Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology

ARTICLE IN PRESS Cancer Letters ■■ (2016) ■■–■■

Contents lists available at ScienceDirect

Cancer Letters j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / c a n l e t

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36

Q2 Original Articles

Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology Q1 Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas * Department of Biochemistry and Molecular Biology, University of Athens, Athens, Greece

A R T I C L E

I N F O

Article history: Received 18 November 2015 Received in revised form 9 January 2016 Accepted 11 January 2016 Keywords: BCL2 family Splice variants Alternative splicing Apoptosis NGS

A B S T R A C T

The next-generation sequencing (NGS) technology has enabled genome-wide studies, providing massively parallel DNA sequencing. NGS applications constitute a revolution in molecular biology and genetics and have already paved new ways in cancer research. BCL2L12 is an apoptosis-related gene, previously cloned from members of our research group. Like most members of the BCL2 gene family, it is highly implicated in various types of cancer and hematological malignancies. In the present study, we used NGS to discover novel alternatively spliced variants of the apoptosis-related BCL2L12 gene in many human cancer cell lines, after 3′-RACE nested PCR. Extensive computational analysis uncovered new alternative splicing events and patterns, resulting in novel alternative transcripts of the BCL2L12 gene. PCR was then performed to validate NGS data and identify the derived novel transcripts of the BCL2L12 gene. Therefore, 50 novel BCL2L12 splice variants were discovered. Since BCL2L12 is involved in the apoptotic machinery, the quantification of distinct BCL2L12 transcripts in human samples may have clinical applications in different types of cancer. © 2016 Published by Elsevier Ireland Ltd.

37

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Introduction Cancer is undoubtedly one of the most serious diseases worldwide. Every year, an enormous number of new cases and deaths are reported. It is remarkable that 25% of deaths in the United States is due to cancer [1]. As a result, cancer diagnosis, prognosis, and therapy have been in the center of research in the past decades. The development of molecular biology along with molecular techniques has vitally contributed to the great progress in diagnosis and prognosis of many types of cancer, as it has led so far to the discovery of various molecules with biomarker potential, such as miRNAs [2], oncogenes [3], tumor suppressor genes [4] and various gene products like enzymes [5] or hormones [6]. All these cancer biomarkers are particularly useful because they have ameliorated the monitoring of the progress of the disease. Moreover, they facilitated the evaluation of the most appropriate therapeutic targets for a specific cancer type and long-term susceptibility to cancer or its recurrence [7]. Moreover, the multifactorial nature of cancer renders its treatment an extremely difficult and complex problem. Therefore, new insights regarding the pathophysiology of cancer

58 59 60 61

* Corresponding author. Tel.: +30 2107274306; fax: +30 2107274158. E-mail address: [email protected] (A. Scorilas).

must be gained, and high throughput sequencing technology is probably the most promising and powerful weapon that can assist this scientific effort. The next-generation sequencing (NGS) technology has enabled advanced genomic research studies. NGS applications constitute a revolution in molecular biology and genetics and have already paved new ways in cancer research [8]. One of the most important applications of NGS technology is high-throughput RNA sequencing (RNA-seq). RNA-seq is a cost-effective technology for high-throughput transcriptome analysis, providing a lot of information about the characterization and quantification of the expressed RNA molecules in a sample. Despite the tremendous amount of datasets that NGS generates, which is probably its main disadvantage due to the parallel need for advanced bioinformatics and computational skills, the use of NGS technology can lead to significant genetic and molecular discoveries. In addition, NGS can be used to identify alternative splicing events, as it can unravel novel alternative splicing patterns or other splicing variations such as intron retentions and novel exons, thus resulting in the discovery of novel alternative transcripts [8,9]. Alternative splicing is a molecular mechanism that allows individual genes to produce multiple different RNAs and thus usually give birth to multiple protein isoforms. Alternative splicing plays a fundamental role in cancer pathobiology [10].

http://dx.doi.org/10.1016/j.canlet.2016.01.019 0304-3835/© 2016 Published by Elsevier Ireland Ltd.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

2

86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147

Apoptosis is a finely tuned form of programmed cell death that occurs next to cell exposure to physiological, pathogenic, or cytotoxic stimuli. Dysregulation of apoptosis contributes significantly to carcinogenesis and cancer progression, as well as to unresponsiveness of malignant neoplasms to therapeutic intervention [11,12]. The molecular machinery underlying apoptosis involves several proteins accounting for the morphological and biochemical changes that characterize this normal process. Apoptosis is executed by a family of cysteine proteases, widely known as caspases, the activation of which is tightly regulated by members of the B-cell CLL/lymphoma 2 (BCL2) family [13]. The BCL2 family consists of proapoptotic and antiapoptotic members that share structural homology, as all of them contain at least one of the four BCL2-homology domains (BH1, BH2, BH3, and/or BH4) [14]; however, sequence similarity among BCL2 family members is low. In fact, the relative balance between proapoptotic and antiapoptotic BCL2 family members dictates sensitivity (or resistance) of cells to apoptotic stimuli, including growth factor deprivation, hypoxia, irradiation, anticancer drug treatment, oxidants, and Ca2+ overload [15]. Owing to their pivotal role in cell fate determination, several BCL2 family members show a significant prognostic and/or chemotherapy response-predictive value in many human malignancies [16–18]. BCL2L12 is a member of the BCL2 family and, therefore, an apoptosis-related gene, which partially overlaps with the interferon regulatory factor 3 (IRF3) gene. Currently, thirteen distinct transcripts resulting from alternative splicing of the BCL2L12 gene are known [19], seven of which are predicted to encode distinct protein isoforms, while the remaining six are nonsense-mediated mRNA decay (NMD) candidates (Supplementary Fig. S1). mRNA expression of BCL2L12 has been detected in most human tissues [20]. The main BCL2L12 transcript consists of seven coding exons and its translation produces the “classical” BCL2L12 protein isoform (BCL2L12 is.1), a 334-amino acid polypeptide with both nuclear and cytosolic localization [20,21]. The full-length BCL2L12 protein isoform is a multifunctional protein containing a highly conserved BH2 domain, a BH3-like motif, and a proline-rich region [20]. However, unlike typical BCL2 family members, BCL2L12 does not does not affect cytochrome c release or apoptosome-driven caspase 9 activation, but instead exerts its antiapoptotic role via multiple protein– protein interactions [22,23]. In the cytoplasm, BCL2L12 inhibits effectors caspases 3 and 7 through two different mechanisms. In particular, BCL2L12 interacts directly with pro-caspase 7 to inhibit its processing and activation [24], while it upregulates the mRNA expression of the CRYAB gene, the product of which (crystallin alpha B) neutralizes caspase 3 [21]. In the nucleus, BCL2L12 forms a complex with the tumor protein p53 and prevents its binding to promoters of apoptosis-related genes, thereby inhibiting p53directed transcriptomic changes upon DNA damage [25]. Interestingly, yeast two-hybrid screening revealed that BCL2L12 is also a binding partner of two antiapoptotic BCL2 family members (BCL2 and BCLXL) [26,27], glycogen synthase kinase 3 beta (GSK3B) [28] – which was previously shown to phosphorylate BCL2L12 at specific amino acid residues [29] – and a specific protein isoform of estrogen receptor beta (ERβ5) [30]. In the present study, we performed NGS technology to search for, identify, and characterize novel alternatively spliced variants of the BCL2L12 gene in many human cancer cell lines. After in-depth computational analysis, we have detected novel alternative splicing events in this apoptosis-related gene, leading to novel BCL2L12 transcripts.

148

Culture of human cell lines

149 150

Fifty six human cell lines were used in the current study, as presented here below: MCF-7, SK-BR-3, BT-20, BT-474, MDA-MB-231, MDA-MB-435S, MDA-MB-468, T-47D,

Materials and methods

151 152 153 154 155 156 157 158 159 160

ZR-75-1 (breast cancer), OVCAR-3, SK-OV-3, ES-2, MDAH-2774, Ishikawa, SK-UT1B, HeLa, SiHa (ovarian cancer), PC-3, DU 145, LNCaP (prostate cancer) T24, RT4 (urinary bladder cancer), ACHN, 786-O, Caki-1 (renal cell carcinoma), Caco-2, DLD1, HT-29, HCT 116, SW 620, COLO 205, RKO (colorectal carcinoma), AGS (gastric adenocarcinoma), Hep G2, HuH-7 (hepatocellular carcinoma), U-87 MG, U-251 MG, D54, H4, SH-SY5Y (brain cancer), A549 (lung carcinoma), FM3 (melanoma), U-937, Raji, Daudi, REC-1, SU-DHL-1, GRANTA-519 (lymphoma), K-562, HL-60, Jurkat (leukemia), BB49-SCCHN, CAL-33 (head and neck squamous cell carcinoma), HEK293 (embryonic kidney), MCF-12A (breast), and 1.2B4 (pancreas). All cell lines were cultured based on the American Type Culture Collection® guidelines.

161 Total RNA extraction and cDNA synthesis

162

Total RNA was extracted from each cell line using the TRIzol® Reagent (Ambion™, Austin, TX, USA), diluted in THE RNA Storage Solution (Ambion™), and stored at −80 °C until further use. Total RNA purity and concentration were assessed spectrophotometrically at 260 and 280 nm. First-strand cDNA synthesis was then carried out according to the manufacturer’s instructions in reaction volumes of 20 μL using 5 μg of total RNA from each cell line, SuperScript® II Reverse Transcriptase (Invitrogen™, Carlsbad, CA, USA) and an oligo-dT–adaptor primer (5′-GCGAGCACAGAATTAATA CGACTCACTATAGGTTTTTTTTTTTTVN-3′, where V = G, A, C, and N = G, A, T, C). All cDNA libraries were diluted 5-fold.

163 164 165 166 167 168 169 170 171 172

3′-Rapid Amplification of cDNA Ends (3′-RACE) PCR and product purification

173

3′-RACE touchdown PCR was used for first round amplification of BCL2L12 transcripts. A forward gene-specific primer (5′-AACAGACCCAAAAGCCGATG-3′), designed to target the region of the annotated start codon region, and a universal reverse primer (5′-GCGAGCACAGAATTAATACGACT-3′) annealing on the oligo-dT–adaptor primer sequence were used. In order for 3′-RACE PCR to be specific for BCL2L12 mRNAs, “BCL2L12 F (atg)” was designed. Therefore, by the end of 3′-RACE PCR the amplification of nucleic acid sequences from our mRNA template between the defined internal site (ATG codon) and the 3′ end of the mRNA was accomplished. All 3′-RACE touchdown PCR products were diluted 1:30 in nuclease-free water and used as templates for 3′-RACE nested touchdown PCR. Accordingly, 3′-RACE nested PCR was carried out using another gene-specific forward primer for BCL2L12 (5′-CCGCTGGGCTGTTCCCG-3′) and a second universal reverse primer (5′AGCACAGAATTAATACGACTCACTATAGG-3′). The purpose of 3′-RACE nested touchdown PCR was to increase sensitivity and specificity for BCL2L12, as well as the PCR yield [31,32]. PCR was performed out in a 25-μL reaction mixture containing MgCl2-free KAPA Long Range Buffer 1× (Kapa Biosystems Inc., Woburn, MA, USA), 1.5 mM MgCl2, 0.2 mM dNTPs, 50 pmol of each primer, and 2 units of KAPA Long Range DNA Polymerase (Kapa Biosystems Inc.), in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems™), under the following cycling conditions: a denaturation step at 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 sec, 62 °C (auto-ΔTa: −0.3 °C/cycle) for 15 sec, 72 °C for 2 min, and a final extension step at 72 °C for 5 min. All 3′-RACE nested PCR products were cleaned-up using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel GmbH & Co. KG, Duren, Germany), following the manufacturer’s instructions. After the clean-up, the concentration and purity of all purified PCR products were assessed spectrophotometrically at 260 and 280 nm. Finally, all samples were stored at −20 °C until further use.

174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199

Q3

200 NGS library construction

201

We mixed 10 μL of all purified 3′-RACE nested PCR products and proceeded to NGS library preparation with the Ion Xpress™ Plus Fragment Library Kit (Ion Torrent™) according to the manufacturer’s instructions, starting from 100 ng of purified DNA (PCR product mix). In brief, we used the Ion Shear™ Plus Reagents (Ion Torrent™) for enzymatic fragmentation of the PCR products, followed by purification of the fragmented DNA. The subsequent steps included adapter ligation, nick-repair, purification of the ligated DNA, size-selection of the unamplified library (200-baseread library) with an E-Gel® SizeSelect™ Agarose (Invitrogen™), and quantification of the library using the Ion Library TaqMan™ Quantitation Kit (Ion Torrent™) in a ABI 7500 Fast Real-Time PCR System (Applied Biosystems™).

202 203 204 205 206 207 208 209 210 211 212

Template preparation, enrichment, and next-generation sequencing (NGS)

213

NGS template was prepared using the Ion PGM™ Template OT2 200 Kit (Ion Torrent™) in an Ion OneTouch™ 2 System (Ion Torrent™), as per manufacturer’s instructions. The quality of the unenriched template-positive Ion Sphere™ Particles was assessed with the Ion Sphere™ Quality Control Kit in a Qubit® 2.0 Fluorometer (Invitrogen™) prior to their enrichment using again the Ion PGM™ Template OT2 200 Kit (Ion Torrent™) in an Ion OneTouch™ ES instrument (Ion Torrent™), following the manufacturer’s instructions. Finally, NGS based on the semi-conductor sequencing technology was carried out using the Ion PGM™ Sequencing 200 Kit v2 and an Ion 314™ Chip in an Ion Personal Genome Machine® (PGM™) System (Ion Torrent™), according to the manufacturer’s instruction.

214 215 216 217 218 219 220 221 222 223

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

224

NGS data analysis

225 226 227 228 229 230 231 232 233 234 235 236 237 238

The Torrent Suite™ Software (Ion Torrent™) was used for base calling and alignment of raw data to the human genome, and hence generated a FASTQ file, which was subsequently fed to the publically available, online GALAXY suite of software tools for NGS data analysis (https://galaxyproject.org). Therefore, GALAXY produced several distinct output files, including the “accepted hits” (BAM) file that contains a list of the reads aligned to the reference genome and the “splice junctions” (BED) file that comprises the splice junctions reported by the TopHat2 algorithm. Both BAM and BED files were used for visualization, processing, and analysis of the NGS data. The Integrative Genomics Viewer (IGV) [33] was used for interactive visual exploration of the results contained in the BAM and BED files, uncovering alternative splicing patterns in read alignments. Moreover, IGV enabled high performance visualization and thorough examination of regions in the reference genome where the sequencing reads were mapped and also provided the read coverage of every genomic region.

Q4

239 240

Validation of NGS results with nested PCR and agarose gel electrophoresis

241 242 243 244 245 246 247 248 249 250 251 252 253 254

We used nested PCR to verify NGS data analysis results and to examine which alternative splicing transcripts are derived from the combination of multiple alternative splicing events. For this purpose, we designed BCL2L12 variant-specific PCR primers (Table 1) using the Primer-BLAST online tool (http://www.ncbi.nlm.nih .gov/tools/primer-blast/) [34]. Both PCR amplification rounds were performed out in 25-μL reaction mixtures containing MgCl2-free KAPA Long Range Buffer 1× (Kapa Biosystems Inc., Woburn, MA, USA), 1.5 mM MgCl2, 0.2 mM dNTPs, 50 pmol of each primer, and 2 units of KAPA Long Range DNA Polymerase (Kapa Biosystems Inc.), in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems™), under the following cycling conditions: a denaturation step at 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 sec, 60 °C for 15 sec, 72 °C for 2 min, and a final extension step at 72 °C for 5 min. First-round PCR products were diluted 40-fold and used as templates for nested PCR. All nested PCR products were electrophoresed on agarose gels.

255 256 257 258 259 260 261 262 263

Results

292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309

Novel 3′-extension of exon 3 NGS data analysis revealed the existence of a 3′-extension of BCL2L12 exon 3. This 3′-extension of exon 3 is 49 nucleotides long and has the following sequence: 5′-GTAAGAGATTTCCATGATCATCTAT GAAGCCGGCAGAACACGGGATAAG-3′. No mutual exclusion was observed between this novel exon and neighboring exons of the BCL2L12 gene. Thus, the novel 3′-terminus of exon 3 is spliced to exon 4 (Fig. 2). This novel splice site is a canonical one, as the intervening intron that follows starts with a GT dinucleotide. Interestingly, this exon extension contains an in-frame translation termination codon (TGA).

310 311 312 313 314 315 316 317 318 319 320 321 322

Computational analysis of NGS output data revealed the existence of BCL2L12 transcripts with retention of intron 1 and intron 2, as well as with 3′-extension of exon 3 (Fig. 1). Analysis of the sequencing data revealed high coverage of intron 1 of the

Table 1 List of primers that were used for the validation of NGS results.

267

Forward primera

Primer sequence (5′→3′)

Length (nt)

Tm (°C)b

268 269 270 271 272 273 274 275 276

1extF 2F 2/4F 2extF 3F 3extF 1/2F 2/3F 2/3altF

CCAGGTCAGCGGGGTGTT CCTTCCTTAGGCGTGGTGAG CAACTCCACCTAGGCCCAG CTAGGTAAGAGGAGTGGCCCTT CCCTCGGCCTTGCTCTCT GAGCCTGGTAAGAGATTTCCATGA GGACCAGGTGCCTCCATG CAACTCCACCTAGAAGCCCTG CACCTAGCCCTGCCCAAG

18 20 19 22 18 24 18 21 18

61.95 60.11 59.40 60.63 61.08 60.14 59.73 60.17 59.73

277

Reverse primera

Primer sequence (5′→3′)

Length (nt)

Tm (°C)b

278 279 280 281 282 283 284 285 286

2/7R 4/7R 5/6R 5/7R 5ext/7R 6/7R 5ext/6R 7R 7altR

GGATGCCCTCCTAGGTGGAGT GATGCCCTCCTGGGCTGG GGTCCGAGGCCAGCTTCT CAGGATGCCCTCCTTCTGGT GATGCCCTCCATTCCGCA CAGGATGCCCTCCCAGCC GTCCGAGGCCAGCATTCC TCAAGTCCACGGGTGAAACA TCAGTCCAATGGCAAGTTCAAG

21 18 18 20 18 18 18 20 22

62.80 62.20 61.39 61.28 59.81 62.20 60.51 59.46 59.11

287 288 289 290 291

BCL2L12 gene, which consists of 617 nucleotides. No splice sites were detected in the retained intron 1. The abrogation of the 3′-splice site of exon 1 was present in 588 reads and the abrogation of the 5′-splice site of exon 2 was present in 2000 reads, confirming intron 1 retention (Fig. 2). However, no single read contained the complete intron 1 due to the large length of this latter. Similarly, high coverage of intron 2 of the BCL2L12 gene was observed. Again, no splice sites were detected in the retained intron 2. Owing to its small size (222 nucleotides), the complete intron 2 was also covered by single reads (Fig. 2). The total coverage of the retained intron 2 was 1224 reads. Moreover, using the BLAST algorithm (http://blast.ncbi.nlm.nih.gov/BLAST) we were able to identify an expressed sequence tag (EST) supporting the retention of BCL2L12 intron 2. This EST clone (GenBank® ID: CN431026.1|) displayed high sequence similarity (>99%) with the BCL2L12 intron 2.

Intron 1 and intron 2 retention

264 265 266

3

Abbreviations: nt, nucleotide; Tm, melting temperature. a Primers with “/” in their name are specific for the splice junction between the two named exons, while “ext” denotes primers that are specific for the retained introns and the 3′-extension of exon 3. b T was calculated by the Primer-BLAST designing tool. m

Validation of NGS findings and identification of novel BCL2L12 splice variants Two PCR amplicons were created with the use of the primer pairs 1extF – 7altR and 1/2F – 7altR. The selection of these two sets of primers not only resulted in PCR amplicons that contained the full coding sequence of all novel BCL2L12 transcripts but also allowed the discrimination of BCL2L12 transcripts into those that contained the retained intron 1 from the ones with the canonical splice junction between exons 1 and 2. Both of these sets of amplicons were used as new templates for nested PCR. Thus, three nested PCR amplicons were created from each template with the use of the primer pairs 2extF – 7R, 2/3F – 7R, and 2/3alt – 7R. The set of primers 2extF – 7R led to the positive selection of BCL2L12 transcripts that included the retained intron 2, while the other two sets of primers (2/3F – 7R and 2/3alt – 7R) could discriminate BCL2L12 transcripts that contained the splice junction between exons 2 and 3 (2/3F – 7R) from the ones that contained the splice junction between exon 2 and the 5′-truncated exon 3 (2/3altF – 7R). In this way, six nested PCR amplicons were created in total, each one containing a unique combination of BCL2L12 exons up to exon 3. Moreover, using the 1extF – 7altR amplicon as template, another nested PCR reaction was performed with 2/4F and 2F as forward primers. In this way, novel transcripts of BCL2L12 lacking exon 3 were detected. In the next step of the experimental procedure, in order to investigate the rest of each transcript structure, each one of the six nested PCR amplicons was subjected to a third-round PCR (second nested PCR) with internal primer sets (Tables 2 and 3). The resulting PCR products were electrophoresed on agarose gels (Figs. 3 and 4), providing evidence for the existence of all novel alternative transcript variants that were discovered in this study.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355

ARTICLE IN PRESS 4

356 357 358

P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

Fig. 1. Schematic representation of all novel splicing events. Nucleotide regions with gray background represent the first three exons of the BCL2L12 gene. Regions inside the red line boxes represent the novel findings: retained intron 1, retained intron 2, and 3′-extension () of exon 3. The translation start codons (ATG) appear in bold. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

359

360 361 362

Fig. 2. Schematic demonstration of representative sequence reads for each novel splicing modification in the BCL2L12 gene. The upper panel shows two representative reads that support the existence of the retained intron 1; the middle panel displays one sequencing read that covers the entire retained intron 2; the bottom panel shows one sequencing read displaying 3′-extension of exon 3.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

363 364

5

Table 2 Demonstration of the PCR validation procedure with 1extF – 7altR as starting amplicons.

365 366

Primer pair for first nested PCR

Primer pair for second nested PCR

Expected PCR product lengtha

Variant No.b

Gelc

367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408

2extF – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v.14 v.15 v.16 v.17 – v.18 v.19 v.20 v.21 v.22 – v.23

A

2/3F – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v.24 – v.25 v.26 – v.27 v.28 v.29 v.30 v.31 – v.32

B

2/3altF – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v.33 – v.34 v.35 – – v.36 v.37 v.38 v.39 – –

C

2/4F – 4/7R 2/4F – 5/7R 2/4F – 5ext/7R 2/4F – 5/6R 2/4F – 5ext/6R 2F – 2/7R

– – – – – –

109 204 250 205 253 62

v.58 v.59 v.60 v.61 v.62 v.63

D

409 410 411 412

For each PCR reaction, the set of primers of every amplicon and the expected length(s) of the PCR product are shown. a Expected PCR product lengths that appeared on the agarose gels are marked in bold. b For PCR amplicons supporting the existence of a novel transcript variant, the number of the variant is shown. c Letters refer to agarose gels shown in Fig. 3.

413

414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431

Based on all PCR experiments that were carried out, 50 novel splice variants of the BCL2L12 gene (BCL2L12 v.14–v.63) were identified (Fig. 5), and their sequences were deposited in GenBank® (GenBank® ID: KR820244–KR820293, respectively). These newly discovered transcripts of BCL2L12 are 5′-partial, as their sequences start from the target region of the forward gene-specific primer that was used for the 3′-RACE PCR, and therefore their 5′-untranslated region (5′-UTR) remains unclear. Due to the fact that this particular region of the BCL2L12 gene overlaps with transcribed genomic region of IRF3, EST clones with no specific strand orientation cannot provide trustworthy evidence for the exact transcription start site of both genes (BCL2L12 and IRF3). Moreover, no typical gene promoter sequence could be identified using bioinformatics tools. Nevertheless, molecular cloning of the gene by members of our group in the past, including 5′-RACE PCR, did not reveal multiple transcription start sites. Thus, it can be assumed that these novel splice variants share the same 5′-UTR with the initially discovered BCL2L12 transcript (BCL2L12 v.1).

Novel predicted BCL2L12 protein isoform sequences and 3D structure models Open reading frame (ORF) was queried in each splice variant sequence. 11 out of the 50 novel transcripts of BCL2L12 are predicted to encode new protein isoforms, while the remaining 39 splice variants are NMD candidates and hence unlikely to encode protein isoforms. Fig. 6 illustrates the predicted three-dimensional (3D) structure models of all novel BCL2L12 protein isoforms, as obtained by the I-TASSER server, an online tool for 3D structure model construction [35,36]. Discussion Undoubtedly, the next decade holds great promise as NGS can dramatically accelerate genomic discoveries and help researchers to translate them into clinically significant information. NGS is expected to offer new insights into genomic research and to have a

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

6

450 451

Table 3 Demonstration of the PCR validation procedure with 1/2F – 7altR as starting amplicons.

452 453

Primer pair for first nested PCR

Primer pair for second nested PCR

Expected PCR product lengtha

Variant No.b

Gelc

454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489

2extF – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v.40 v.41 v.42 v.43 – – v.44 v.45 v.46 v.47 – –

E

2/3F – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v.10d v.1d v.4d v.8d – – v.48 v.49 v.50 v.51 – –

F

2/3altF – 7R

3F – 4/7R 3F – 5/6R 3F – 5/7R 3F – 5ext/7R 3F – 6/7R 3F – 5ext/6R 3extF – 4/7R 3extF – 5/6R 3extF – 5/7R 3extF – 5ext/7R 3extF – 6/7R 3extF – 5ext/6R

146 242, 155 241, 154 287, 200 563, 476, 422, 514 290, 203 152 248, 161 247, 160 293, 206 569, 482, 428, 520 296, 209

v v.3d v.52 v.53 – – v.54 v.55 v.56 v.57 – –

G

490 491 492 493 494

For each PCR reaction, the set of primers of every amplicon and the expected length(s) of the PCR product are shown. a Expected PCR product lengths that appeared on the agarose gels are marked in bold. b For PCR amplicons supporting the existence of a novel transcript variant, the number of the variant is shown. c Letters refer to agarose gels shown in Fig. 4. d Previously annotated transcripts (see also Supplementary Fig. S1).

495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518

high impact in the diagnosis and prognosis of many diseases, including cancer. As aforementioned, NGS can be used to deeply survey alternative splicing complexity in the human transcriptome and to discover novel transcripts resulting from alternative splicing, even those with very low expression [37]. Alternative splicing is a key process in carcinogenesis, as it produces splice isoforms that can enhance cell proliferation and migration, or render cancer cells resistant to apoptosis and anticancer agents. Patterns of alternative splicing present significant alterations in cancer cells [38]. Multiple paradigms of defective premRNA in myelodysplastic syndromes and cancer have been described so far. For instance, CD44 variant 6 (CD44v6) is a protein isoform of CD44 that is associated with severe tumor invasion and positive regional lymph nodes in laryngeal squamous cell carcinoma patients [39,40]. In breast cancer, overexpression of an alternatively spliced BRCA2 transcript (delta12-BRCA2) was associated with negative steroid receptor status, thus suggesting a prognostic role for this particular splice variant of the breast cancer susceptibility gene BRCA2 [41]. In addition, more than forty different splice variants of the MDM2 proto-oncogene have been identified both in malignant tumors and normal tissues; some of them have been linked to cancer progression and have significant prognostic value in specific human malignancies [42].

Among the proteins implicated, either directly or indirectly, in the apoptotic machinery, BCL2 family members seem to be the key players that determine cell fate [13]. In mammals, there are at least twenty core BCL2 family proteins, including BCL2 itself and proteins that have either three-dimensional (3D) structural similarity or a predicted secondary structure that is similar to BCL2 structure. These polypeptides display a range of activities, from inhibition to promotion of apoptosis [43]. Thus, from a mechanistic point of view, BCL2 family members are distinguished into antiapoptotic and proapoptotic proteins. With regard to their structure, most antiapoptotic members are BCL2-like as they contain all four BH domains (BH1, BH2, BH3, and BH4 domains), whereas proapoptotic members are either BAX-like (BH1, BH2, and BH3 domains) or BH3-only proteins. Furthermore, a small group of four “atypical” BCL2 family members containing only a BH2 and a BH3 domain has been described. Three of these four BCL2 family proteins, namely BCL2L13 (BCL-RAMBO), BCL2L14 (BCLG), and BCL2L15 (BFK), rather facilitate apoptosis [44–46], whereas the apoptotic role of BCL2L12 – the last member of this group – remains ambiguous [19,20]. Several studies have clearly demonstrated so far the antiapoptotic activity of the fulllength BCL2L12 protein isoform in human glioblastoma cells [21,24–26,28]. On the contrary, BCL2L12 displayed proapoptotic

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

542

7

Fig. 3. Electrophoresis results of all PCR products shown in Table 2. The primer pairs used for each reaction are shown at the top of each lane.

543

544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560

action in human breast cancer cells by sensitizing these cells to cisplatin [47]. Furthermore, in mouse embryonic fibroblasts Bcl2l12 displayed a proapoptotic function [48], and in Chinese hamster ovary cells, expression of the full-length BCL2L12 isoform and an alternative one resulting from alternative splicing, named BCL2L12A, was shown to have a negative effect on cell growth [49]. This discrepancy regarding the role of BCL2L12 in apoptosis has been suggested to be cell-dependent [48]. More importantly, some predicted BCL2L12 protein isoforms – BCL2L12 is.11, is.12, is.14, is.15, is.16, and is.17, as well as the previously discovered BCL2L12 is.4 and is.5 – are BH3-only and hence could act in a proapoptotic manner, in contrast to the full-length isoform, which is most likely to inhibit apoptosis, as aforementioned. The behavior of the BCL2L12 gene as a double-edged sword generating both antiapoptotic and proapoptotic isoforms is reminiscent of two other BCL2 family genes, MCL1 and BCLX. The full-length protein

product of the MCL1 gene, named MCL1L, is a typical antiapoptotic member of the BCL2 family [50]; nonetheless, the protein isoforms produced by two alternative splice variants of MCL1, namely MCL1S and MCL1ES, can induce mitochondrial cell death [51,52]. Similarly, transcription of the BCLX gene results in two alternatively spliced transcripts, BCLXL and BCLXS; the BCLXL protein is able to protect cells from a wide variety of apoptotic stimuli, while the BCLXS isoform can sensitize cells to apoptosis trigged by distinct apoptotic stimuli [53]. Interestingly, the novel BCL2L12 protein isoforms that are encoded by BCL2L12 v.24, v.25, v.26, v.58, v.59, and v.63 (BCL2L12 is.10, is.11, is.12, is.18, is.19, and is.20, respectively) have a truncated N-terminus compared to previously annotated BCL2L12 protein isoforms (BCL2L12 is.6, is.4, is.5, is.8, is.2, and is.9, respectively). In fact, these transcripts are most likely to use a second, in-frame translation start codon, in comparison with the already discovered BCL2L12 protein isoforms (Fig. 1). Moreover, in contrast to

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577

ARTICLE IN PRESS 8

578

P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

Fig. 4. Electrophoresis results of all PCR products shown in Table 3. The primer pairs used for each reaction are shown at the top of each lane.

579

580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606

the full-length BCL2L12 isoform (is.1), BCL2L12 is.11 does not contain any proline-rich region similar to those of TC21 and RRAS; Interestingly, BCL2L12 is.11 is a BH3-only protein, bearing also four consensus PXXP motifs and several putative phosphorylation sites, predicted using the NetPhos 2.0 Server [54]. Further investigation of the novel transcripts of BCL2L12 presented in this study is needed to shed light on the exact role of distinct BCL2L12 protein isoforms in apoptosis. The BCL2L12 gene, like most members of the BCL2 gene family, is highly implicated in various types of cancer and hematological malignancies. High BCL2L12 mRNA expression constitutes an unfavorable prognosticator in chronic lymphocytic leukemia [55,56], acute myelid leukemia [57], gastrointestinal cancer [58,59], and nasopharyngeal carcinoma [60]. On the other hand, BCL2L12 has been suggested as a potential molecular biomarker of favorable prognosis in breast cancer [61,62] as well as in head and neck squamous cell carcinoma [63]. Undoubtedly, research efforts investigating the diagnostic and/or prognostic utility of distinct BCL2L12 transcripts in human disease could become fruitful. Moreover, previous studies showed that full-length BCL2L12 is a promising therapeutic target in acute myeloid leukemia [64] and glioblastoma [65,66]. Thus, it would be interesting to study the potential of particular splice variants and/or protein isoforms of BCL2L12 as novel therapeutic targets in many other types of cancer, leukemia, and lymphoma. Although it is now possible to understand the diversity and the role of common splice variants among humans in a decent

level, it is yet unknown how they are involved in complex disease genetics. Thus, it can be easily assumed that less common or even rare variants can play a pivotal role in many human diseases. NGS technology not only renders the discovery of rare splicing events possible, but will also enable the detection of large and small insertions and deletions. However, the main modern challenge is the analysis and integration of these data. Therefore, there is an imperative need for further development of bioinformatics and innovative analysis tools that will analyze NGS output data faster and more efficiently, and provide high quality results. The full benefit of NGS will not be achieved until bioinformatics is able to maximally interpret and utilize these short-read sequences, providing better alignment and assembly, thus taking full advantage of this extremely powerful research tool, called NGS.

607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622

Conflict of interest

623 624 625

The authors declare no conflict of interest.

626 Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.canlet.2016.01.019.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

Q5

627 628 629 630

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

631 632 633 634

Q7

9

Fig. 5. Detailed sequence structure of all novel BCL2L12 transcript variants. Exons are depicted as boxes and introns as lines. Numbers inside boxes and above lines indicate the length of each exon or intron in nucleotides. For each transcript that was predicted to encode a protein isoform, the translation start and stop codons are also shown. Gray and white boxes represent coding and non-coding exons, respectively. For each transcript, the splice variant number, the GenBank® accession number (see also Supplemental data), and the protein isoform number (only for transcripts that are predicted to be coding) are presented at the right end of each transcript.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

10

635

Fig. 6. Predicted models of BCL2L12 isoforms using the I-TASSER server. For each protein, only the 3D structure with the highest confidence score is displayed.

636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682

References [1] R. Siegel, J. Ma, Z. Zou, A. Jemal, Cancer statistics, 2014, CA Cancer J. Clin. 64 (2014) 9–29. [2] J. Inns, V. James, Circulating microRNAs for the prediction of metastasis in breast cancer patients diagnosed with early stage disease, Breast (2015). doi:10.1016/ j.breast.2015.04.001. [3] B.L. Parsons, F. Meng, K-RAS mutation in the screening, prognosis and treatment of cancer, Biomark Med. 3 (2009) 757–769. [4] W.L. Santivasi, H. Wang, T. Wang, Q. Yang, X. Mo, E. Brogi, et al., Association between cytosolic expression of BRCA1 and metastatic risk in breast cancer, Br. J. Cancer (2015). doi:10.1038/bjc.2015.208. [5] M.J. Ahrens, P.A. Bertin, E.F. Vonesh, T.J. Meade, W.J. Catalona, D. Georganopoulou, PSA enzymatic activity: a new biomarker for assessing prostate cancer aggressiveness, Prostate 73 (2013) 1731–1737. [6] F. Linkov, Z. Yurkovetsky, A. Lokshin, Hormones as biomarkers: practical guide to utilizing luminex technologies for biomarker research, Methods Mol. Biol. 520 (2009) 129–141. [7] M. Frantzi, A. Latosinska, L. Fluhe, M.C. Hupe, E. Critselis, M.W. Kramer, et al., Developing proteomic biomarkers for bladder cancer: towards clinical application, Nat. Rev. Urol. (2015). doi:10.1038/nrurol.2015.100. [8] D.W. Bryant Jr., H.D. Priest, T.C. Mockler, Detection and quantification of alternative splicing variants using RNA-seq, Methods Mol. Biol. 883 (2012) 97–110. [9] J.W. Park, C. Tokheim, S. Shen, Y. Xing, Identifying differential alternative splicing events from RNA sequencing data using RNASeq-MATS, Methods Mol. Biol. 1038 (2013) 171–179. [10] T.A. Cooper, L. Wan, G. Dreyfuss, RNA and disease, Cell 136 (2009) 777–793. [11] N. Sasi, M. Hwang, J. Jaboin, I. Csiki, B. Lu, Regulated cell death pathways: new twists in modulation of BCL2 family function, Mol. Cancer Ther. 8 (2009) 1421–1429. [12] J.C. Reed, Dysregulation of apoptosis in cancer, J. Clin. Oncol. 17 (1999) 2941–2953. [13] J.C. Reed, Mechanisms of apoptosis, Am. J. Pathol. 157 (2000) 1415–1430. [14] A.M. Petros, E.T. Olejniczak, S.W. Fesik, Structural biology of the Bcl-2 family of proteins, Biochim. Biophys. Acta 1644 (2004) 83–94. [15] K.W. Yip, J.C. Reed, Bcl-2 family proteins and cancer, Oncogene 27 (2008) 6398–6406. [16] H. Thomadaki, A. Scorilas, BCL2 family of apoptosis-related genes: functions and clinical implications in cancer, Crit. Rev. Clin. Lab. Sci. 43 (2006) 1–67. [17] M.I. Christodoulou, C.K. Kontos, M. Halabalaki, A.L. Skaltsounis, A. Scorilas, Nature promises new anticancer agents: Interplay with the apoptosis-related BCL2 gene family, Anticancer Agents Med. Chem. 14 (2014) 375–399. [18] C.K. Kontos, M.I. Christodoulou, A. Scorilas, Apoptosis-related BCL2-family members: Key players in chemotherapy, Anticancer Agents Med. Chem. 14 (2014) 353–374.

[19] C.K. Kontos, A. Scorilas, Molecular cloning of novel alternatively spliced variants of BCL2L12, a new member of the BCL2 gene family, and their expression analysis in cancer cells, Gene 505 (2012) 153–166. [20] A. Scorilas, L. Kyriakopoulou, G.M. Yousef, L.K. Ashworth, A. Kwamie, E.P. Diamandis, Molecular cloning, physical mapping, and expression analysis of a novel gene, BCL2L12, encoding a proline-rich protein with a highly conserved BH2 domain of the Bcl-2 family, Genomics 72 (2001) 217–221. [21] A.H. Stegh, S. Kesari, J.E. Mahoney, H.T. Jenq, K.L. Forloney, A. Protopopov, et al., Bcl2L12-mediated inhibition of effector caspase-3 and caspase-7 via distinct mechanisms in glioblastoma, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 10703– 10708. [22] A.H. Stegh, L. Chin, D.N. Louis, R.A. DePinho, What drives intense apoptosis resistance and propensity for necrosis in glioblastoma? A role for Bcl2L12 as a multifunctional cell death regulator, Cell Cycle 7 (2008) 2833– 2839. [23] A.H. Stegh, R.A. Depinho, Beyond effector caspase inhibition: Bcl2L12 neutralizes p53 signaling in glioblastoma, Cell Cycle 10 (2011) 33–38. [24] A.H. Stegh, H. Kim, R.M. Bachoo, K.L. Forloney, J. Zhang, H. Schulze, et al., Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma, Genes Dev. 21 (2007) 98–111. [25] A.H. Stegh, C. Brennan, J.A. Mahoney, K.L. Forloney, H.T. Jenq, J.P. Luciano, et al., Glioma oncoprotein Bcl2L12 inhibits the p53 tumor suppressor, Genes Dev. 24 (2010) 2194–2204. [26] M.C. Yang, J.K. Loh, Y.Y. Li, W.S. Huang, C.H. Chou, J.T. Cheng, et al., Bcl2L12 with a BH3-like domain in regulating apoptosis and TMZ-induced autophagy: a prospective combination of ABT-737 and TMZ for treating glioma, Int. J. Oncol. 46 (2015) 1304–1316. [27] P.W. Hammond, J. Alpin, C.E. Rise, M. Wright, B.L. Kreider, In vitro selection and characterization of Bcl-X(L)-binding proteins from a mix of tissue-specific mRNA display libraries, J. Biol. Chem. 276 (2001) 20898–20906. [28] C.H. Chou, A.K. Chou, C.C. Lin, W.J. Chen, C.C. Wei, M.C. Yang, et al., GSK3beta regulates Bcl2L12 and Bcl2L12A anti-apoptosis signaling in glioblastoma and is inhibited by LiCl, Cell Cycle 11 (2012) 532–542. [29] G.L. Toumelin, A. Mazars, A. Licznar, G. Guasconi, J.-C. Rain, N. Cauquil, et al., Bcl2L12, a new BH2 BH3 containing protein, substrate for GSK3beta, mediates UV induced apoptosis, in: Proceedings of the 97th AACR Annual Meeting, American Association for Cancer Research, Washington, DC, 2006, p. 959-b-. [30] M.T. Lee, S.M. Ho, P. Tarapore, I. Chung, Y.K. Leung, Estrogen receptor beta isoform 5 confers sensitivity of breast cancer cell lines to chemotherapeutic agentinduced apoptosis through interaction with Bcl2L12, Neoplasia 15 (2013) 1262–1271. [31] M.A. Frohman, M.K. Dush, G.R. Martin, Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer, Proc. Natl. Acad. Sci. U.S.A. 85 (1988) 8998–9002. [32] D.J. Korbie, J.S. Mattick, Touchdown PCR for increased specificity and sensitivity in PCR amplification, Nat. Protoc. 3 (2008) 1452–1456.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

Q6

683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729

ARTICLE IN PRESS P.G. Adamopoulos et al./Cancer Letters ■■ (2016) ■■–■■

730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779

[33] H. Thorvaldsdottir, J.T. Robinson, J.P. Mesirov, Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration, Brief. Bioinform. 14 (2013) 178–192. [34] J. Ye, G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen, T.L. Madden, PrimerBLAST: a tool to design target-specific primers for polymerase chain reaction, BMC Bioinform. 13 (2012) 134. [35] Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinform. 9 (2008) 40. [36] A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (2010) 725–738. [37] Q. Pan, O. Shai, L.J. Lee, B.J. Frey, B.J. Blencowe, Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing, Nat. Genet. 40 (2008) 1413–1415. [38] L. Shkreta, B. Bell, T. Revil, J.P. Venables, P. Prinos, S.A. Elela, et al., Cancerassociated perturbations in alternative pre-messenger RNA splicing, Cancer Treat. Res. 158 (2013) 41–94. [39] H. Zhao, J. Ren, X. Zhuo, H. Ye, J. Zou, S. Liu, Prognostic significance of Survivin and CD44v6 in laryngeal cancer surgical margins, J. Cancer Res. Clin. Oncol. 134 (2008) 1051–1058. [40] S. Staibano, F. Merolla, D. Testa, R. Iovine, M. Mascolo, V. Guarino, et al., OPN/CD44v6 overexpression in laryngeal dysplasia and correlation with clinical outcome, Br. J. Cancer 97 (2007) 1545–1551. [41] I. Bieche, R. Lidereau, Increased level of exon 12 alternatively spliced BRCA2 transcripts in tumor breast tissue compared with normal tissue, Cancer Res. 59 (1999) 2546–2550. [42] F. Bartel, H. Taubert, L.C. Harris, Alternative and aberrant splicing of MDM2 mRNA in human cancer, Cancer Cell 2 (2002) 9–15. [43] R.J. Youle, A. Strasser, The BCL-2 protein family: opposing activities that mediate cell death, Nat. Rev. Mol. Cell Biol. 9 (2008) 47–59. [44] L. Coultas, M. Pellegrini, J.E. Visvader, G.J. Lindeman, L. Chen, J.M. Adams, et al., Bfk: a novel weakly proapoptotic member of the Bcl-2 protein family with a BH3 and a BH2 region, Cell Death Differ. 10 (2003) 185–192. [45] B. Guo, A. Godzik, J.C. Reed, Bcl-G, a novel pro-apoptotic member of the Bcl-2 family, J. Biol. Chem. 276 (2001) 2780–2785. [46] T. Kataoka, N. Holler, O. Micheau, F. Martinon, A. Tinel, K. Hofmann, et al., Bcl-rambo, a novel Bcl-2 homologue that induces apoptosis via its unique C-terminal extension, J. Biol. Chem. 276 (2001) 19548–19554. [47] Y. Hong, J. Yang, W. Wu, W. Wang, X. Kong, Y. Wang, et al., Knockdown of BCL2L12 leads to cisplatin resistance in MDA-MB-231 breast cancer cells, Biochim. Biophys. Acta 1782 (2008) 649–657. [48] A. Nakajima, K. Nishimura, Y. Nakaima, T. Oh, S. Noguchi, T. Taniguchi, et al., Cell type-dependent proapoptotic role of Bcl2L12 revealed by a mutation concomitant with the disruption of the juxtaposed Irf3 gene, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 12448–12452. [49] Y. Hong, J. Yang, Y. Chi, W. Wang, W. Wu, X. Yun, et al., BCL2L12A localizes to the cell nucleus and induces growth inhibition through G2/M arrest in CHO cells, Mol. Cell. Biochem. 333 (2010) 323–330. [50] K.M. Kozopas, T. Yang, H.L. Buchan, P. Zhou, R.W. Craig, MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 3516–3520.

11

[51] J.H. Kim, S.H. Sim, H.J. Ha, J.J. Ko, K. Lee, J. Bae, MCL-1ES, a novel variant of MCL-1, associates with MCL-1L and induces mitochondrial cell death, FEBS Lett. 583 (2009) 2758–2764. [52] J. Bae, C.P. Leo, S.Y. Hsu, A.J. Hsueh, MCL-1S, a splicing variant of the antiapoptotic BCL-2 family member MCL-1, encodes a proapoptotic protein possessing only the BH3 domain, J. Biol. Chem. 275 (2000) 25255–25261. [53] A.J. Minn, L.H. Boise, C.B. Thompson, Bcl-x(S) anatagonizes the protective effects of Bcl-x(L), J. Biol. Chem. 271 (1996) 6306–6312. [54] N. Blom, S. Gammeltoft, S. Brunak, Sequence and structure-based prediction of eukaryotic protein phosphorylation sites, J. Mol. Biol. 294 (1999) 1351– 1362. [55] S.G. Papageorgiou, C.K. Kontos, V. Pappa, H. Thomadaki, F. Kontsioti, J. Dervenoulas, et al., The novel member of the BCL2 gene family, BCL2L12, is substantially elevated in chronic lymphocytic leukemia patients, supporting its value as a significant biomarker, Oncologist 16 (2011) 1280–1291. [56] T. Karan-Djurasevic, V. Palibrk, B. Zukic, V. Spasovski, I. Glumac, M. Colovic, et al., Expression of Bcl2L12 in chronic lymphocytic leukemia patients: association with clinical and molecular prognostic markers, Med. Oncol. 30 (2013) 405. [57] H. Thomadaki, K.V. Floros, S. Pavlovic, N. Tosic, D. Gourgiotis, M. Colovic, et al., Overexpression of the novel member of the BCL2 gene family, BCL2L12, is associated with the disease outcome in patients with acute myeloid leukemia, Clin. Biochem. 45 (2012) 1362–1367. [58] D. Florou, I.N. Papadopoulos, A. Scorilas, Molecular analysis and prognostic impact of the novel apoptotic gene BCL2L12 in gastric cancer, Biochem. Biophys. Res. Commun. 391 (2010) 214–218. [59] C.K. Kontos, I.N. Papadopoulos, A. Scorilas, Quantitative expression analysis and prognostic significance of the novel apoptosis-related gene BCL2L12 in colon cancer, Biol. Chem. 389 (2008) 1467–1475. [60] A. Fendri, C.K. Kontos, A. Khabir, R. Mokdad-Gargouri, A. Scorilas, BCL2L12 is a novel biomarker for the prediction of short-term relapse in nasopharyngeal carcinoma, Mol. Med. 17 (2011) 163–171. [61] A. Tzovaras, A. Kladi-Skandali, K. Michaelidou, G.C. Zografos, I. Missitzis, A. Ardavanis, et al., BCL2L12: a promising molecular prognostic biomarker in breast cancer, Clin. Biochem. 47 (2014) 257–262. [62] M. Talieri, E.P. Diamandis, N. Katsaros, D. Gourgiotis, A. Scorilas, Expression of BCL2L12, a new member of apoptosis-related genes, in breast tumors, Thromb. Haemost. 89 (2003) 1081–1088. [63] P.A. Geomela, C.K. Kontos, I. Yiotakis, A. Scorilas, Quantitative expression analysis of the apoptosis-related gene, BCL2L12, in head and neck squamous cell carcinoma, J. Oral Pathol. Med. 42 (2013) 154–161. [64] C. Nishioka, T. Ikezoe, A. Takeuchi, A. Nobumoto, M. Tsuda, A. Yokoyama, The novel function of CD82 and its impact on BCL2L12 via AKT/STAT5 signal pathway in acute myelogenous leukemia cells, Leukemia 29 (2015) 2296–2306. [65] F.M. Kouri, C. Ritner, A.H. Stegh, miRNA-182 and the regulation of the glioblastoma phenotype – toward miRNA-based precision therapeutics, Cell Cycle 14 (2015) 3794–3800. [66] F.M. Kouri, S.A. Jensen, A.H. Stegh, The role of Bcl-2 family proteins in therapy responses of malignant astrocytic gliomas: Bcl2L12 and beyond, Sci. World J. 2012 (2012) 838916.

Please cite this article in press as: Panagiotis G. Adamopoulos, Christos K. Kontos, Panagiotis Tsiakanikas, Andreas Scorilas, Identification of novel alternative splice variants of the BCL2L12 gene in human cancer cells using next-generation sequencing methodology, Cancer Letters (2016), doi: 10.1016/j.canlet.2016.01.019

780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829