- Email: [email protected]
Identification of nonessential Helicobacter pylori genes using random mutagenesis and loop amplification
Res. Microbiol. 152 (2001) 725–734 2001 Éditions scientifiques et médicales Elsevier SAS. All rights reserved S0923-2508(01)01253-0/FLA
Identification of nonessential Helicobacter pylori genes using random mutagenesis and loop amplification Peter J. Jenks∗,1 , Catherine Chevalier, Chantal Ecobichon, Agnès Labigne Unité de Pathogénie Bactérienne des Muqueuses, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris cedex 15, France Received 12 March 2001; accepted 19 April 2001
Abstract – Analysis of the published genome sequences of Helicobacter pylori revealed that approximately 40% of the predicted open reading frames (ORFs) were of unknown function. We have developed the random mutagenesis and loop amplification (RMLA) strategy, and used this approach both to characterize individual virulence factors and to collectively screen comparatively large numbers of H. pylori mutants to identify genes that are not essential for viability in vitro. The mini-Tn3-Km transposon was used to generate a random mutant library in H. pylori strain G27. By screening the library of mutants we were able to demonstrate that the transposon integrated randomly into the chromosome of H. pylori and that RMLA was able to identify mutants in known virulence genes (urease and catalase). To test whether this strategy could be used as a high-throughput approach for the simultaneous identification of a series of nonessential genes of H. pylori, the transposon–chromosomal junctions of a pool of mutants were amplified by inverse PCR using circular fragments of genomic DNA obtained after chromosomal DNA extracted from the pool of mutants had been digested with HindIII and self-ligated. The amplification products were radioactively labelled and hybridized to a high density macroarray membrane containing a duplicated target sequence for every gene of H. pylori strain 26695. For the positive ORFs the precise site of transposon insertion was confirmed by PCR mapping. In total 78 H. pylori genes were unambiguously identified as nonessential for viability in vitro, including 20 with orthologues of unknown function in other species and 21 which were H. pylori-specific. 2001 Éditions scientifiques et médicales Elsevier SAS random mutagenesis / transposon / inverse PCR / hybridization / array / Helicobacter pylori
1. Introduction The search for factors important in the pathogenesis of Helicobacter pylori has been facilitated by the publication of the entire genome sequence of two clinical strains, 26695 and J99 [1, 18]. Analysis of these genomes has revealed that while the function of 58% of the open reading frames may be predicted, 18.5% have orthologues of unknown function in other species, and 23.5% are H. pylori specific [1]. Characterization of these newly identified genes is likely to identify novel determinants important in survival and colonization of the stomach.
∗ Correspondence and reprints.
E-mail address: [email protected] (P.J. Jenks). 1 Present address: Institute of Infections and Immunity, Floor
C, West Block, University Hospital, Queen’s Medical Centre, Nottingham NG7 2UH, UK.
The genetic and molecular analysis of H. pylori has been greatly facilitated by the development of random mutagenesis strategies for this organism. The construction of random mutant libraries by transposons [6, 10] or an integration plasmid [2] has provided a powerful basis for the characterization of individual genes of H. pylori on the basis of phenotype [2, 14]. However, the increasing availability of microbial genome sequence data is encouraging a more global approach to the study of microorganisms and how they interact with their environment or host [8]. The development of a system that allowed the collective screening of comparatively large numbers of H. pylori mutants both in vitro and in vivo would greatly facilitate further research into the pathogenesis of this organism. In this study, we describe the development of the random mutagenesis and loop amplification (RMLA) system which is able to identify new gene loci involved in virulence-associated traits of H. pylori. We have used a previously described transposon shuttle-
726
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
mutagenesis system [11] to generate random mutations throughout the genome of a transformable strain of H. pylori. The RMLA identification procedure allowed direct determination of the site of transposon insertion within the H. pylori chromosome, so facilitating the identification of individual H. pylori mutants. In addition, RMLA, in combination with hybridization to a high density macroarray containing a duplicated target sequence for every gene of H. pylori strain 26695, was able to identify multiple mutants within a pool, making it a potentially powerful technique for screening large numbers of mutant strains for those with mutations in genes that are not essential for viability in vitro. By combining these approaches we have identified a series of 78 nonessential genes in H. pylori, including 20 with orthologues of unknown function in other species and 21 which are H. pylorispecific. Further analysis of these genes will allow determination of their function and whether they are involved in establishing and maintaining infection of the gastric mucosa.
2. Materials and methods 2.1. Bacterial strains and growth conditions
H. pylori strain G27 [3] was routinely cultured on 10% horse blood agar medium containing antibiotics at the following final concentrations: vancomycin (10 mg/L), polymyxin (2500 U/L), trimethoprim (5 mg/L) and amphotericin B (4 mg/L). Plates were incubated at 37 ◦ C under microaerobic conditions. H. pylori that had undergone chromosomal allelic exchange were selected on medium supplemented with 25 mg/L kanamycin. Escherichia coli strain DH1 [7] was used as the host for plasmid cloning experiments and was grown at 37 ◦ C in Luria-Bertani medium (LB). Antibiotics were used at the following final concentrations unless indicated: 100 mg/L spectinomycin, 8 mg/L tetracycline and 25 mg/L of kanamycin. Independent E. coli transformants were saved by storing up to 96 clones individually in 96-well microtitre plates (plate I.0 to plate XV.0); clones were inoculated into LB supplemented with 8 mg/L tetracycline, 100 mg/L spectinomycin and 7% DMSO and stored at −80 ◦ C.
2.2. General molecular biology techniques and construction of recombinant plasmids
The alkaline lysis procedure was used for small scale plasmid preparation [16]. MIDI Qiagen columns (Qiagen, Courtaboeuf, France) were used for largescale plasmid preparation. Plasmid DNA from each pool of transconjugates was prepared using an alkaline lysis procedure followed by cesium chloride extraction [16]. Whole cell DNA for the preparation of the genomic library of H. pylori G27 was prepared as described previously [13]. Genomic DNA from individual generated H. pylori mutants was extracted using the QIAamp tissue kit (Qiagen) according to the manufacturer’s instructions. Standard procedures for cloning, DNA analysis, colonydot blots and Southern blots were used [16]. Blots were hybridized under standard conditions with [α2 P]-deoxyribonucleotide probes labelled by random priming using the MegaPrime DNA system (Amersham, Les Ulis, France) according to the manufacturer’s instructions. In order to construct a library of cloned H. pylori DNA, chromosomal DNA from H. pylori strain G27 was partially digested with Sau3A, size fractionated on a sucrose gradient (10 to 40%), and 1.5-2.0-kb fragments were ligated into the BglII site of plasmid vector pILL570-1 (table I). These ligated, recombinant plasmids were then transformed into E. coli strain DH1 that contained the transposaseencoding plasmid pTCA (TcR ). This library of H. pylori genomic DNA fragments was stored as individual clones in fifteen 96-well plates at −80 ◦ C (plate I.0 to plate XV.0). 2.3. Urease and catalase assays
To screen for urease activity, individual kanamycinresistant H. pylori transformants were suspended in 50 µL of urea-indole medium as previously described [12]. Colonies that did not turn pink within 30 min were considered urease-negative, and their urease activity was quantified using an assay based on the Bertholet reaction [4]. To screen for catalase activity, individual kanamycin-resistant H. pylori transformants were suspended in 50 µL of 30% v/v hydrogen peroxide. Colonies that did not induce immediate effervescence of the hydrogen peroxide were considered catalase negative.
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734 2.4. Transposon mutagenesis and transformation of H. pylori
Transposon mutagenesis of individual clones was performed using the mini-Tn3-Km transposon (figure 1) [11]. All manipulations were performed in 96well format using a 96-well inoculator designed to deliver a 10-µL liquid volume. Each storage microtitre plate (plate I.0 to plate XV.0) was thawed and used to inoculate a fresh plate (plate I.1 to plate XV.1) with the E. coli DH1 clones that harbored the pTCA and recombinant pILL570-1 derivative plasmids (table I). Plasmid pILL553 harboring the mini-Tn3-Km transposon (a low copy autotransferable plasmid pOX38 derivative) [12] was transferred into these E. coli DH1 clones by conjugation. Transconjugates harbor-
Figure 1. Restriction map and orientation of oligonucleotide primers (rmla-1, rmla-2, rmla-3 and rmla-4) of the mini-Tn3 Km transposon. Black box, Campylobacter kanamycin cassette; shaded box, DNA sequences originating from Tn3 ; crossed box, specific recombination site from phage P1 (loxP ) recognized by the cre gene product.
727
ing all three plasmids (recombinant pILL 570-1 derivative, pTCA and pILL553), were selected by spotting 10 µL of the mating mixture on LB medium containing 25 mg/L kanamycin, 8 mg/L tetracycline and 100 mg/L spectinomycin (plate I.2a to plate XV.2a). The transconjugates were inoculated into new 96-well microtitre plates (plate I.2b to plate XV.2b) and highfrequency transposition of the mini-transposon was obtained by growing the bacteria for 48 h at 30 ◦ C in LB containing 25 mg/L kanamycin, 8 mg/L tetracycline and 100 mg/L spectinomycin. Cointegrates resulting from the transposition of mini-Tn3-Km into pILL570-1 recombinant plasmids were transferred by conjugation into E. coli NS2114SmRif which carries the cre gene encoding the P1-specific recombinase for the lox site of the mini-transposon (plate I.3 to plate XV.3) [17]. Positive selection of resolved forms of the cointegrates was obtained by growth on LB containing 100 mg/L rifampicin, 625 mg/L kanamycin, 625 mg/L spectinomycin and 625 mg/L streptomycin (plate I.4 to plate XV.4). The resultant colonies are E. coli NS2114SmRif cells harboring the pILL5701 derivative in which the mini-Tn3-Km has been inserted and the original pILL553 plasmid. All the colonies that grew on each individual 96-well plate (plate I.4 to plate XV.4) were independently pooled, and plasmid DNA was isolated from each pool of transconjugates. Resultant recombinant plasmids were introduced into H. pylori for allelic exchange by natural transfor-
Table I. H. pylori plasmids and oligonucleotide primers used in this study.
Plasmid/oligonucleotide Plasmid pILL570 pTCA pILL553 Plasmid pools I to XV
Oligonucleotide rmla-1 rmla-2 rmla-3 rmla-4
Characteristics or oligodeoxynucleotide sequence (5 to 3 )
Reference
Spr ; pBR322 derivative in which the DNA sequences responsible for Tn3 immunity have been deleted Tcr ; pACY184 derivative constitutively expressing the Tn3 transposase (TnpA); immune to Tn3 Kmr pOX38 plasmid in which the Tn3-Km transposon has been inserted Spr ; Kmr ; individual pools of pILL570-1 derivative plasmids containing mini-Tn3-Km-disrupted cloned H. pylori chromosomal DNA prepared from plate I.4 to plate XV.4 respectively
[12]
TTTGACTTACTGGGGATCAAGCCTG CGGTATAATCTTACCTATCACCTCA GATCCTTTTTGATAATCTCATGACC CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC
Spr , resistance to spectinomycin; Tcr , resistance to tetracycline; Kmr , resistance to kanamycin.
[17] [11] This work
This work This work This work [9]
728
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
mation. H. pylori strains were naturally transformed with circular plasmid DNA (∼ 2 µg per transformation) using a modification of the technique of Wang et al. [19]. Briefly, bacteria were inoculated as 1 cm patches and grown for 5 h before addition of 10 µL supercoiled plasmid DNA. After further incubation for 18 h, the bacteria from each individual patch were harvested and plated directly onto a single plate of selective medium containing 25 mg of kanamycin/L. 2.5. Identification of H. pylori mutants by loop amplification
The loop amplification procedure was used to generate a PCR product that contained the transposonchromosome junction of each individual mutant. Chromosomal DNA extracted from either an individual mutant or a mixed population of H. pylori mutants (2 µg in a final volume of 60 µL) was digested to completion with HindIII, which cuts twice near one extremity of mini-Tn3-Km (figure 1) and frequently throughout the chromosome of H. pylori. The HindIII-digested fragments were extracted with phenol chloroform, precipitated with ethanol, resuspended in 50 µL TE and diluted 1:5 before selfligation with T4 DNA ligase for 18 h at 16 ◦ C. The ligation mix was then used as a template for inverse PCR amplification of the transposon-chromosome junction, using the oligonucleotide primers rmla-1 and rmla-2 (table I), which are oriented so as to amplify outwards from each end of the kanamycin cassette (figure 1). To identify individual mutants, PCR products were sequenced directly using oligonucleotide rmla-3 which is situated at the 3 end of the mini-Tn3-Km transposon and allows sequencing of the transposonchromosome junction (figure 1; table I). The point of insertion of the mini-Tn3-Km transposon in the H. pylori chromosome was identified by alignment of the sequence with the complete genome sequence of H. pylori strain 26695 as provided by the TIGR database [18]. An H. pylori gene number was allocated to each mutant according to the sequence of strain 26695 [18]. To identify several different H. pylori mutants simultaneously, the mixed population of PCR products (which contains the transposon-chromosome junctions of all the H. pylori mutants within the pool) was radiolabelled with [α-3 P]-dCTP and [α-3 P]-dATP and 0.5 U Klenow (Amersham), using as primers
rmla-1 and rmla-2 [5]. For control experiments, individual plasmid pools (20 ng) linearized by EcoRI and sonicated genomic DNA (25 ng) from H. pylori 26695 were radiolabelled with [α-3 P]-dCTP and [α3 P]-dATP and 0.5 U Klenow, using as primers the random hexamers from Pharmacia [5]. High density oligonucleotide arrays were prepared and provided by Eurogentec (Seraing, Belgium) by gridding (using a 5 × 5 square matrix), in duplicate, 1590 specific amplification products corresponding to each of the predicted open reading frames of H. pylori 26695. Membranes were hybridized at 68 ◦ C and hybridization was revealed by autoradiography with Amersham Hyperfilm-MP. The identity of the positive open reading frames was determined by comparison of the coordinates of each pair of reactive spots to the matrix used for gridding the membrane. The site of transposon insertion in the positive ORFs was confirmed by PCR mapping. Two series of PCR reactions were performed using the chromosomal DNA extracted from the mixed pool of H. pylori mutants as a template. Each reaction used the oligonucleotide rmla-4 (table I), which is situated at both the 5 and 3 end of the mini-Tn3-Km transposon, and an oligonucleotide corresponding to either the 3 or 5 end of each ORF identified by hybridization to the array [9]. 3. Results 3.1. Construction of a nonexhaustive mutant library
The construction of a library of H. pylori mutants was achieved by adapting a shuttle mutagenesis system that we have previously described [10, 13], and validating its use for the generation of random mutations throughout the genome of H. pylori. This system uses the mini-transposon, mini-Tn3-Km, to inactivate H. pylori chromosomal DNA fragments cloned in E. coli. Mini-Tn3-Km (figure 1) is a modified version of the mini-Tn3 transposable element [17] in which the β-lactamase encoding gene has been replaced with a kanamycin-resistance gene of Campylobacter coli [13]. Following transposon insertion within E. coli, the disrupted fragments of H. pylori genomic DNA are transformed into H. pylori for allelic replacement of the intact chromosomal gene by the mutated gene. A library of 1187 H. pylori genomic DNA fragments was constructed and stored as individual clones in fifteen 96-well plates at −80 ◦ C (plate I.0 to plate XV.0), with each 96-well plate containing between 45
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
and 92 individual clones. Hybridization experiments indicated that there was a small degree of redundancy within the library of cloned H. pylori chromosomal DNA and that the library covered approximately 50% of the genome (data not shown). The mini-Tn3-Km transposable element (figure 1) was used to generate random mutations within the cloned H. pylori DNA of individual recombinant plasmids in each of the fifteen 96-well plates (plate I.0 to plate XV.0) through the two mating steps described in Materials and methods. At the end of the mutagenesis procedure, multiple colonies resistant to rifampicin, kanamycin, spectinomycin and streptomycin were obtained for each of the 1187 individual clones, suggesting that the mini-transposon had been inserted into individual recombinant plasmids on multiple occasions. After mutagenesis, all colonies from each individual 96-well plate (plate I.4 to plate XV.4) were pooled and plasmid DNA was purified by caesium chloride extraction (fifteen independent plasmid preparations). Restriction analysis of one of the 15 plasmid pools (plasmid pool I prepared from plate I.4) with ClaI and PstI resulted in a large smear below 5.3 kb (the size of plasmid pILL5701) suggesting that insertion of the mini-transposon had occurred predominantly in cloned H. pylori genomic DNA rather than the vector. As previously shown [12], the proportion of cloned H. pylori DNA fragments disrupted by this procedure was 99%. The fifteen individual pools of plasmids containing mini-Tn3-Km-disrupted fragments of H. pylori DNA (plasmid pools I to XV) were then introduced independently into H. pylori strain G27 by natural transformation. Each individual pool of plasmids (∼ 2 µg of DNA) yielded between 200 and 1200 kanamycinresistant transformants of H. pylori G27 (100–600 CFU/µg of DNA). Southern hybridization analysis of kanamycin-resistant transformants obtained after exposure of H. pylori to transforming pooled plasmid DNA (plasmid pool 1) for 3 h or 18 h revealed that all the transformants had single insertions in different loci of the bacterial chromosome, and demonstrated that allelic replacement occurred as early as 3 h and that events remained predominantly independent at 18 h (figure 2). This confirmed that the majority of H. pylori mutants obtained using our protocol were truly independent and not the result of the clonal multiplication of transformants arising from early allelic exchange events.
729
Figure 2. Southern hybridization analysis of randomly selected H. pylori G27 kanamycin-resistant transformants obtained after exposure of H. pylori strain G27 to plasmid pool I (prepared from plate I.4) for 3 h or 18 h. Chromosomal DNA of individual transformants was digested with HindIII, separated on a 1% agarose gel and transferred onto a nitrocellulose membrane, before hybridization with a purified kanamycin resistance gene probe. Lanes 1 to 11, kanamycin-resistant transformants obtained after 3-h transformation; lanes 12 and 15, positive controls; lanes 13 and 14, H. pylori strain G27; lanes 16 to 26, kanamycinresistant transformants obtained after 18 h transformation.
3.2. Identification of individual H. pylori mutants by RMLA
Having demonstrated that the mini-Tn3-Km mutagenesis system was able to generate random, single mutations throughout the genome of H. pylori, we wished to determine whether this approach could be used to identify individual H. pylori mutants, including those deficient for specific phenotypes. The library of H. pylori G27 mutants was therefore screened for loss of urease or catalase enzyme activities. Screening with urea-indole medium identified three independent kanamycin-resistant H. pylori G27 transformants that were urease negative and quantitative determination of urease activity confirmed that these mutants were devoid of urease activity. Screening with hydrogen peroxide identified three independent kanamycin-resistant H. pylori G27 transformants that were catalase negative. Direct determination of the site of mini-transposon insertion using the RMLA identification procedure revealed that all the urease-negative mutants were disrupted at different sites within the ureE gene. For the catalase-
730
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
Table II. Nonessential genes of H. pylori identified by inverse PCR and either sequencing or hybridization to a macroarray.
Cellular function of identified genea H. pylori-specific with no known function
Conserved with no known function
Amino acid biosynthesis/protein synthesis Biosynthesis of cofactors, prosthetic groups and carriers Cell envelope Cellular processes Central intermediary metabolism DNA metabolism Energy metabolism
Genes identified by inverse PCR and sequencing HP0014, HP0053, HP0058* , HP0080, HP0095, HP0158, HP0209, HP0271, HP0344, HP0356, HP0368, HP0505, HP0563, HP0603, HP1081 HP0031, HP0040* , HP0065, HP0139, HP0170, HP1080, HP1338, HP1401
Genes identified by hybridization and PCR mapping HP0097, HP0112, HP0893, HP1057, HP1188, HP1410
HP1118* (ggt)
HP0293, HP0329, HP1118* (ggt)
HP0477, HP0506, HP0923 HP0875* (katA), HP0887* (vacA), HP1420* (fliI) HP0070* (ureE) HP1009 HP0954* (rdxA)
HP0923, HP1052 HP1126
Fatty acid and phospholipid metabolism Purines, pyrimidines, nucleosides and nucleotides Regulatory functions Transport and binding proteins
HP0117, HP0118, HP0120, HP0139, HP0328, HP0381, HP0677, HP1056, HP1187, HP1349, HP1401, HP1409, HP1411, HP1466 HP0171, HP0380, HP0476, HP1050
HP0197 HP1121 HP0121, HP0192* (frdA), HP0294 (amiE) HP0215 HP0255, HP0829
HP0792 HP0299, HP0475, HP1077* (nixA), HP1252, HP0055, HP0613, HP1091, HP1180 HP1329, HP1491 a Function allocated according to the Pylori Gene World-Wide Web Server (http://genolist.pasteur.fr/PyloriGene/). * Genes previously identified as nonessential by other workers.
negative mutants the mini-transposon was inserted within or 27 bp upstream of the coding region of the catalase gene. Using the RMLA approach, a total of 39 genes were individually identified as nonessential in vitro, including 8 with orthologues of unknown function in other species and 15 which were H. pylori specific (table II). 3.3. Screening for H. pylori genes that are nonessential in vitro
In order to develop a global approach to identify genes of H. pylori that are nonessential for viability, three pools of H. pylori mutants were generated by independent transformation of strain G27 with plasmid pools IV (prepared from plate IV.4 and which contained 63 clones), VI (prepared from plate VI.4 and which contained 74 clones) and VII (prepared from plate VII.4 and which contained 70 clones). The
kanamycin-resistant H. pylori transformants resulting from each transformation were pooled, and chromosomal DNA was independently extracted from each mixture of mutants. Chromosomal DNA from the three different pools was then combined and used to generate a mixed population of PCR products using the RMLA procedure. A series of hybridizations was performed using a high-density macroarray membrane containing a duplicated target sequence of every gene of H. pylori strain 26695. Firstly, a probe prepared from sonicated chromosomal DNA extracted from strain 26695 was hybridized to the membrane. Hybridization was observed across the array (figure 3A). Next, in order to determine the number of independent mini-Tn3Km-disrupted fragments of H. pylori DNA contained within the three plasmid pools that were used to generate the mutants, DNA from plasmid pools IV, VI
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
(A)
731
and VII was combined. The pooled plasmids were linearized with EcoRI before being radiolabelled and hybridized to the macroarray. In total, 204 individual pairs of spots were identified as positive (figure 3B). Finally, the PCR products generated from the pool of H. pylori mutants by the RMLA procedure were radiolabelled and hybridized to the macroarray (figure 3C). A total of 72 positive ORFs were identified including 9 groups of between 2 and 5 ORFs that were adjacent to each other on the array (table II). Of these, PCR mapping unambiguously identified 43 nonessential genes, including 14 with orthologues of unknown function in other species and 6 which were H. pylori-specific. 4. Discussion
(B)
(C) Figure 3. Identification of nonessential genes of H. pylori by hybridization to a high-density macroarray. (A) Hybridization of the array with a probe prepared from sonicated chromosomal DNA from H. pylori strain 26695. (B) Hybridization of the array with a probe prepared from plasmid pools IV, VI and VII extracted from plates IV.4, VI.4 and VII.4 respectively. (C) Hybridization to the array of a probe prepared using the RMLA procedure on chromosomal DNA extracted from pooled kanamycin-resistant transformants obtained by transformation of H. pylori strain G27 with plasmid pools IV, VI and VII.
Although the complete genome sequence of H. pylori has been in the public domain for over three years, none of the high-throughput approaches that allow the simultaneous examination of multiple genes of a microorganism have been successfully used for the molecular and genetic analysis of this organism. The development of the RMLA system for H. pylori represents an extremely useful tool for identifying virulence factors in this bacterium. RMLA can be used to generate a random library of mutants in transformable strains of H. pylori, and the development of a simple technique for the identification of the site of the transposon insertion allows rapid and direct identification of individual mutants. Furthermore, because this strategy is able to identify multiple mutants within a pool, RMLA has considerable potential for the high-throughput screening of H. pylori genes. RMLA is simple to perform and utilizes standard molecular biology techniques. It is therefore a suitable approach for other research groups wishing to perform similar genome-wide studies on this organism. In this study, we have demonstrated that the miniTn3-Km transposable element, which was originally developed for the random insertional inactivation of selected, individual genes [13], can also be used to generate random mutations throughout the genome of H. pylori and generate libraries of nonessential mutants. The approach can be used to mutate either randomly cloned fragments of H. pylori chromosomal DNA, as in this study, or cloned entire open reading frames. We have recently developed a rapid
732
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
and efficient cloning system that has allowed us to clone every open reading frame of H. pylori strain 26695 [9]. We now intend to systematically inactivate each open reading frame of this strain of H. pylori, and to classify genes as nonessential or essential according to whether it is possible or not to disrupt them in H. pylori. In order to validate the RMLA procedure, we screened the generated library of H. pylori mutants for urease-negative and catalase-negative strains. Although there was only a small degree of redundancy within the library of 1187 clones of H. pylori chromosomal DNA used to generate the mutant bank, we were aware that coverage of the entire genome was not comprehensive. This was confirmed during the urease screen which only identified three independent mutants devoid of urease activity. The three urease-negative mutants were derived from three independent insertions of the mini-transposon within the same corresponding cloned fragment of H. pylori chromosomal DNA. The observation that the three different catalase-negative mutants were also derived from a common cloned fragment of H. pylori chromosomal DNA confirmed the efficiency of the mini-Tn3-Km mutagenesis system. The fact that the mini-transposon is independently inserted at multiple positions within a given cloned fragment of H. pylori chromosomal DNA greatly increases the likelihood of generating a mutant by natural transformation of H. pylori. One of the advantages of RMLA is that the position of transposon insertion within the chromosome of the H. pylori mutant can be directly determined without the need for cloning the transposon-chromosomal junction or excessive experimental manipulations. The RMLA system generates a PCR product that contains the transposon-chromosomal junction and which can be used as a template to identify the site of insertion by sequencing out from the transposon. Using the RMLA procedure the three urease-negative and three catalase-negative H. pylori mutants were demonstrated to have transposon disruption of genes expected to be involved in urease and catalase enzyme activities [4, 15]. Using this technique, we have individually identified 39 nonessential H. pylori genes, and it has been possible to sequence up to 500 bp of the H. pylori chromosomal DNA adjacent to the minitransposon. As well as using RMLA to identify individual mutants, we also wanted to determine whether this
system could be used for the large-scale identification of nonessential genes of H. pylori. Using this system, in combination with hybridization to a highdensity macroarray, we were able to identify a large number of genes that are not essential for viability in H. pylori under the environmental conditions used. The identification of nonessential genes of H. pylori, particularly those with no defined function, is an important step in the determination of their function and biological role. It is likely that certain of the nonessential genes identified by this screen represent previously unidentified components of known biological systems or are involved in processes that are unique to H. pylori. Further analysis of these genes will allow determination of their function and whether they are involved in establishing and maintaining infection of the gastric mucosa. Theoretically, the identification of nonessential genes of an organism by such an approach allows the determination of essential genes by deduction. This is of considerable interest because the factors that are absolutely required for growth and viability provide potential targets for the development of new anti-H. pylori agents. It is possible that the genes present in plasmid pools IV, VI and VII for which mutants were not obtained are essential genes in H. pylori. However, certain limitations of RMLA, such as the reduced efficiency of natural transformation of H. pylori by pooled plasmids, could also explain why these mutants were not obtained. Ultimately, confirmation of the essential role of genes that cannot be disrupted in H. pylori will have to be performed using a gene by gene approach. The ability of RMLA to identify simultaneously multiple mutants also means that it has considerable potential for studying the pathogenesis of H. pylori in vivo. Comparison of the members of a pool of mutants used to inoculate an animal compared to those subsequently recovered would allow the identification of factors that are dispensable in establishing and maintaining infection of the gastric mucosa. One limitation of using the RMLA hybridization strategy on randomly cloned fragments of H. pylori chromosomal DNA was the difficulty in interpreting the significance of lines of adjacent reactive spots on the macroarray. There are two possible explanations for this phenomenon. The first is the presence of individual mutants within the pool which have the minitransposon inserted within genes that are adjacent to each other on the cloned H. pylori chromosome
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
fragment. The second is that the HindIII-generated fragment of mutant chromosomal DNA that is used to generate the probe contained the gene in which the mini-transposon was inserted plus a portion of the adjacent gene(s). Hybridization will therefore occur between those ORFs contained within the probe and all the homologous ORFs on the array. To circumnavigate this problem, the precise site of transposon insertion was determined by PCR mapping using an oligonucleotide common to both the 5 and 3 end of the mini-Tn3-Km transposon, and another oligonucleotide corresponding to either the 3 or 5 end of each ORF identified by hybridization to the array. Using this approach we were able to collectively screen a large number of H. pylori mutants and identify a further 43 genes that were nonessential in vitro. In conclusion, RMLA has proven to be a relatively simple system for identifying nonessential genes of H. pylori and for the simultaneous examination of multiple genes. Because RMLA permits the collective screening of comparatively large numbers of H. pylori mutants this technique has considerable potential as a global approach for the study of this organism. Acknowledgements P.J. Jenks was supported by a Research Training Fellowship in Medical Microbiology from the Wellcome Trust, United Kingdom (Ref 044330). Financial support was provided in part by Aventis-Pasteur, Lyon, France, OraVax, Boston, MA, USA, Institut de Recherche des Maladies de l’Appareil Digestif (IRMAD), Rueil Malmaison, France and Eurogentec, Seraing, Belgium. References [1] Alm R.A., Ling L.-S.L., Moir D.T., King B.L., Brown E.D., Doig, P.C., Smith D.R., Noonan B., Guild B.C., deJonge B.L., Carmel G., Tummino P.J., Caruso A., Uria-Nickelsen M., Mills D.M., Ives C., Gibson R., Merberg D., Mills S.D., Jiang Q., Taylor D.E., Vovis G.F., Trust T.J., Genomicsequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori , Nature 397 (1999) 176–180. [2] Bijlsma J.J.E., Vandenbroucke-Grauls C.M.J.E., Phadnis S.H., Kusters J.G., Identification of virulence genes of Helicobacter pylori by random insertion mutagenesis, Infect. Immun. 67 (1999) 2433–2440.
733
[3] Covacci A., Censini S., Bugnoli M., Petracca R., Burroni D., Macchia G., Massone A., Papini E., Xiang Z., Figura N., Rappuoli R., Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer, Proc. Natl. Acad. Sci. USA 90 (1993) 5791–5795. [4] Cussac V., Ferrero R.L., Labigne A., Expression of Helicobacter pylori urease genes in Escherichia coli grown under nitrogen-limiting conditions, J. Bacteriol. 174 (1992) 2466–2473. [5] Feinberg A.P., Vogelstein B., A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity, Anal. Biochem. 132 (1983) 6–13. [6] Haas R., Meyer T.F., van Putten J.P.M., Aflagellated mutants of Helicobacter pylori generated by genetic transformation of naturally competent strains using transposon shuttle mutagenesis, Mol. Microbiol. 8 (1993) 753–760. [7] Hanahan D., Studies on transformation of Escherichia coli plasmids, J. Mol. Biol. 166 (1983) 557–580. [8] Jenks P.J., Sequencing microbial genomes-what will it do for microbiology?, J. Med. Microbiol. 47 (1998) 375–382. [9] Labigne A., Ecobichon C., Thiberge J.M., Systematic cloning of the 1590 Orfs of the 26695 genome as a tool for H. pylori (Hp) gene expression and functional analysis, in: Abstracts of the 10th International Workshop on Campylobacter, Helicobacter and related organisms, Baltimore, M.A., 1999, p. 135. [10] Labigne A., Random mutagenesis of the H. pylori genome, in: Clayton C.L., T. H.M. (Eds.), Helicobacter pylori protocols, Humana Press, Totowa, N.J., 1997, pp. 153–163. [11] Labigne A., Courcoux P., Tompkins L., Cloning of Campylobacter jejuni genes required for leucine biosynthesis, and construction of leu -negative mutant of C. jejuni by shuttle transposon mutagenesis, Res. Microbiol. 143 (1992) 15–26. [12] Labigne A., Cussac V., Courcoux P., Shuttle cloning and nucleotide sequence of Helicobacter pylori genes responsible for urease activity, J. Bacteriol. 173 (1991) 1920–1931. [13] Labigne-Roussel A., Courcoux P., Tompkins L., Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni , J. Bacteriol. 170 (1988) 1704–1708. [14] Odenbreit S., Till M., Hofreuter D., Faller G., Haas R., Genetic and functional characterization of the alpAB gene locus essential for the adhesion of Helicobacter pylori to human gastric tissue, Mol. Microbiol. 31 (1999) 1537–1548. [15] Odenbreit S., Wieland B., Haas R., Cloning and genetic characterization of Helicobacter pylori catalase and construction of a catalase-deficient mutant strain, J. Bacteriol. 178 (1996) 6960–6967. [16] Sambrook J., Fritsch E.F., Maniatis T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. [17] Seifert H.S., Chen E.Y., So M., Heffron F., Shuttle mutagenesis: a method of transposon mutagenesis for Saccharomyces cerevisae, Proc. Natl. Acad. Sci. USA 83 (1986) 735–739. [18] Tomb J.F., White O., Kervalage A.R., Clayton R.A., Sutton G.G., Fleischmann R.D., Ketchum K.A., Klenk H.P., Gill S., Dougherty B.A., Nelson K., Quackenbush J., Zhou L., Kirkness E.F., Peterson S., Loftus B., Richard-
734
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734 son D., Dodson R., Khalak H.G., Glodek A., McKenney K., Fitzegerald L.M., Lee N., Adams M.D., Hickey E.K., Berg D.E., Gocayne J.D., Utterback T.R., Peterson J.D., Kelley J.M., Cotton M.D., Weidman J.M., Fujii C., Bowman C., Watthey L., Wallin E., Hayes W.S., Borodovsky M., Karp P.D., Smith H.O., Fraser C.M., Ventor J.C., The com-
plete genome sequence of the gastric pathogen Helicobacter pylori , Nature 388 (1997) 539–547. [19] Wang Y., Roos K.P., Taylor D.E., Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker, J. Gen. Microbiol. 39 (1993) 2485–2493.
Identification of nonessential Helicobacter pylori genes using random mutagenesis and loop amplification Peter J. Jenks∗,1 , Catherine Chevalier, Chantal Ecobichon, Agnès Labigne Unité de Pathogénie Bactérienne des Muqueuses, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris cedex 15, France Received 12 March 2001; accepted 19 April 2001
Abstract – Analysis of the published genome sequences of Helicobacter pylori revealed that approximately 40% of the predicted open reading frames (ORFs) were of unknown function. We have developed the random mutagenesis and loop amplification (RMLA) strategy, and used this approach both to characterize individual virulence factors and to collectively screen comparatively large numbers of H. pylori mutants to identify genes that are not essential for viability in vitro. The mini-Tn3-Km transposon was used to generate a random mutant library in H. pylori strain G27. By screening the library of mutants we were able to demonstrate that the transposon integrated randomly into the chromosome of H. pylori and that RMLA was able to identify mutants in known virulence genes (urease and catalase). To test whether this strategy could be used as a high-throughput approach for the simultaneous identification of a series of nonessential genes of H. pylori, the transposon–chromosomal junctions of a pool of mutants were amplified by inverse PCR using circular fragments of genomic DNA obtained after chromosomal DNA extracted from the pool of mutants had been digested with HindIII and self-ligated. The amplification products were radioactively labelled and hybridized to a high density macroarray membrane containing a duplicated target sequence for every gene of H. pylori strain 26695. For the positive ORFs the precise site of transposon insertion was confirmed by PCR mapping. In total 78 H. pylori genes were unambiguously identified as nonessential for viability in vitro, including 20 with orthologues of unknown function in other species and 21 which were H. pylori-specific. 2001 Éditions scientifiques et médicales Elsevier SAS random mutagenesis / transposon / inverse PCR / hybridization / array / Helicobacter pylori
1. Introduction The search for factors important in the pathogenesis of Helicobacter pylori has been facilitated by the publication of the entire genome sequence of two clinical strains, 26695 and J99 [1, 18]. Analysis of these genomes has revealed that while the function of 58% of the open reading frames may be predicted, 18.5% have orthologues of unknown function in other species, and 23.5% are H. pylori specific [1]. Characterization of these newly identified genes is likely to identify novel determinants important in survival and colonization of the stomach.
∗ Correspondence and reprints.
E-mail address: [email protected] (P.J. Jenks). 1 Present address: Institute of Infections and Immunity, Floor
C, West Block, University Hospital, Queen’s Medical Centre, Nottingham NG7 2UH, UK.
The genetic and molecular analysis of H. pylori has been greatly facilitated by the development of random mutagenesis strategies for this organism. The construction of random mutant libraries by transposons [6, 10] or an integration plasmid [2] has provided a powerful basis for the characterization of individual genes of H. pylori on the basis of phenotype [2, 14]. However, the increasing availability of microbial genome sequence data is encouraging a more global approach to the study of microorganisms and how they interact with their environment or host [8]. The development of a system that allowed the collective screening of comparatively large numbers of H. pylori mutants both in vitro and in vivo would greatly facilitate further research into the pathogenesis of this organism. In this study, we describe the development of the random mutagenesis and loop amplification (RMLA) system which is able to identify new gene loci involved in virulence-associated traits of H. pylori. We have used a previously described transposon shuttle-
726
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
mutagenesis system [11] to generate random mutations throughout the genome of a transformable strain of H. pylori. The RMLA identification procedure allowed direct determination of the site of transposon insertion within the H. pylori chromosome, so facilitating the identification of individual H. pylori mutants. In addition, RMLA, in combination with hybridization to a high density macroarray containing a duplicated target sequence for every gene of H. pylori strain 26695, was able to identify multiple mutants within a pool, making it a potentially powerful technique for screening large numbers of mutant strains for those with mutations in genes that are not essential for viability in vitro. By combining these approaches we have identified a series of 78 nonessential genes in H. pylori, including 20 with orthologues of unknown function in other species and 21 which are H. pylorispecific. Further analysis of these genes will allow determination of their function and whether they are involved in establishing and maintaining infection of the gastric mucosa.
2. Materials and methods 2.1. Bacterial strains and growth conditions
H. pylori strain G27 [3] was routinely cultured on 10% horse blood agar medium containing antibiotics at the following final concentrations: vancomycin (10 mg/L), polymyxin (2500 U/L), trimethoprim (5 mg/L) and amphotericin B (4 mg/L). Plates were incubated at 37 ◦ C under microaerobic conditions. H. pylori that had undergone chromosomal allelic exchange were selected on medium supplemented with 25 mg/L kanamycin. Escherichia coli strain DH1 [7] was used as the host for plasmid cloning experiments and was grown at 37 ◦ C in Luria-Bertani medium (LB). Antibiotics were used at the following final concentrations unless indicated: 100 mg/L spectinomycin, 8 mg/L tetracycline and 25 mg/L of kanamycin. Independent E. coli transformants were saved by storing up to 96 clones individually in 96-well microtitre plates (plate I.0 to plate XV.0); clones were inoculated into LB supplemented with 8 mg/L tetracycline, 100 mg/L spectinomycin and 7% DMSO and stored at −80 ◦ C.
2.2. General molecular biology techniques and construction of recombinant plasmids
The alkaline lysis procedure was used for small scale plasmid preparation [16]. MIDI Qiagen columns (Qiagen, Courtaboeuf, France) were used for largescale plasmid preparation. Plasmid DNA from each pool of transconjugates was prepared using an alkaline lysis procedure followed by cesium chloride extraction [16]. Whole cell DNA for the preparation of the genomic library of H. pylori G27 was prepared as described previously [13]. Genomic DNA from individual generated H. pylori mutants was extracted using the QIAamp tissue kit (Qiagen) according to the manufacturer’s instructions. Standard procedures for cloning, DNA analysis, colonydot blots and Southern blots were used [16]. Blots were hybridized under standard conditions with [α2 P]-deoxyribonucleotide probes labelled by random priming using the MegaPrime DNA system (Amersham, Les Ulis, France) according to the manufacturer’s instructions. In order to construct a library of cloned H. pylori DNA, chromosomal DNA from H. pylori strain G27 was partially digested with Sau3A, size fractionated on a sucrose gradient (10 to 40%), and 1.5-2.0-kb fragments were ligated into the BglII site of plasmid vector pILL570-1 (table I). These ligated, recombinant plasmids were then transformed into E. coli strain DH1 that contained the transposaseencoding plasmid pTCA (TcR ). This library of H. pylori genomic DNA fragments was stored as individual clones in fifteen 96-well plates at −80 ◦ C (plate I.0 to plate XV.0). 2.3. Urease and catalase assays
To screen for urease activity, individual kanamycinresistant H. pylori transformants were suspended in 50 µL of urea-indole medium as previously described [12]. Colonies that did not turn pink within 30 min were considered urease-negative, and their urease activity was quantified using an assay based on the Bertholet reaction [4]. To screen for catalase activity, individual kanamycin-resistant H. pylori transformants were suspended in 50 µL of 30% v/v hydrogen peroxide. Colonies that did not induce immediate effervescence of the hydrogen peroxide were considered catalase negative.
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734 2.4. Transposon mutagenesis and transformation of H. pylori
Transposon mutagenesis of individual clones was performed using the mini-Tn3-Km transposon (figure 1) [11]. All manipulations were performed in 96well format using a 96-well inoculator designed to deliver a 10-µL liquid volume. Each storage microtitre plate (plate I.0 to plate XV.0) was thawed and used to inoculate a fresh plate (plate I.1 to plate XV.1) with the E. coli DH1 clones that harbored the pTCA and recombinant pILL570-1 derivative plasmids (table I). Plasmid pILL553 harboring the mini-Tn3-Km transposon (a low copy autotransferable plasmid pOX38 derivative) [12] was transferred into these E. coli DH1 clones by conjugation. Transconjugates harbor-
Figure 1. Restriction map and orientation of oligonucleotide primers (rmla-1, rmla-2, rmla-3 and rmla-4) of the mini-Tn3 Km transposon. Black box, Campylobacter kanamycin cassette; shaded box, DNA sequences originating from Tn3 ; crossed box, specific recombination site from phage P1 (loxP ) recognized by the cre gene product.
727
ing all three plasmids (recombinant pILL 570-1 derivative, pTCA and pILL553), were selected by spotting 10 µL of the mating mixture on LB medium containing 25 mg/L kanamycin, 8 mg/L tetracycline and 100 mg/L spectinomycin (plate I.2a to plate XV.2a). The transconjugates were inoculated into new 96-well microtitre plates (plate I.2b to plate XV.2b) and highfrequency transposition of the mini-transposon was obtained by growing the bacteria for 48 h at 30 ◦ C in LB containing 25 mg/L kanamycin, 8 mg/L tetracycline and 100 mg/L spectinomycin. Cointegrates resulting from the transposition of mini-Tn3-Km into pILL570-1 recombinant plasmids were transferred by conjugation into E. coli NS2114SmRif which carries the cre gene encoding the P1-specific recombinase for the lox site of the mini-transposon (plate I.3 to plate XV.3) [17]. Positive selection of resolved forms of the cointegrates was obtained by growth on LB containing 100 mg/L rifampicin, 625 mg/L kanamycin, 625 mg/L spectinomycin and 625 mg/L streptomycin (plate I.4 to plate XV.4). The resultant colonies are E. coli NS2114SmRif cells harboring the pILL5701 derivative in which the mini-Tn3-Km has been inserted and the original pILL553 plasmid. All the colonies that grew on each individual 96-well plate (plate I.4 to plate XV.4) were independently pooled, and plasmid DNA was isolated from each pool of transconjugates. Resultant recombinant plasmids were introduced into H. pylori for allelic exchange by natural transfor-
Table I. H. pylori plasmids and oligonucleotide primers used in this study.
Plasmid/oligonucleotide Plasmid pILL570 pTCA pILL553 Plasmid pools I to XV
Oligonucleotide rmla-1 rmla-2 rmla-3 rmla-4
Characteristics or oligodeoxynucleotide sequence (5 to 3 )
Reference
Spr ; pBR322 derivative in which the DNA sequences responsible for Tn3 immunity have been deleted Tcr ; pACY184 derivative constitutively expressing the Tn3 transposase (TnpA); immune to Tn3 Kmr pOX38 plasmid in which the Tn3-Km transposon has been inserted Spr ; Kmr ; individual pools of pILL570-1 derivative plasmids containing mini-Tn3-Km-disrupted cloned H. pylori chromosomal DNA prepared from plate I.4 to plate XV.4 respectively
[12]
TTTGACTTACTGGGGATCAAGCCTG CGGTATAATCTTACCTATCACCTCA GATCCTTTTTGATAATCTCATGACC CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC
Spr , resistance to spectinomycin; Tcr , resistance to tetracycline; Kmr , resistance to kanamycin.
[17] [11] This work
This work This work This work [9]
728
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
mation. H. pylori strains were naturally transformed with circular plasmid DNA (∼ 2 µg per transformation) using a modification of the technique of Wang et al. [19]. Briefly, bacteria were inoculated as 1 cm patches and grown for 5 h before addition of 10 µL supercoiled plasmid DNA. After further incubation for 18 h, the bacteria from each individual patch were harvested and plated directly onto a single plate of selective medium containing 25 mg of kanamycin/L. 2.5. Identification of H. pylori mutants by loop amplification
The loop amplification procedure was used to generate a PCR product that contained the transposonchromosome junction of each individual mutant. Chromosomal DNA extracted from either an individual mutant or a mixed population of H. pylori mutants (2 µg in a final volume of 60 µL) was digested to completion with HindIII, which cuts twice near one extremity of mini-Tn3-Km (figure 1) and frequently throughout the chromosome of H. pylori. The HindIII-digested fragments were extracted with phenol chloroform, precipitated with ethanol, resuspended in 50 µL TE and diluted 1:5 before selfligation with T4 DNA ligase for 18 h at 16 ◦ C. The ligation mix was then used as a template for inverse PCR amplification of the transposon-chromosome junction, using the oligonucleotide primers rmla-1 and rmla-2 (table I), which are oriented so as to amplify outwards from each end of the kanamycin cassette (figure 1). To identify individual mutants, PCR products were sequenced directly using oligonucleotide rmla-3 which is situated at the 3 end of the mini-Tn3-Km transposon and allows sequencing of the transposonchromosome junction (figure 1; table I). The point of insertion of the mini-Tn3-Km transposon in the H. pylori chromosome was identified by alignment of the sequence with the complete genome sequence of H. pylori strain 26695 as provided by the TIGR database [18]. An H. pylori gene number was allocated to each mutant according to the sequence of strain 26695 [18]. To identify several different H. pylori mutants simultaneously, the mixed population of PCR products (which contains the transposon-chromosome junctions of all the H. pylori mutants within the pool) was radiolabelled with [α-3 P]-dCTP and [α-3 P]-dATP and 0.5 U Klenow (Amersham), using as primers
rmla-1 and rmla-2 [5]. For control experiments, individual plasmid pools (20 ng) linearized by EcoRI and sonicated genomic DNA (25 ng) from H. pylori 26695 were radiolabelled with [α-3 P]-dCTP and [α3 P]-dATP and 0.5 U Klenow, using as primers the random hexamers from Pharmacia [5]. High density oligonucleotide arrays were prepared and provided by Eurogentec (Seraing, Belgium) by gridding (using a 5 × 5 square matrix), in duplicate, 1590 specific amplification products corresponding to each of the predicted open reading frames of H. pylori 26695. Membranes were hybridized at 68 ◦ C and hybridization was revealed by autoradiography with Amersham Hyperfilm-MP. The identity of the positive open reading frames was determined by comparison of the coordinates of each pair of reactive spots to the matrix used for gridding the membrane. The site of transposon insertion in the positive ORFs was confirmed by PCR mapping. Two series of PCR reactions were performed using the chromosomal DNA extracted from the mixed pool of H. pylori mutants as a template. Each reaction used the oligonucleotide rmla-4 (table I), which is situated at both the 5 and 3 end of the mini-Tn3-Km transposon, and an oligonucleotide corresponding to either the 3 or 5 end of each ORF identified by hybridization to the array [9]. 3. Results 3.1. Construction of a nonexhaustive mutant library
The construction of a library of H. pylori mutants was achieved by adapting a shuttle mutagenesis system that we have previously described [10, 13], and validating its use for the generation of random mutations throughout the genome of H. pylori. This system uses the mini-transposon, mini-Tn3-Km, to inactivate H. pylori chromosomal DNA fragments cloned in E. coli. Mini-Tn3-Km (figure 1) is a modified version of the mini-Tn3 transposable element [17] in which the β-lactamase encoding gene has been replaced with a kanamycin-resistance gene of Campylobacter coli [13]. Following transposon insertion within E. coli, the disrupted fragments of H. pylori genomic DNA are transformed into H. pylori for allelic replacement of the intact chromosomal gene by the mutated gene. A library of 1187 H. pylori genomic DNA fragments was constructed and stored as individual clones in fifteen 96-well plates at −80 ◦ C (plate I.0 to plate XV.0), with each 96-well plate containing between 45
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
and 92 individual clones. Hybridization experiments indicated that there was a small degree of redundancy within the library of cloned H. pylori chromosomal DNA and that the library covered approximately 50% of the genome (data not shown). The mini-Tn3-Km transposable element (figure 1) was used to generate random mutations within the cloned H. pylori DNA of individual recombinant plasmids in each of the fifteen 96-well plates (plate I.0 to plate XV.0) through the two mating steps described in Materials and methods. At the end of the mutagenesis procedure, multiple colonies resistant to rifampicin, kanamycin, spectinomycin and streptomycin were obtained for each of the 1187 individual clones, suggesting that the mini-transposon had been inserted into individual recombinant plasmids on multiple occasions. After mutagenesis, all colonies from each individual 96-well plate (plate I.4 to plate XV.4) were pooled and plasmid DNA was purified by caesium chloride extraction (fifteen independent plasmid preparations). Restriction analysis of one of the 15 plasmid pools (plasmid pool I prepared from plate I.4) with ClaI and PstI resulted in a large smear below 5.3 kb (the size of plasmid pILL5701) suggesting that insertion of the mini-transposon had occurred predominantly in cloned H. pylori genomic DNA rather than the vector. As previously shown [12], the proportion of cloned H. pylori DNA fragments disrupted by this procedure was 99%. The fifteen individual pools of plasmids containing mini-Tn3-Km-disrupted fragments of H. pylori DNA (plasmid pools I to XV) were then introduced independently into H. pylori strain G27 by natural transformation. Each individual pool of plasmids (∼ 2 µg of DNA) yielded between 200 and 1200 kanamycinresistant transformants of H. pylori G27 (100–600 CFU/µg of DNA). Southern hybridization analysis of kanamycin-resistant transformants obtained after exposure of H. pylori to transforming pooled plasmid DNA (plasmid pool 1) for 3 h or 18 h revealed that all the transformants had single insertions in different loci of the bacterial chromosome, and demonstrated that allelic replacement occurred as early as 3 h and that events remained predominantly independent at 18 h (figure 2). This confirmed that the majority of H. pylori mutants obtained using our protocol were truly independent and not the result of the clonal multiplication of transformants arising from early allelic exchange events.
729
Figure 2. Southern hybridization analysis of randomly selected H. pylori G27 kanamycin-resistant transformants obtained after exposure of H. pylori strain G27 to plasmid pool I (prepared from plate I.4) for 3 h or 18 h. Chromosomal DNA of individual transformants was digested with HindIII, separated on a 1% agarose gel and transferred onto a nitrocellulose membrane, before hybridization with a purified kanamycin resistance gene probe. Lanes 1 to 11, kanamycin-resistant transformants obtained after 3-h transformation; lanes 12 and 15, positive controls; lanes 13 and 14, H. pylori strain G27; lanes 16 to 26, kanamycinresistant transformants obtained after 18 h transformation.
3.2. Identification of individual H. pylori mutants by RMLA
Having demonstrated that the mini-Tn3-Km mutagenesis system was able to generate random, single mutations throughout the genome of H. pylori, we wished to determine whether this approach could be used to identify individual H. pylori mutants, including those deficient for specific phenotypes. The library of H. pylori G27 mutants was therefore screened for loss of urease or catalase enzyme activities. Screening with urea-indole medium identified three independent kanamycin-resistant H. pylori G27 transformants that were urease negative and quantitative determination of urease activity confirmed that these mutants were devoid of urease activity. Screening with hydrogen peroxide identified three independent kanamycin-resistant H. pylori G27 transformants that were catalase negative. Direct determination of the site of mini-transposon insertion using the RMLA identification procedure revealed that all the urease-negative mutants were disrupted at different sites within the ureE gene. For the catalase-
730
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
Table II. Nonessential genes of H. pylori identified by inverse PCR and either sequencing or hybridization to a macroarray.
Cellular function of identified genea H. pylori-specific with no known function
Conserved with no known function
Amino acid biosynthesis/protein synthesis Biosynthesis of cofactors, prosthetic groups and carriers Cell envelope Cellular processes Central intermediary metabolism DNA metabolism Energy metabolism
Genes identified by inverse PCR and sequencing HP0014, HP0053, HP0058* , HP0080, HP0095, HP0158, HP0209, HP0271, HP0344, HP0356, HP0368, HP0505, HP0563, HP0603, HP1081 HP0031, HP0040* , HP0065, HP0139, HP0170, HP1080, HP1338, HP1401
Genes identified by hybridization and PCR mapping HP0097, HP0112, HP0893, HP1057, HP1188, HP1410
HP1118* (ggt)
HP0293, HP0329, HP1118* (ggt)
HP0477, HP0506, HP0923 HP0875* (katA), HP0887* (vacA), HP1420* (fliI) HP0070* (ureE) HP1009 HP0954* (rdxA)
HP0923, HP1052 HP1126
Fatty acid and phospholipid metabolism Purines, pyrimidines, nucleosides and nucleotides Regulatory functions Transport and binding proteins
HP0117, HP0118, HP0120, HP0139, HP0328, HP0381, HP0677, HP1056, HP1187, HP1349, HP1401, HP1409, HP1411, HP1466 HP0171, HP0380, HP0476, HP1050
HP0197 HP1121 HP0121, HP0192* (frdA), HP0294 (amiE) HP0215 HP0255, HP0829
HP0792 HP0299, HP0475, HP1077* (nixA), HP1252, HP0055, HP0613, HP1091, HP1180 HP1329, HP1491 a Function allocated according to the Pylori Gene World-Wide Web Server (http://genolist.pasteur.fr/PyloriGene/). * Genes previously identified as nonessential by other workers.
negative mutants the mini-transposon was inserted within or 27 bp upstream of the coding region of the catalase gene. Using the RMLA approach, a total of 39 genes were individually identified as nonessential in vitro, including 8 with orthologues of unknown function in other species and 15 which were H. pylori specific (table II). 3.3. Screening for H. pylori genes that are nonessential in vitro
In order to develop a global approach to identify genes of H. pylori that are nonessential for viability, three pools of H. pylori mutants were generated by independent transformation of strain G27 with plasmid pools IV (prepared from plate IV.4 and which contained 63 clones), VI (prepared from plate VI.4 and which contained 74 clones) and VII (prepared from plate VII.4 and which contained 70 clones). The
kanamycin-resistant H. pylori transformants resulting from each transformation were pooled, and chromosomal DNA was independently extracted from each mixture of mutants. Chromosomal DNA from the three different pools was then combined and used to generate a mixed population of PCR products using the RMLA procedure. A series of hybridizations was performed using a high-density macroarray membrane containing a duplicated target sequence of every gene of H. pylori strain 26695. Firstly, a probe prepared from sonicated chromosomal DNA extracted from strain 26695 was hybridized to the membrane. Hybridization was observed across the array (figure 3A). Next, in order to determine the number of independent mini-Tn3Km-disrupted fragments of H. pylori DNA contained within the three plasmid pools that were used to generate the mutants, DNA from plasmid pools IV, VI
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
(A)
731
and VII was combined. The pooled plasmids were linearized with EcoRI before being radiolabelled and hybridized to the macroarray. In total, 204 individual pairs of spots were identified as positive (figure 3B). Finally, the PCR products generated from the pool of H. pylori mutants by the RMLA procedure were radiolabelled and hybridized to the macroarray (figure 3C). A total of 72 positive ORFs were identified including 9 groups of between 2 and 5 ORFs that were adjacent to each other on the array (table II). Of these, PCR mapping unambiguously identified 43 nonessential genes, including 14 with orthologues of unknown function in other species and 6 which were H. pylori-specific. 4. Discussion
(B)
(C) Figure 3. Identification of nonessential genes of H. pylori by hybridization to a high-density macroarray. (A) Hybridization of the array with a probe prepared from sonicated chromosomal DNA from H. pylori strain 26695. (B) Hybridization of the array with a probe prepared from plasmid pools IV, VI and VII extracted from plates IV.4, VI.4 and VII.4 respectively. (C) Hybridization to the array of a probe prepared using the RMLA procedure on chromosomal DNA extracted from pooled kanamycin-resistant transformants obtained by transformation of H. pylori strain G27 with plasmid pools IV, VI and VII.
Although the complete genome sequence of H. pylori has been in the public domain for over three years, none of the high-throughput approaches that allow the simultaneous examination of multiple genes of a microorganism have been successfully used for the molecular and genetic analysis of this organism. The development of the RMLA system for H. pylori represents an extremely useful tool for identifying virulence factors in this bacterium. RMLA can be used to generate a random library of mutants in transformable strains of H. pylori, and the development of a simple technique for the identification of the site of the transposon insertion allows rapid and direct identification of individual mutants. Furthermore, because this strategy is able to identify multiple mutants within a pool, RMLA has considerable potential for the high-throughput screening of H. pylori genes. RMLA is simple to perform and utilizes standard molecular biology techniques. It is therefore a suitable approach for other research groups wishing to perform similar genome-wide studies on this organism. In this study, we have demonstrated that the miniTn3-Km transposable element, which was originally developed for the random insertional inactivation of selected, individual genes [13], can also be used to generate random mutations throughout the genome of H. pylori and generate libraries of nonessential mutants. The approach can be used to mutate either randomly cloned fragments of H. pylori chromosomal DNA, as in this study, or cloned entire open reading frames. We have recently developed a rapid
732
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
and efficient cloning system that has allowed us to clone every open reading frame of H. pylori strain 26695 [9]. We now intend to systematically inactivate each open reading frame of this strain of H. pylori, and to classify genes as nonessential or essential according to whether it is possible or not to disrupt them in H. pylori. In order to validate the RMLA procedure, we screened the generated library of H. pylori mutants for urease-negative and catalase-negative strains. Although there was only a small degree of redundancy within the library of 1187 clones of H. pylori chromosomal DNA used to generate the mutant bank, we were aware that coverage of the entire genome was not comprehensive. This was confirmed during the urease screen which only identified three independent mutants devoid of urease activity. The three urease-negative mutants were derived from three independent insertions of the mini-transposon within the same corresponding cloned fragment of H. pylori chromosomal DNA. The observation that the three different catalase-negative mutants were also derived from a common cloned fragment of H. pylori chromosomal DNA confirmed the efficiency of the mini-Tn3-Km mutagenesis system. The fact that the mini-transposon is independently inserted at multiple positions within a given cloned fragment of H. pylori chromosomal DNA greatly increases the likelihood of generating a mutant by natural transformation of H. pylori. One of the advantages of RMLA is that the position of transposon insertion within the chromosome of the H. pylori mutant can be directly determined without the need for cloning the transposon-chromosomal junction or excessive experimental manipulations. The RMLA system generates a PCR product that contains the transposon-chromosomal junction and which can be used as a template to identify the site of insertion by sequencing out from the transposon. Using the RMLA procedure the three urease-negative and three catalase-negative H. pylori mutants were demonstrated to have transposon disruption of genes expected to be involved in urease and catalase enzyme activities [4, 15]. Using this technique, we have individually identified 39 nonessential H. pylori genes, and it has been possible to sequence up to 500 bp of the H. pylori chromosomal DNA adjacent to the minitransposon. As well as using RMLA to identify individual mutants, we also wanted to determine whether this
system could be used for the large-scale identification of nonessential genes of H. pylori. Using this system, in combination with hybridization to a highdensity macroarray, we were able to identify a large number of genes that are not essential for viability in H. pylori under the environmental conditions used. The identification of nonessential genes of H. pylori, particularly those with no defined function, is an important step in the determination of their function and biological role. It is likely that certain of the nonessential genes identified by this screen represent previously unidentified components of known biological systems or are involved in processes that are unique to H. pylori. Further analysis of these genes will allow determination of their function and whether they are involved in establishing and maintaining infection of the gastric mucosa. Theoretically, the identification of nonessential genes of an organism by such an approach allows the determination of essential genes by deduction. This is of considerable interest because the factors that are absolutely required for growth and viability provide potential targets for the development of new anti-H. pylori agents. It is possible that the genes present in plasmid pools IV, VI and VII for which mutants were not obtained are essential genes in H. pylori. However, certain limitations of RMLA, such as the reduced efficiency of natural transformation of H. pylori by pooled plasmids, could also explain why these mutants were not obtained. Ultimately, confirmation of the essential role of genes that cannot be disrupted in H. pylori will have to be performed using a gene by gene approach. The ability of RMLA to identify simultaneously multiple mutants also means that it has considerable potential for studying the pathogenesis of H. pylori in vivo. Comparison of the members of a pool of mutants used to inoculate an animal compared to those subsequently recovered would allow the identification of factors that are dispensable in establishing and maintaining infection of the gastric mucosa. One limitation of using the RMLA hybridization strategy on randomly cloned fragments of H. pylori chromosomal DNA was the difficulty in interpreting the significance of lines of adjacent reactive spots on the macroarray. There are two possible explanations for this phenomenon. The first is the presence of individual mutants within the pool which have the minitransposon inserted within genes that are adjacent to each other on the cloned H. pylori chromosome
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734
fragment. The second is that the HindIII-generated fragment of mutant chromosomal DNA that is used to generate the probe contained the gene in which the mini-transposon was inserted plus a portion of the adjacent gene(s). Hybridization will therefore occur between those ORFs contained within the probe and all the homologous ORFs on the array. To circumnavigate this problem, the precise site of transposon insertion was determined by PCR mapping using an oligonucleotide common to both the 5 and 3 end of the mini-Tn3-Km transposon, and another oligonucleotide corresponding to either the 3 or 5 end of each ORF identified by hybridization to the array. Using this approach we were able to collectively screen a large number of H. pylori mutants and identify a further 43 genes that were nonessential in vitro. In conclusion, RMLA has proven to be a relatively simple system for identifying nonessential genes of H. pylori and for the simultaneous examination of multiple genes. Because RMLA permits the collective screening of comparatively large numbers of H. pylori mutants this technique has considerable potential as a global approach for the study of this organism. Acknowledgements P.J. Jenks was supported by a Research Training Fellowship in Medical Microbiology from the Wellcome Trust, United Kingdom (Ref 044330). Financial support was provided in part by Aventis-Pasteur, Lyon, France, OraVax, Boston, MA, USA, Institut de Recherche des Maladies de l’Appareil Digestif (IRMAD), Rueil Malmaison, France and Eurogentec, Seraing, Belgium. References [1] Alm R.A., Ling L.-S.L., Moir D.T., King B.L., Brown E.D., Doig, P.C., Smith D.R., Noonan B., Guild B.C., deJonge B.L., Carmel G., Tummino P.J., Caruso A., Uria-Nickelsen M., Mills D.M., Ives C., Gibson R., Merberg D., Mills S.D., Jiang Q., Taylor D.E., Vovis G.F., Trust T.J., Genomicsequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori , Nature 397 (1999) 176–180. [2] Bijlsma J.J.E., Vandenbroucke-Grauls C.M.J.E., Phadnis S.H., Kusters J.G., Identification of virulence genes of Helicobacter pylori by random insertion mutagenesis, Infect. Immun. 67 (1999) 2433–2440.
733
[3] Covacci A., Censini S., Bugnoli M., Petracca R., Burroni D., Macchia G., Massone A., Papini E., Xiang Z., Figura N., Rappuoli R., Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer, Proc. Natl. Acad. Sci. USA 90 (1993) 5791–5795. [4] Cussac V., Ferrero R.L., Labigne A., Expression of Helicobacter pylori urease genes in Escherichia coli grown under nitrogen-limiting conditions, J. Bacteriol. 174 (1992) 2466–2473. [5] Feinberg A.P., Vogelstein B., A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity, Anal. Biochem. 132 (1983) 6–13. [6] Haas R., Meyer T.F., van Putten J.P.M., Aflagellated mutants of Helicobacter pylori generated by genetic transformation of naturally competent strains using transposon shuttle mutagenesis, Mol. Microbiol. 8 (1993) 753–760. [7] Hanahan D., Studies on transformation of Escherichia coli plasmids, J. Mol. Biol. 166 (1983) 557–580. [8] Jenks P.J., Sequencing microbial genomes-what will it do for microbiology?, J. Med. Microbiol. 47 (1998) 375–382. [9] Labigne A., Ecobichon C., Thiberge J.M., Systematic cloning of the 1590 Orfs of the 26695 genome as a tool for H. pylori (Hp) gene expression and functional analysis, in: Abstracts of the 10th International Workshop on Campylobacter, Helicobacter and related organisms, Baltimore, M.A., 1999, p. 135. [10] Labigne A., Random mutagenesis of the H. pylori genome, in: Clayton C.L., T. H.M. (Eds.), Helicobacter pylori protocols, Humana Press, Totowa, N.J., 1997, pp. 153–163. [11] Labigne A., Courcoux P., Tompkins L., Cloning of Campylobacter jejuni genes required for leucine biosynthesis, and construction of leu -negative mutant of C. jejuni by shuttle transposon mutagenesis, Res. Microbiol. 143 (1992) 15–26. [12] Labigne A., Cussac V., Courcoux P., Shuttle cloning and nucleotide sequence of Helicobacter pylori genes responsible for urease activity, J. Bacteriol. 173 (1991) 1920–1931. [13] Labigne-Roussel A., Courcoux P., Tompkins L., Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni , J. Bacteriol. 170 (1988) 1704–1708. [14] Odenbreit S., Till M., Hofreuter D., Faller G., Haas R., Genetic and functional characterization of the alpAB gene locus essential for the adhesion of Helicobacter pylori to human gastric tissue, Mol. Microbiol. 31 (1999) 1537–1548. [15] Odenbreit S., Wieland B., Haas R., Cloning and genetic characterization of Helicobacter pylori catalase and construction of a catalase-deficient mutant strain, J. Bacteriol. 178 (1996) 6960–6967. [16] Sambrook J., Fritsch E.F., Maniatis T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. [17] Seifert H.S., Chen E.Y., So M., Heffron F., Shuttle mutagenesis: a method of transposon mutagenesis for Saccharomyces cerevisae, Proc. Natl. Acad. Sci. USA 83 (1986) 735–739. [18] Tomb J.F., White O., Kervalage A.R., Clayton R.A., Sutton G.G., Fleischmann R.D., Ketchum K.A., Klenk H.P., Gill S., Dougherty B.A., Nelson K., Quackenbush J., Zhou L., Kirkness E.F., Peterson S., Loftus B., Richard-
734
P.J. Jenks et al. / Res. Microbiol. 152 (2001) 725–734 son D., Dodson R., Khalak H.G., Glodek A., McKenney K., Fitzegerald L.M., Lee N., Adams M.D., Hickey E.K., Berg D.E., Gocayne J.D., Utterback T.R., Peterson J.D., Kelley J.M., Cotton M.D., Weidman J.M., Fujii C., Bowman C., Watthey L., Wallin E., Hayes W.S., Borodovsky M., Karp P.D., Smith H.O., Fraser C.M., Ventor J.C., The com-
plete genome sequence of the gastric pathogen Helicobacter pylori , Nature 388 (1997) 539–547. [19] Wang Y., Roos K.P., Taylor D.E., Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker, J. Gen. Microbiol. 39 (1993) 2485–2493.