet. Microbiol. 138 (1–2), 34–40. Tong, G.Z., Zhou, Y.J., Hao, X.F., Tian, Z.J., An, T.Q., Qiu, H.J., 2007. Highly pathogenic porcine reproductive and respiratory syndrome, China. Emerg. Infect. Dis. 13 (9), 1434–1436. Vashisht, K., Goldberg, T.L., Husmann, R.J., Schnitzlein, W., Zuckermann, F.A., 2008. Identification of immunodominant T-cell epitopes present in glycoprotein 5 of the North American genotype of porcine reproductive and respiratory syndrome virus. Vaccine 26 (36), 4747–4753. Vezina, S.A., Loemba, H., Fournier, M., Dea, S., Archambault, D., 1996. Antibody production and blastogenic response in pigs experimentally infected with porcine reproductive and respiratory syndrome virus. Can. J. Vet. Res. 60 (2), 94–99. Wei, T.C., Tian, Z.J., Zhou, Y.J., An, T.Q., Xiao, Y., Peng, J.M., Jiang, Y.F., Tong, G.Z., 2009. Development of a TaqMan fluorescent quantitative real-time PCR assay for detection of porcine IFN-␥ mRNA. Chin. Vet. Sci. 39 (02), 168–172. Wensvoort, G., 1993. Lelystad virus and the porcine epidemic abortion and respiratory syndrome. Vet. Res. 24 (2), 117–124. Wissink, E.H., van Wijk, H.A., Kroese, M.V., Weiland, E., Meulenberg, J.J., Rottier, P.J., van Rijn, P.A., 2003. The major envelope protein, GP5, of a European porcine reproductive and respiratory syndrome virus contains a neutralization epitope in its N-terminal ectodomain. J. Gen. Virol. 84 (Pt 6), 1535–1543. Yang, L., Frey, M.L., Yoon, K.J., Zimmerman, J.J., Platt, K.B., 2000. Categorization of North American porcine reproductive and respiratory syndrome viruses: epitopic profiles of the N, M, GP5 and GP3 proteins and susceptibility to neutralization. Arch. Virol. 145 (8), 1599–1619. Zhou, Y.J., Hao, X.F., Tian, Z.J., Tong, G.Z., Yoo, D., An, T.Q., Zhou, T., Li, G.X., Qiu, H.J., Wei, T.C., Yuan, X.F., 2008. Highly virulent porcine reproductive and respiratory syndrome virus emerged in China. Transbound. Emerg. Dis. 55 (3–4), 152–164. Zinkernagel, R.M., Bachmann, M.F., Kundig, T.M., Oehen, S., Pirchet, H., Hengartner, H., 1996. On immunological memory. Annu. Rev. Immunol. 14, 333–367.