Identification of multiple promoters within the N-ras proto-oncogene

Bioch et Big

Biochimica et BiophysicaActa 1219 (199~

ultiple promoters wit i

1

N-ras proto-on

Jeffers, Angel Michael Jeffers Department of Pathology (and Kaplan Cancer Center), Ne New York Unit

Center, New York NY 10016, US~

7 March 19 Received 21

raet -ras possesses a 'housekeeping' promoter, being G + C-rich C-rich and devc ~-box. Transcription initiates ions within this gene, a phenomena that is generally attribut attributed to the TATA-box. In this report we bility that multiple promoters, which could potentially contribute contribl to the c d heterogeneity, exist within tl The 5' region of the gene was subdivided into several fragme ments, each corresponding to a reg ion in which one or m tion site(s) had been mapped, and the ability of each fragmenl gment to express a reporter gene was assessed. Promoter acl associated ',iated with three independent, non-overlapping fragments, two of which were located entirely,within transcribed regi We found ound that these intragenic promoters were able to express the N-ras gene itself, as well as the th reporter gene. In adc that the he activity of an intragenic promoter fragment was dependent upon the presence of regions er encompassing initiation smallLfragment ( ~ 40 bp) encompassing several initiation sites possessed I promoter activity. These Th data support the ' initiator' ator' element within the N-ras gene. Overall, our results dem demonstrate that multiple promoter,~ :omoters reside within N-ras ~ they may play a role in generating the observed mRNA 5' end heterogeneity. hetc The identification of multiple promoters w have important implications regarding the regulation of expressio 9resslon of this gene in normal and malignant tissues. In a number ~er of other genes with housekeeping promoters also initiate Itranscription at multiple locations, locatior it is possible that t multiple ole rpromoters may ty rel~ reoresent a common feature of this class of genes. Keywords: N-ras, proto-oncogene;Multip dultiple; Promoter; Expression

1. I n t r o d u c t i o n R a s comprises a highly conservec 7red superfamily of guaonserved nine-nucleotide-binding-proteins ;ins that is represented in all eukaryotic organisms (reviewed 'ed in [1]). In mammals, there are at least 35 ras genes which ich can be categorized into at least three sub-families (ras, rho, and rab) based on sequence relationships (reviewed ~¢ed in [2]). N-ras, H-ras, and K-ras are three members off the ras sub-family which encode similar yet non-identical tical proteins that have been implicated in the normal cellular alar processes of proliferation [3,4] and differentiation [5-7] 7], as well as the abnormal process of transformation [8,9]. 9]. The proteins of these ras genes are believed to serve as signal transducing molecules by conformationally switching from an inactive state (GDP-bound) to an active state Lte (GTP-bound) upon receiving the proper stimulus. We are interested in studying th

three ras genes. The importance ix of gainil understanding of the mechanisms m~ which re pression of these genes is underscored by r that the alteration of normal control mec contribute to the develo ,pment 1 of some cane the most commonly re r~orted tumor-associ~ ras is a point mutatio] nutation which generates (activated) protein [1], there tt have also been overexpression in some human 1 tumors [10], rived cell lines [11]. In addition, overexpre~ shown to impart oncogenic oncogl properties to a non-activated) ras gene in vitro [12,13] ant and to enhance the onco~genic potential of an gene in vitro [15,16]. It is thus important t~ question of expression when attempting to c that ras plays in cancer. has previously investigat~ ',nes in developing and adu In that study, although eac and to be expressed throu~ , adult tissue examined, si~

Jeffers, A. Pellicer / Biochimica et Biophysit

variations in expression tern of expression being rnurine and human N-ras [22,23] genes have been msekeeping' variety [24] a TATA-box. However, differential regulation of rmal tissues, and for their ~gulation in some malignancies, are incompletely untood and require further characterization. Ve have focused our attention on understanding the dation of the murine N-ras gene, and have thus far Ltified regulatory elements in the 5' flanking region [18] in transcribed regions [25] of the gene. We have also •acterized a gene which may influence N-ras expresby virtue of its close linkage with N-ras [26]. n the present study we present evidence for the exise of multiple promoters within the murine N-ras gene. ; finding may have important implications regarding regulated and deregulated expression of N-ras itself, perhaps also of other genes which initiate transcription mltiple locations from housekeeping promoters.

need lulo~,

+ RNA was prepared by tromatography [28].

2.2.

~sion assay

P stare as pl corn] muri CA( GCI detai cleol

ion analysis was performed 1 [29] using two separate o of the primers correspond sequences from within c me; primer PR1 reads 5'-~ FCAGTCAT-3' and primer ~CACCACCTGCTC-3' (s~ rimer was end labeled wi nd [y-32p]ATP, and 5 • 105 was RNA and precipitated wit dissolved in water, dried, sam t hybr ffer, denatured at 85°C, ar 37°C The samples were then pr ethaJ d with Moloney murine ] revel tase, digested with RNase, phen m (1:1), and again pre ethanol. After resuspem ethat ~ension and denaturatk samples were separated on a polyacrylamid~ and exposed to film.

2. Materials and methods

2.3. Transfections

2.1. RNA preparation

Calcium phosphate mediated transfecti formed according to an established protocol prior to transfection, the cells were seeded a mm plate in complete medium l (Dulbecco': gle's medium containintg I 10% calf serum a On the day of the transfection, transfq the cells wer ml of complete mediur medium. Precipitates were plasmid DNA at 18 /xg/ml. /xg Cells to be us assays were transfected sfected with 15 /zg/ml o plasmid and 3 /zg/ml of a plasmid encod sidase plasmid p C H l l 0 Ref. [30]; cells to be were transfected with 18 1~ /xg/ml of experin A 1 ml volume of pr~ precipitate was added

'~NA was isolated by guanidinium isothiocyanate lysis RNA )wed byy centrifug centrifu~ation through tgh a CsC1 cushion [27,28]. ', followed RNA from transfected cells was ~¢as harvested 48 h post-transfection and contaminating DNA NA was removed by treatment with RNase-free DNase I [28]. For the preparation of cytoplasmic RNA from cell line TF1, the cells were lysed in a buffer containing 10 mM Tris (pH 7.4)/10 mM NaC1/3 mM MgC12/0.5% NP-40 and centrifuged twice ~NA was prepared from the for 10 min at 1 0 0 0 × g . RNA supernatant obtained after thee second centrifugation. Testis tdult C57BL/6 mice. When RNA was obtained from adult

:ne tan tandem is presented in A. "I Fig. 1. A portion of the murine unr~/N-ras gene tandem. A diagram of a portion of the unr/N-ras gene used to initiate transl le first two exons of N-ras (exon - 1 and exon 1). The location of the ATG A' region of unr is depicted, as are the ene is illustrated by an ast protein is illustrated by an asterick in exon 1, while an ATG present in the 5' untranslated region of the gen tha have been identified in Vertical lines extending from exon - 1 and exon 1 depict the locations of the transcription initiation sites that oup is depicted with an arrow (se de sites have been organized into three groups: 1, -1A, and -1B, and the most 5' initiation site in each group details). The sequence presented in B has been organized into regions which correspond to the diagram shown in A. Most of the sequen ank accession number for this sequence is L19607. Restriction sites that were used for p r e p a r i n g , previous reports [25,31]. The GenBank acces are indicated. The 'XhoI' s ion are shown, although not all of the recognition sites for each enzyme arc constructs for the present investigation onto the 5' end of an N-ras myme, but rather signifies the region at which an XhoI linker was added on actually a recognition site for this enz constructs. Two Dolvadenvlation si~,nals in the 3' untranslated reg re,ion of unr are underlined. that was used in preparing some of' the const 'he arrows pointing to the right re] signals in the rat gene are known to be functi ntified in this report. The arrows encompassed by the three groups of transcrip 3 used to initiate translation of the represent the primers used for the primer extel on sites for various transcription f~ asterick at nt 637 illustrates an ATG located i

% A. Pellicer/Biochimica et Biophysica Act,

N- ras -ID -1A

I J

II

i a oo-Iq* i

I

I

I

Vt

il

I

~[Xll I ]

B. A if'. 1

CTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTAAAAA

'AATA,ATAAAA#UkGTTGTG"

81

'AGCCCCGTGGTTCCAGTGC CCTGAAATGAATCCTGTTTTTTTTAATAAATAGCCCCGTGG

:AGGCACTTGATCCTTGGT

161

"TTTGTATCACGGGAACGGATTGGCCTGATTTCTC GTAGCTTCTGTTCAACTTTGTATCACGGGAACGGATTGGCC

'GAATTGGCCCCAAACAGG

241

=Xhol"

3'ut

GTGAAGGCTTTTTGTCTAACAATGACAAGGGI GTCCCTGGCAAGTGGAGTGAAGGCTTTTTGTCTAACAATGA GTGGAGTGAAGGCTTTTTGTCTAACAATGACAAGGGTCAGCTCAGGGGTTGTCGGGC~ k~CGCTT~

321 TCTTCCCCGTTGTCATTTGAGGTTTTGAACTCTGGGTAAAG ~-GAGGCCGTTTATCTTTGTAAACACAAAAC UkACATTTTTGCTTT 401

P~IW A *dd'n CTCCGGTTTTATGTTAATGGCGAAAGAATGGAAG~TAA AGTTTTACTGATTTTTGA

460

GACACTAGCACCTAGCGCTTTCATTATTGAAATGG~GCG~ ;IGGGC@GC~GCTGGACTGGGTGCGGCCGGC,CTGCAAGACTCTA

Eco47111

SPI

8Pl

USFIc-Myc SPl 540 GTCGTCGGC+~ ~CGT---~aCT(~GACTGCCGTGGCGCCTAGTGATTACGTAGCGG J-l~ -IB 599

G T ~ C C G A A G T~*GTGCCGCTCCCTGGCGGC~CTGTTCATGGCGGTTTCGGGGTCTCCAACAGCTCJ~GG, GCI TCAGGTTGAAGTCCAAA]H - fdl~*

AvII

J'4~ - IA

J DcOn -

679 AGCCTCCCGAGGCG ~CGGGCTGCGGAGT'TTGAG

liml

$Pl

709 GTAAAGCTCCGGCCT( ~CCTGCCTGGCGTCGGACTTCTCAGCGTGTGAACGCTGGCG~GACGCGGJ ~CGGAGACTTGGCGAG 789

CTGAAACAAAGGCTTGGGT ~GTGGGGGACTCTGGC ;CTTGGGTGGGGGACTCTGGCTGGCTCTGGGGTGATTTTCGGAGCCGGAAAGGGGAG~ GGGAGTTTCGGGARGTG

869

GTTGTGCCAGGCGGAC( .'GC-~CCCCAGAGCTTGGGTTTGCAGGAATTGGAAGAGGGGGGTTCTTTTCCCGTAAA( ~.ACTGAGGCGGC, GC

949

imTJ GAGTAGATTGAAAAA] %AAAATAGTCGCTGGTCTTTAATCCAATAATCTGGCCCGCACTCATCTGCAAGGAAT( GAATGCTATGTTTCTG

N- r~

Intron

USFI©-My{ T*ql 1029 AATCACTTTGAGAACT GGTAAACTCATAGA Ia~.CTTAGTGGAAGG~ A TCGAA TGGGT GCCTTAGAAACA GAAGAGTTTGG I

Fnu4HI

1109 AGCCCTTGAAG~L'ATTGTAGGTTTGGTTTGCCAGTTTAATCGTAATTGCTGCTTTTCTACAG

=

l170

GTTTTTGCTGGTGTGAAAT

A~UkGCGCCCTGACGATCI H- r4~r J F..xon I

Jeffers, A. Pellicer/ Biochimicaet Biophysic nal concentration of 100 the cells for 5 h at 37°C, ~,ashed and then shocked n at 37°C. After washing vas added, and the cells ditional 48 h.

~he CAT assays were performed as described [29]. Cell ets were collected, resuspended in 175 /.,1 of 0.25 M (pH 7.8), and disrupted by 3 freeze-thaw cycles. The dactosidase activity in a 5 / z l (3T3) or a 30/xl (HeLa) uot was determined and the extracts were heated to for 10 min, normalized for /3-galactosidase activity, then used in the CAT assay. Each extract was incud with 10 ml of 14C-labeled chloramphenicol and yl coenzyme A for 45 rain at 37°C and then extracted t ethyl acetate. The samples were dried, resuspended in /zl of ethyl acetate, separated on a thin-layer chroography (TLC) plate using a solvent of chloroformhanol (95:5), and exposed to film.

2.5. RNase protection assay tadiolabeled antisense RNA probes were prepared from Radiolabeled an in vitro transcription system (Stratagene) using the vectors ors described under 'Preparation of constructs'. The ors were linearized with BamHI and incubated with vectors RNA polymerase and a ribonucleotide mixture containT3 RNA were then treated with DNase ing [[Og-32P]CTP. The samples [ )roform (1:1), and precipitated I, extracted with phenol-chloroform red RNA was then solubilized with ethanol. The radiolabeled IO1 for a second time. After and precipitated with ethanol tion into each probe was asresuspension, the incorporation nting. The RNase protection sessed by scintillation countin Ling to an established protocol assay was performed accordin [29]. RNA in water was driedd and resuspended in 30 /~1 of taining 5.105 cpm of probe. hybridizidation solution containin The samples were denatured at 85°C and then incubated at °C (all other probes) for 12 h. either 30°C (probe R) or 55°C Samples were then digested with RNase TI (2 /xg/ml) and RNase A (40 /xg/ml) at 30°C, proteinase K treated, tracted, and precipitated with phenol-chloroform (1:1) extracted ethanol. After resuspension and denaturation at 95°C, the samples were separated on a polyacrylamide/8 M urea gel and exposed to film.

2.6. Northern blotting 11 /xg/lane of RNA ( DNase I treated) were elec-nse-fnrmaldehvde ~el. treated trophoresed on a 1.2% agarose-forr with 0.05 M NaOH, and transfem cellulose [29]. Probes were labele~ according to the manufacturers

The men1 porti fragl from 55°(

~s probe is a BgllI/RsaI bp which contains all of 6 [31]. The actin probe human /3-actin cDNA (c Filters were washed witt d to film.

2.7.

of constructs

F ration of the constructs u,~ prob ~ase protection assay, varic blun subcloned into the Sm id (Stratagene). The N-ras Blue CAT insert is a 254 bp J liste~ fragl CAT gene that was excise~ pSV aration of the CAT cons F It ended and subcloned int~ insel pCO [34], which had beeJ less it ended with Klenow. Tt Bam p fragment from a unr cI insel 3i ~SOO-lZ1O trom Pig. 3 of o Ref. [26]). The ( + 800simplex virus immedi encodes the herpes sin N-ras insert promoter [34,35]. The various x below. All of the restriction restriq sites are authe onto the end ot XhoI which was linkered linker nomic fragment. See FiLg. 1B for details on these fragments within the 1 N-ras gene. B 513 bp AvaI/RsaI M 426 bp XhoI/AvaI N 806 bp XhoI/TaqI O 938 bp XhoI/RsaI /AvaI P 210 bp Eco47III/A~ Q 307 bp AvaI/BstXI R 207 bp BstXI/RsaI 4HI S 431 bp BglI/Fnu4H T 43 bp AvaI/BglI U 41 bp Fnu4HI/RsaI For the preparation of the N-ras deletk structs, various fragme',nts of the N-ras gt ended and subcloned, in the same orient Bluescript plasmid. The v Sinai site of the Bluest fragment consists of ~ 8 kb of the muril ctivating mutation at coc containing an activatir begins at an artificial XhoI site that lies 3, nitiation site (see Fig. 1B) of the most 5' initiatio 1587 bp into exon 6 [31]. [3 To create the e~ was partiall (EX-1), the wild type fragment fI AvaI and the resulting 7.58 kb product fragment begins 24 bp upstream of the exo junction (see Fig. 1B)~and continues 1587 [31]. To create the intron intr~ 1 mutant (INT1) gested with BglI and the re ]. This fragment begins 19 1/intron 1 junction (see ~p into exon 6 [31].

Jeffers, A. Pellicer / Biochimica et Biophysic

!title locations within the

a distance of approx. 11 31]. The first exon (exon 1 6) are noncoding, while 3, and 4) encode the ras

A .

-IB I

U/7/"

ion, a gene called unr r( 126]. Unr and N-ras are an md are separated by only r to determine the locatic ates within the N-ras gem primer extension and RN

prote stre~ to he Fig. trans this assa) In and 1

extension assay, oligonuq ~mentary to regions of N-r~

-I& IF]

I t O0-bp t

I

N- re:

3" ut

~--PRI ~--PR2

B.

NTE I R N A G

A

T

C

Prlmer PRI

1 RNA

i~rlmer Imer

Primer PR2

Testis

RNA

Primer PRI i:ii~ii

PRI

150 -

' il :~)j

i

.

- i II "

.....

-Ill

-ill

leO"

!iiiii!i i

.......

I00-- )

ii~i~iiiiii!i

- IA

;~ -IA

-IA

50-

.......~i

2

i

? !;

Fig. 2. Analysis of N-ras transcription m initiation sites by primer extension. A diagram of a portion of the the muurine unr/N-ras gene tan A (see Fig. 1 for further details). The,~ location of the nrimers. PR1 and PR2. used to nerform the assav are shown ~ha~ under exon 1. Results and C. In B, 7 / z g of cytoplasmic poly(A) + m t ~ere hybridized to primer PR1 or 1 were analyzed along side of a sequencing re DNA) on an 8% denaturing ge cytoplasmic poly(A) + m R N A from NTF1, or vere hybridized to primer PR1. q analyzed along side of a sequencing reaction o of initiation in NTF1 and testis R Fig. 3B).

Jeffers, A. PeUicer / Biochimica et Biophysic

sources (Fig. 2). In Fig. bridized to R N A from a )verexpresses N-ras. The initiates at multiple locaone of the sites m a p p i n g ~rently, to exon - 1. The ave b e e n organized into ich are illustrated in Fig. ion sites included in the :ams were confirmed by both primers. Similar sites of ttion were detected using R N A from an i n d e p e n d e n t transformant which overexpresses N-ras (not shown);

thus a nul testis level detec partk ple, arro~ RNA W initia assay

re most likely authentic. W ation sites using R N A fro1 tissue k n o w n to express a 7]. Some of the sites corre ~TF1 R N A but difference itiation sites from group -1 g initiation site in NTF1 ~NA lane) is not even del stigated the location(s) o RNase protection assay (Fi al series of three probes

A. -IA

-IB

I

I O0-bp [

-1

I--I R

m

///7/-

N-

3" at

[

ras

I P

i

Q I

R

C.

B. PROBE NTF I

3T3

P

NTFI

TS

(~)

PROBE Q TS

NTFI

D. PROBE

(-)

NTF!

i ii i ii~i i!ii! i i i ~i i

(-)

............

75 - ~

124--

_ 104 --

TS

R

.......

:

89~I

~

iil

)?r

!

80-

,,o,

ii ii

74 ~

iil

3 t

~,-

~ii!i~ii!ii!ii !!i! ii!i i ;

25

2s~i!i!ili~!!!!i!!ii i

Fig. 3. Analysis of N-ras transcription ion initiation sites by RNase protection. The probes are depicted in A under un a diagram of a porti ove N-ras (NTF unr/N-ras gene tandem. Results are', shown in B, C, and D. R N A from 3T3 cells, a 3T3-derived cell line overexpressing bridized to 25/.~g of total RNA fr testis (TS) was hybridized to the various [ous probe probes, as was tRNA as a ( - ) control. In B. Probe P was hybridized rlucts were analyzed along side o and NTF1, 5 /.tg of poly(A) + mRNA from a( ~,o NTF1 lanes which was expos weight markers on a 6% denaturing gel. Each arrows indicate some of the major products. In otect 1.5 ~g of cytoplasmic poly( cell line NTF1, 6.4/zg of poly(A) + mRNA fn products were analyzed along sid

Jeffers, A. Pellicer / Biochimica et Biophysic

S within the 5' region of nd used to protect RNA Je P) on R N A from cell and 74 nt are protected ~sponds closely in size to ated at a site of strong r extension analysis (see lane). In support of the enticity of these products, the protection of 3T3 RNA probe P was found to produce a set of products lar in size to those generated by probe P with RNA t cell line NTF1. When the NTF1 R N A protected with e P is exposed for a longer length of time, a number of tional protected fragments are detected. This result ~sponds closely with that of the primer extension assay :h had demonstrated the existence of multiple sites of ;cription initiation (represented by group -1B) in the )n encompassed by probe P. When probe P is used to ,~ct mouse testis RNA, a major product of 74 nt is :ted. This product corresponds closely in size to the ~ction of transcripts initiated at a site of strong initia-

tion d by primer extension anal testis Fig. 2C; arrow in testis ] addit minor products are also s primq and RNase protection assa'. the I~ nultiple initiation sites in1 and in the region encompasse, Both also indicate that there are the itiation site selection betw muriJ U: t in the series of RNase pro (prol: :A from testis or cell line 1 prodl p is detected (Fig. 3C). corre fly to the size that would b prote entire portion of probe Q ' exon :es, and therefore probably prote scripts that have been initi locat ;xon - 1 (i.e., transcription from as identified by primer subst ced at the exon - 1 / i n t r o n addit smaller products which [] to the of transcripts initiated at va at the the very 3' end1 of exon exc - 1 (i.e., transcri

A. I ! OO-bp I

N- ras -IB U~P

I

-IA

~

3" ut M Q R 0

B. 3T3

HeLa

None ~e(-) (÷) M N O g R R(~) Q None(-) (+) M N O B R R(ct) O Fig. 4. CAT assay-derived evidence for the existence of multiple promoters within the N-ras gene. The fragme ments of the N-ras gene th into the promoterless CAT vector, pCO, ~'O,and and su subsequently analyzed for promoter activity via the CAT assay, y, are depicted in A under a dil of the unr/N-ras gene tandem. Results Lltsare presented in B. The construct in the lane labeled NONE is the pCO' pCOvector without an insert; R(ot) is pCO containing fragment R~,in the antisense orientation: the ( - ) control in.~ert i~ a 411 bn fraorne.nt !ragment from a unr cDNA clon( insert is the herpes simplex virus immediate-el 3T3 and HeLa cells, along with a /3-galactosidase. Extracts were prepared from =tivity, and used in the CAT assl extract equivalent to 0.53 (3T3) or 0.076 ( le. The samples were separated chromatography (TLC) plate and exposed to t nt transfections yielded essentiall

Jeffers, A. Pellicer / Biochimica et Biophysk

I by primer extension) are ~d for a longer period of tically possible that the represent the products of rather than the 5' end of transcripts initiated from an - 1. However, since of probe Q would protect we do not detect such a tuct with this probe (not shown),), the fragments pro~d by probe Q must represent transcripts that have ated from within exon - 1 and not intron 1. Vhen the last of the series of RNase protection probes be R) is used on RNA from testis or cell line NTF1, ected fragments of ~ 31 and ~ 29 nt are detected

(Fig. size porti there that (i.e., as id at th corr~ exov idenl It even time initi~

arger fragment corresponds, be expected for protectioJ R which encodes exon 1 ly represents the protectiol nitiated at various locatioz n initiation sites from grou ! ~rimer extension) and subse xon 1 junction. The smallel e protection of transcripts ranscription initiation site f her extension). I to note that neither probe ing the respective blots for gments of a size that wou curred from within intron

A. ///7/"

~

-IB

-IA

I

II--1

I

I-I

3" ut

11oO-bpI

I

Veffq tl R

Varq

B°

CAT M

N

0

PROBE B

P,

Roc

0

M ~

~ene. The fragments of the Nred evidence for the existence of multiple promoters within the N-ras gene Fig. 5. RNase protection assay-derived ¢ ~ via the RNase protection assay, subcloned into the promoterless CAT vector lstruct in the lane labeled R ( a ) under a diagram of a portion of the unr/N was prepared 48 h post-transfectiq fragment R in the antisense orientation. The p dth RNase, and analyzed along si DNase I. 30 /xg of RNA from each sample

Jeffers, A. Pellicer / Biochimica et Biophysic

~r extension and RNase epresent transcripts that exon - 1 and 1. of multiple promoters m-overlapping fragments e gene possess promoter

Eaving determined that there are multiple sites of tran~tion initiation scattered over a relatively large portion te 5' region of the N-ras gene, we were interested in maining whether multiple promoters, which could percontribute to the observed heterogeneity, were operat~ithin this region. o investigate this possibility, we subdivided the 5' )n of the N-ras gene into three non-overlapping fragts (M, Q, and R) and assessed the ability of each laent to express a reporter gene (Fig. 4). Each fragt corresponds to a region of the N-ras gene in which

A.

one ( ment ident -1A, subc] feras vectc CAT latiot the k [341. HeL~ CAT indic N-ra (M, ( HeL, does cell 1 with

scription initiation sites are asses initiation sites from mer extension), fragment nt R from group 1. The f am of the chloramphenicc ae in a promoterless vectc ntains a polylinker just u l herpes simplex virus-deri~ downstream of the CAT gq of fragments containing pr( tcts were transfected into extracts from the cells we e results, which are presen ', are indeed multiple promc ,' each of the non-overlap[ xhibit promoter activity in ment R in the antisense ( the expression of the CAT ing that the promoter acti, is orientation-dependent. N

N- r a s L/C/C"

-IB

-l&

I

11-I

itoa-~l I

F-]

3" ut latron I mutant (IHTi) r

Exon

-

I m u t a n t (EX- 1) w

Wild tvpe (WT)

C

B,

ACTIN

N-ras WT

EX-|

INTI

(-)

WT

EX- I

INTI

(-1

Fig. 6. Demonstration via Northern blottin )lotting that the intragenic promoters can express the N-ras gene. The mute mutants are depicted in A u m portion of the unr/N-ras gene tandem. m. Mutant INT1 be~,ins at a location towards the 5' end of intron 1 while m mutant EX-1 begins at a 1~ 3' end of exon - 1. The wild type (WT) gene lding a portion of unr). Each of I location 1587 bp into exon 6. The genes were mluding the Bluescript vector witl ( - ) control, were transfected into HeLa cells. ated with DNase I. 11 ~ g / l a n e o sample were separated on a 1.2% agarose-f B, the membrane was hybridize )be.

leffers, A. Pellicer/ Biochimica et Biophysic~

a negative control insert cell type, indicating that om vector pCO requires sing promoter activity, promoter-associated reere interested in examinining greater than one of ~ral additional fragments +ubcloned into the pCO ~r, and assessed for promoter activity via the CAT (Fig. 4). Fragment B encompasses both of the intra; promoters as defined by fragments Q and R, and in 3T3 and HeLa cells exhibits a stronger promoter ity than either fragment alone. Fragment N encom;s the promoters defined by fragments M and Q ading a small piece of R), and in 3T3 cells exhibits a ger promoter activity than either fragment alone (in t the additive affect of fragments M and Q is difficult ;sess because of the low activity of fragment M in cells). Finally, fragment O encompasses all three of ~romoters as defined by fragments M, Q, and R, and ,~sses a stronger activity than any of the promoter aents when tested alone or in a combination of two. Thus when included on the same stretch of DNA, the toters can apparently function independently and perpromoters haps even synergistically. Since we have previously identified an enhancer-like element near the 3' end of fragment 5], the observed increase in expression when fragment R [251 R is included on another fragment may be due to the isition of both promoter and enhancer-like elements. acquisition nce the CAT assay quantitates gene ex[ expression at the Since y ql protein level, and what we were interested in was the tivity, we sought to verify the determination of promoter activit results of the CAT assay at the RNA level. We therefore )n assay using a CAT-derived performed an RNase protection Led from HeLa cells that had probe to protect RNA obtained been transfected with some of the same constructs that ~ay. The results, which are were used in the CAT assa' trallel those of the CAT assay presented in Fig. 5, closely parallel and verify that each of the; individual non-overlapping ave promoter activity via the N-ras fragments shown to have CAT assay (i.e., fragments M, Q, and R) does in fact influence gene expression at the RNA level. 3.3. Evidence that the intra7genic N-ras promoters can ~cated N-ras 5' deletion muexpress the N-ras gene: truncated tants retain promoter activity

',iated fragments (fragment M) One of the promoter-associated corresponds to the 5' flanking; region of the N-ras gene, in addition to a piece of exon - 1 . The two other promoterreside downstream of this associated fragments (Q and R) resid location, and thus lie within transc gene. We reasoned that if the N-ras truncated so as to be lacking the

ing t, M), it may still be expl down •agenic promoters. If so demo these promoters, which w are al ss the CAT gene, can als N-ra~ We therefore created two deleti that were missing the n prom~ ed region (Fig. 6A). One tants an at the 3' end of exon conta f the intragenic promotergions 9y fragments Q and R. Th~ he 5' end of intron 1 and 1 (INT: enic promoter-associated t part c by fr~ ad all of the intragenic pr~ ed by fragment R. The a ated ; the full length wildtype gc muta~ N-ra~ s assessed via Northern an; asiently transfected HeLa c obtaix astrate that each of the mut The r ~NA, although at a lower 1 expre ene. (Densitometry reading of th~ e expresses 3-4-times mc the mutant E.K-1, anod 13-14-times 1..5-1 more RN.~ muta~ INT1). The N-ras probe >robe is derived from tl lated region of the murine muril N-ras gene and not cross-hybridize with endogenous huma scripts. The size of the message ( ~ 1.3 kb N-ras transcript with the size of the smallest small molecular we in mouse tissues [17]; a higher [ enerated by the N-ras ~ 5.0 kb that is gener~ 9roduced in this experiJ mouse tissues is not pro~ 3' untrar constructs possess an incomplete ir and are missing the regiion that is needed tq lbridization of the blot larger transcript. Hybrid probe demonstrates that equal amounts of RI for each sample (Fig. 66C). The ability of t generate N-ras mRNA was verified by an i tion assay, and the abilit,.y of the mutants to protein was assessed in a focus formation a the mutants were found to exhibit focus fox although at a level ~ 25;-fold less than that c the intragenic ] construct (not shown). Thus, T the N-ras gen ers are clearly able to express ex existence of initiator e 3.4. Evidence for the exi activity of an intragenic the N-ras gene: the actfi by the remo sociated fragment is destroyed de~ encompassing initiation sites, and a short (, sites possesse+, ment encompassing initiation initi, tivity

9resents a strong promol Fragment B represer strated bv the CAT assa~ly in both 3T3 and H e protection assay in HeLa ~gment is composed main contain a small amount at either end. Transcription

leffers, A. Pellicer / Biochimica et Biophysio

y primer extension) are nce present at the 5' end 1 transcription initiation sequence present at the wn as the initiator (INR) of genes (reviewed in which is positioned at the I itself act as a promoter me instances. With this in mind, we were interested in lining the effect that removing the initiation site-conag exonic sequences would have on the activity of the s intragenic promoter represented by fragment B. le therefore generated a fragment (fragment S) which atially represents fragment B without the short exonic lents at either end, and subcloned it into vector pCO 7A). When this fragment was assessed for promoter ity via the CAT assay, it was found to be devoid of loter activity in both 3T3 and HeLa cells (Fig. 7B). As cted from previous results, fragment B exhibited strong ~oter activity in this experiment, as did fragments Q R which represent subfragments of fragment B that ess either the 5' exonic sequence (fragment Q) or the 1- . . . . . . 3' ex( xonic sequence (fragment R) of fragment B. This e x p e rriment i m e n t demonstrates that sequences in the immediate

A.

vicin ing e: assoc initia In initia initia from them prom whicl prom activJ Fragl 3' en prom

and 3' transcription initiatic ~ces are essential for the prt ragment B, and suggests t] within the N-ras gene. are directly demonstrate th lents within N-ras, the sh ttaining sequences that hac 3 in order to create frag oned into vector pCO ant (Fig. 7; fragments T and U the initiation site-contain nt B, was found to posse not as strong as fragment~ :h represents the initiation er fragment B was found tq

4. Di 3nstrated by primer extensi W protection analysis is that the murine N-ras transcription at multiple 91e locations. The ma sites map within exon - 1 , but one site is 1¢ end of exon 1. No initiattion sites are found v

N- ras unr 3"

I I OO-bp I

-ID

-IA

I

I

IF']

I--]

u!

n S

R

u-4B. 3T3

•

•

oi 99909

HeLa

o

•

•

o.o 9 9 '•O,

I

B

S

Fig. 7. CAT assay-derived evidence for the exi

R

T

U

ig. 4 legend for experimental detai

Jeffers, A. Pellicer/ Biochimica et Biophysic

ation sites with different • the existence of many ,d ~s, we cannot completely of the sites are artifactual cture in this region of the nd could thus potentially have also identified proon-overlapping fragments nding to the 5' flanking on of the N-ras gene (fragment M) and two correlding to intragenic regions of N-ras (fragments Q and Each promoter-associated fragment corresponds to a on in which at least one initiation site has been mapped, thus it is likely that each promoter can independently :tion in its natural setting to generate N-ras transcripts. analysis of N-ras 5' end deletion mutants suggests that intragenic promoters can express the N-ras gene itself. ether these data support the existence of multiple we promoters within the N-ras gene. Jke many of the genes which initiate transcription a multiple locations, the promoter region of murine ~s is of the housekeeping variety (reviewed in [24]), tg G + C-rich and devoid of a TATA-box [18]. The luction of multiple transcripts from genes with this production type: of promoter is generally assumed to be due to the ;nce of a TATA-box which may function to direct the absence ation of transcription to a single site (reviewed in [37]). initiation vever, our present analysis suggests that the multiple However scripts that are produced by the N-ras gene, and also transcri taps by other genes with this type of promoter, are not perhal: ,'ssarily gq generated from a single tg inaccuratelyy initiating necessarily promoter, but may in fact be generated from multiple ally operating promoters, independently or synergistically The element(s) utilized by the N-ras promoters to facilitate the formation of an1 active transcription initiation complex are unknown. Nonee of the N-ras promoter flagments contain a TATA-box and it is therefore likely that scriptional activators function either initiators and/or transcri in this regard. An inspection1 of all three N-ras promoter~, and R) reveals consensus associated fragments (M, Q, lent for known transcriptional binding sites on each fragment JSF/c-Myc, which may faciliactivators, such as SP1 and USF ve initiation complex (see Fig. tate the formation of an active 'ator which has been proposed 1). SP1 is a ubiquitous activator eral transcription factor TFIID to be able to recruit the general rs thereby facilitating the foron TATA-box-less promoters marion of an active initiation complex [38,39]. U S F / c - M y c PNA binding proteins that apare basic helix-loop-helix DNA cognition sequence, CACGTG parently possess the same reco [40,41]. A protein believed to be USF has been shown to interact with and stabilize TFIID on a TATA-box-less ~, the formation of an active promoter, thereby facilitating f, initiation complex [42]. In support these factors for the regulation of th~ the observation that the correspom

whic cont~ shov with

ice of the area of interest is ion sites for these activa for the presence of initiat~ mes from our finding tha N-ra fragment (fragment B) lose shorl transcription initiation site onic tre deleted from its 5' and thes~ nces are themselves assess~ activ t that the 5' end fragmen exhil romoter activity in both ! cells s short 5' end initiation fragx thened by ~ 2 5 0 bp (to c Q), increase in promoter activ this 250 bp reveals the exan GC-1 Since others have shown al expression from an init can 3C-boxes within the N-r~ likel ion from the N-ras initiat~ incre :agment T. Unlike the sho local men1 tt B, the short 3' end fragl sess independent promoter u) d aent does not contain an either tlalS tragment eithe dc possesses an initiator of o the type which dq promoter activity in the th absence of other ments [36]. reater than one pror The presence of gr~ regulatio gene may allow for transcriptional tran promoters are indepem ~endently regulated. St has been described for a number of genes, proto-oncogenes (revie~ reviewed in [43,44]). Si gene contains multiple 1~~romoters, the possit different stimuli, pert each one responds to di or developmental-stage specific manner. I regulation of the diff~ case, the independent re could contribute to the developmental and with N-ras e variations that are associated asso One factor that could pperhaps differentially promoters is a sion from the various N-ras 1~ ture transcriptional arrest arre that we have pr~ fled in the 5' region of oJ the N-ras gene [2 -associated fragments (fra N-ras promoter-associ~ downstream of the arrest arre site, and should promoter-associ by this site; the two other ot lie upstream of, or o (fragments M and Q) li arrest site and may thus be differentially im from it. A situ site based on their distance dist~ a single gene aT multiple promoters within witl termination influenced by a transcriptional transcr on their distance from the element has be~ factors that cc the c-myc gene [45]. Other C differentially affect the expression from the le an enhancer-like elemen nromoters include e e N-ras gene [25], and scription proceeding into N zated just upstream of N-r~ 3f the current study, couple

leffers, A. Pellicer / Biochimica et Biophysio

ich we identified regularegion [18] and in tranN-ras gene, leads to the the gene is apparently a ubiquitously expressed upstream of N-ras [26] "he expression of other carefully regulated, for , may also be controlled

[12] c I~ [13] Iv

complex network of elements, some of which (i.e., a )f premature transcriptional arrest; utilization of multipromoters) are similar to those operating within N-ras. t summary, the findings of our present investigation ide new information concerning the regulation of the s gene, and may have important implications regardhe norma~ and deregulated expression of this gene. In :ion, our identification of multiple promoters within q-ras gene raises the possibility that multiple promotnay also play a role in generating the heterogeneous cripts that are associated with other housekeeping

[19] T II [20] B

S.

Acknowledgments re thank John Hill for assistance with computer-related We analyIsis. This work was supported by NIH grants CA36327 and CA50434.

References [1] Barbacid, M. (1987) Annu. Rev.¢. Biochem. 56, 779-827. [2] Chardin, P. (1991) Cancer Cellss 3, 117-126. [3] Feramisco, J.R., Gross, M., Kamata, mata, T., Rosenberg, M. and Sweet, R.W. (1984) Cell 38, 109-117. [4] Mulcahy, L.S., Smith, M.R. and ld Stacey, D.W. (1985) Nature 313, 241-243. [5] Bar-Sagi, D. and Feramisco, J.R. R. (1985) Cell 42, 841-848. [6] Noda, M., Ko, M., Ogura, A., Liu, D.-G., Amano, T., Takano, T. and Ikawa (1985) Nature 318, 73-75. [7] Guerrero, I., Wong, H., Pellicer, er, A. and Burstein, D.E. (1986) J. Cell. Physiol. 129, 71-76. [8] Der, C.J., Krontiris, T.G. andI Cooper, G.M. (1982) Proc. Natl. Acad. Sci. USA 79, 3637-3640. [9] Santos, E., Tronick, S.R., Aaronson, Ison, S.A., Pulciani, S. and Barbacid, M. (1982) Nature 298, 343-347. [10] Gerosa, M.A., Talarico, D., Fog~ gnani, C., Raimondi, E., Colombatti, M., Tridente, G., De Carli, L. and Della VaUe, G. (1989) J. Natl. Cancer Inst. 81, 63-67. [11] Doniger, J. and DiPaolo, J.A. (1988) ~1988) Nucleic Acids Res. 16, 969980.

5 [14] Iv

[15] [16] [17] [18]

c v ¢ L 1 e

B

[21] I~

rth, M.E., Scolnick, E.M. and L -483. trshall, C.J., Cales, C. and Hall, A :idman, I., Gordon, J.W. and P r3-2076. 'erucho, M. (1986) Mol. Cell. Bi Levinson, A.D. (1988) Nature 33 ro, I. and Pellicer, A. (1987) /~ Pellicer, A. (1991) Mol. Cell. Bio d, A.V., Warrilow, D., Watt, F., ) Oncogene 6, 1843-1850. leul, B., Ramsden, M., Fee, F., 38) Mol. Carcinogenesis 1, 161-1 ~, G.T. and Pastan, I. (1985) Sc

1

Frusko, S.P., Freeman, N. and Ge [22] H Iv 7, 2592-2596. ad Perucho, M. (1988) Oncogene [23] 86) Trends Genet. 2, 196-197. [241 E [25] Jc 'ellicer, A. (1992) Oncogene 7, 2 [26] Jc acci, R. and Pellicer, A. (1990) b 1 Przybyla, A.E., MacDonald, R.J. [27] C (1 tl~/~,) Dlocnemlstry stry 18, le,, 5294-5299. : [28] Ausubel, F.M., Brent, R., Kingston, R.E., Moore, Seidman, J.G. and Struhl., K. (1987) Current protc biology, Greene Publishing Publishir Associates and Wiley° [29] Sambrook, J., Fritsch, E.F. I and Maniatis, T. cloning: a laboratory, manual, man 2nd Edn., Cold Sprit tory Press, Cold Spring Harbor. Iq l G.M. and Lee, [30] Hall, C.V., Jacob, P.E., Ringold, Appl. Genet. 2, 101-109 101-109. [31] Chang, H.-Y., Guerrero, I., Lake, R., Pellicer, A. P. (1987) Oncogene Res. 1, 129-136. [32] Gunning, P., Ponte, P., Okayama, O H., Engel, J., BI L. (1983) Mol. Cell. Biol. Biol 3, 787-795. [33] Gorman, C.M., Moffat, L.F. l and Howard, B.H. Biol. 2, 1044-1051. [34] Lowndes, N.F., Paul, J., Wu, J. and Allan, M. I Biol. 9, 3758-3770. [35] Gaffney, D.F., McLauch vlcLauchlan, J., Whitton, J.L at (1985) Nucleic Acids Re~ Res. 13, 7847-7863. 13 (1992) FASEB J. 6, 32 [36] Weis, L. and Reinberg, D. [37] Breathnach, R. and Chan Chambon, P. (1981) Annu. 1~ 349-383. [38] Smale, S.T., Schmidt, M M.C., Berk, A.J. and Ball Proc. Natl. Acad. Sci. USA US 87, 4509-4513. [39] Pugh, B.F. and Tjian, R. (1991) Genes Dev. 5, 19 Roede R.G. (1985) Cell 43, 1 [40] Sawadogo, M. and ad Roeder, Zit E.B. (1992) Trends GI [411 Prendergast, G.C. and Ziff, DI [421 Bungert, J., Kober, I., During, F. and Seifart, K.] Biol. 223, 885-898. [43] Kozak, M. (1988) J. Cell Biol. 107, 1-7. [44] Kozak, M. (1991) J. Cell Biol. 115, 887-903. [45] Roberts, S. and Bentley, D.L. ] (1992) EMBO J. 11 [46] Marcu, K.B., Bossone, S.A. and Patel, A.J. (1 Biocbem. 61, 809-860.