- Email: [email protected]
Identification of novel drought-related mRNAs in common bean roots by differential display RT-PCR
Plant Science 171 (2006) 300–307 www.elsevier.com/locate/plantsci
Identification of novel drought-related mRNAs in common bean roots by differential display RT-PCR Gisele A.M. Torres a, Stephanie Pflieger b, Fabienne Corre-Menguy c, Christelle Mazubert c, Caroline Hartmann c, Christine Lelandais-Brie`re c,* a
Instituto Agronoˆmico de Campinas, Centro de Pesquisa e Desenvolvimento de Recursos Gene´ticos Vegetais, Caixa Postal 28, 13001-970 Campinas, SP, Brazil b Virologie Moleculaire, Institut Jacques Monod, CNRS, Universite´s Paris 6-7, 2 Place Jussieu, 75251 Paris Cedex 05, France c Institut des Sciences du Ve´ge´tal, CNRS, bat 23, Avenue de la terrasse, 91198 Gif/Yvette, France Received 11 October 2005; received in revised form 17 March 2006; accepted 22 March 2006 Available online 18 April 2006
Abstract Drought is a major constraint for the production of common bean (Phaseolus vulgaris L.). To identify molecular responses to water deficit, we performed a differential display RT-PCR (DDRT) analysis using roots of bean plants grown aeroponically and submitted to dehydration. This allowed us to visualise 1200 DDRT bands, 8.7% of which showed a clear regulation by dehydration, and to clone 42 cDNAs, called PvD1 to PvD42. Among them, 20 early-dehydration-responsive cDNAs were selected by reverse northern that were induced or repressed before detectable water status changes and induction of ABA-regulated genes. Northern analysis for 16 PvD clones confirmed these early regulations and allowed us to identify four late dehydration-responsive genes. Their putative involvement in signalling, protein turn-over and translocation, chaperones as well as root growth modulations in response to water stress is discussed. # 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Dehydration; DDRT; Gene regulation; Legumes; Water deficit
1. Introduction Environmental stresses such as drought, salinity and temperature extremes limit crop productivity. To cope with these constraints, plants induce complex modifications of both their physiological state and metabolic pathways, which are not still clarified. However, some ubiquitous physiological responses have been reported, such as stomatal closure, osmotic adjustment and increase in abscisic acid (ABA) content [1]. At molecular level, many groups of proteins play important roles in these responses, like proteins involved in signal transduction and regulation of gene expression and proteins that participate in adaptation to stress such as heat shock proteins (HSP) and late embryogenesis abundant (LEA) proteins [2]. As all the modifications associated with stress responses generally affect plant growth and yield [3,4], more drought-tolerant varieties must be developed. However, both
* Corresponding author. Tel.: +33 1 69 82 35 93. E-mail address: [email protected] (C. Lelandais-Brie`re). 0168-9452/$ – see front matter # 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2006.03.008
classic breeding and engineering strategies, relying on the transfer of one or several genes, are limited by the genetic complexity and multigenic trait of water stress tolerance [5]. Thus, it appears that an important step will be the discovery of new genes, involved in water stress response and/or tolerance. For model plants, analyses using full genome microarrays allow to reveal genes whose expression is modulated during application of different types of stresses. However, a comparative analysis of published microarray data from about 7000 to 8000 genes of Arabidopsis ecotype Columbia [6–8] showed that methods of water deficit imposition have a strong impact on the results [9]. Indeed, among the 1919 genes present on the three sets of microarrays, only 27 were induced and three were repressed under the three hyperosmotic stress conditions tested: desiccation, mannitol treatment and progressive soil–water deficit. Moreover, the great variety of inducible or repressible genes in each experiment (around 10% of the genes) confirms the complexity of water stress responses and the difficulty to transfer data from model plants to crops. Therefore, one challenge remains to identify the maximum of molecular elements involved in drought responses for each cultivated species.
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
Drought is one of the major constraints for the productivity of common bean (Phaseolus vulgaris L.), an important crop legume for human consumption [10]. Unfortunately, among legumes, common bean genomics was not a priority and the first large expressed sequence tag (ESTs) data have only been published this year [11]. These data correspond to five libraries derived from different organs and treatments, like phosphorus starvation, but do not include osmotic treatments. To date, only a dozen of genes have been reported as drought-related in bean. Some are involved in protection or repair of cell components under stress conditions, such as Pvlea18 or Pvlea4-25, two late embryogenesis abundant proteins and Pvhsp17-19, a lowmolecular-weight heat shock protein [12]. Others, like prolinerich proteins or a lipid-transfer protein, could participate in modifications of cell wall composition and thus certainly in growth adaptation in response to drought [12]. Finally, like in other plant species, the activation of Pvnced1 expression was tightly correlated with the rapid accumulation of ABA in dehydrated leaves and roots. Indeed, this gene encodes the ninecis-epoxycarotenoid dioxygenase, an enzyme which catalyses a key limiting step in ABA biosynthesis [13]. Identification of new bean drought-responsive genes is essential to dissect molecular regulation in response to water deficit. A dehydration system was thus developed and differential display RT-PCR (DDRT) allowed to identify 24 genes putatively linked to drought responses in common bean roots.
301
root water status, water potentials (Cw) were measured for five dehydrated and five control plants at each period with a portable pressure chamber (PMS Intrument, Corvallis, OR). The Cw data are reported as the mean value of the five samples S.E. in three replicates. 2.3. RNA extraction and differential display RT-PCR
2. Materials and methods
Total RNA was extracted using the cesium chloride cushion method [14]. RNA (20 mg) was treated with 10 U of RNase-free DNAse I (Amersham Biosciences) for 15 min at 37 8C. Differential display RT-PCR (DDRT) was then performed as described in [15]. Briefly, 0.2 mg of RNAwas reverse-transcribed with 40 U of Superscript II reverse transcriptase (Invitrogen) and 50 mM of anchor primer (T12CA or T12GC) for 1 h at 42 8C. PCR was performed using 1/8 v of cDNA, 2 mL of [a-33P]-dATP (Amersham Biosciences), 1 U of Taq DNA Polymerase (Perkin Elmer Applied Biosystems), 2.5 mM of anchor primer and 0.5 mM of an arbitrary upstream primer (30 s at 94 8C, 2 min at 40 8C and 45 s at 72 8C for 40 cycles). Upstream primers were U5: 50 GGAACCAATC30 , U6: 50 AAACTCCGTC30 , U13: 50 GTTTTCGCAG30 , U17: 50 GATCTGACAC30 , U19: 50 GATCATAGCC30 and U25: 50 TGGATTGGTC30 . DDRT products were separated on 6% sequencing denaturing gels and visualised by autoradiography. After excision from the gel, partial cDNAs were amplified by PCR in similar conditions and cloned using the Topo TA Cloning Kit (Invitrogen). For each DDRT band, 12 clones were analysed and the different cDNA families were selected according their AluI and HaeIII restriction pattern.
2.1. Plant material and aeroponic growth conditions
2.4. Reverse northern analysis
P. vulgaris L. cv La Victoire is a french bean cultivar of andean origin (according phaseolin markers analysis), whose field qualities (productivity, precocity) are counterbalanced by a high sensitivity to pathogens (V. Geffroy, personal communication). Seeds were grown on perlite in a growth chamber with 16 h of light at 26 8C (OSRAM TLD 83 lamps, MGIE, France, 300 mmol m2 s1) and 8 h of dark at 17 8C in a relative humidity of 70%. Plants were watered daily with a nutrient solution (Hydrokani C2 – Hydro Agri Spe´cialite´s, France) 5% (w/v), chelate iron (0.144 g/L) buffered to pH 5.8 with 0.4 N nitric acid. After 1 week, seedlings were transferred to an aeroponic ‘‘Rainforest-72 sites’’ system, manufactured by General Hydroponics Europe. In these conditions, roots grew during 2 weeks in a black plastic box with a constantly spraying of the nutrient solution, whereas stems were kept in the controlled conditions described above.
The 42 cDNAs obtained by DDRT were amplified by PCR in standard conditions using 10 ng of plasmid and the universal direct and reverse primers. After a short migration on 1.2% agarose gels, 200 ng of each cDNA were transferred onto nylon positive membranes (Qbiogen). Bean genomic DNA (200 ng) was also blotted to test the quality of the transfer and control the counting of the probes. The complex cDNA probes were synthesised from 5 mg of DNAse-treated RNA during 30 min at 42 8C in the presence of 5 mL of [a-32P]-dCTP, 200 U of Superscript II reverse transcriptase, 30 U of RNaseout (Invitrogen), 1.8 mM pdN6 (Invitrogen), 1 mM dNTP without dCTP (Amersham Biosciences) and 0.01 M DTT. An incubation at 42 8C for 30 min with non-radioactive dCTP (2.5 mM) was then performed. The probes were purified onto Nick columns (Amersham Biosciences) and the level of incorporated radioactivity was counted with a Beckman LS6000IC Liquid Scintillation system. After prehybridisation for 2 h at 42 8C in 5 SSC, 50% (v/v) formamide, 0.5% (w/v) SDS, 5 Denhardt’s and 100 mg/mL salmon sperm DNA, the blot were hybridised with 30 106 cpm of complex cDNA probe during 16 h at 42 8C. The membranes were washed twice for 20 min at 42 8C in 2 SSC/0.5% SDS, twice at 42 8C in 0.1 SSC/0.1% SDS and once at 65 8C in 0.1 SSC/0.1% SDS. The hybridisation signals were quantified using a Storm 860 and the ImageQuant 5.0 software (Molecular Dynamics). All values
2.2. Dehydration treatments and water potential measurements A 3-week-old plants, with three trifoliate leaves, were submitted to dehydration by arrest of the spraying, 1 h after the beginning of the light. Roots of five dehydrated and five control well-watered plants were collected after 1, 2, 5, and 8 h of treatment in four independent experiments. To determine the
302
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
were normalised to the hybridisation signals obtained with the constitutive 18S rDNA gene (50 ng). Finally, the mean ratio of transcript accumulation between the dehydrated and the corresponding control samples (d/c ratio) in two independent experiments was calculated for each cDNA. 2.5. Northern blot analysis Total RNA (12 mg) was fractionated on formaldehyde denaturing agarose gels and transferred onto nylon positive membranes according to [16]. The pre-hybridisation and hybridisation steps were performed as described above. The probes were labelled with [a-32P]-dCTP using the Ready To Go Labelling kit (Amersham Biosciences). The PvD probes were obtained by PCR amplification with universal primers on the corresponding clone. The Pvnced1, Pvlea18, Pvlox2 probes were generated by RT-PCR using specific primers designed on published bean sequences (AF190462: 50 CCCGAAACTCGACCCCGTCAAC30 , 50 CCTCCCACGCGTTCCAGAGATG30 ; U72764: 50 CAACAGAGGACAGTCCCTATG30 , 50 CCAACATGTCATGATCGAAAAG30 ; U76687: 50 TGAAT0 ATCAATGGACTTGCACG3 , 50 AGCTTCCTTCCACCAAGTTTG30 ). As a loading control, the membranes were subsequently hybridised with a 18S rDNA constitutive probe. 2.6. Sequence analyses The 42 PvD cDNAs were sequenced using the ABIPRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems). Accession numbers of the PvD cDNAs are from AF527434 to AF527453 for PvD1 to PvD20 and DQ117555 to DQ117576 for PvD21 to PvD42. The nucleotide and predicted amino acid sequences homologies were searched in databases using the blastn and blastx programs [17]. Sequence alignments were performed with CLUSTAL_X.
Table 1 Effect of dehydration on root water potential Time (h)
0 1 2 5 8
Root water potential (MPa) Control
Dehydration
0.3 0.2 0.4 0.4 0.4 0.1 0.2 0.2 0.2 0.2
– 0.5 0.1 1.3 0.4 1.9 1.1 2.4 0.7
For each condition, root water potential (in MPa) was measured for five plants in three independent experiments.
The Pvnced1, Pvlea18 and Pvlox2 genes, whose transcription was previously known to be activated during water deficit in bean, were used as molecular controls to validate the appropriateness of this experimental system (Fig. 1). Indeed, Qin and Zeevaart [13] showed that the accumulation of ABA in bean was strictly correlated with the activation of the Pvnced1 gene, coding for the 9-cis-epoxycarotenoid dioxygenase, a key enzyme in ABA biosynthesis [19]. In our conditions, the 2.4 kb Pvnced1 transcripts, undetectable in well-watered roots (c1–c8) could be observed as a very faint signal within 1 h after the onset of dehydration (d1) and gradually increased up to 8 h of treatment (d2–d8). Moreover, Moreno-Fonseca and Covarrubias [20] reported that the expression of the LEA-encoding gene Pvlea18 was activated by drought via ABA-dependent signalling. As expected, Pvlea18 mRNA accumulation increased after 2 h of treatment, concomitantly with Pvnced1. Finally, the lipoxygenase-encoding Pvlox genes, whose expression was activated by desiccation in bean [21], showed a progressive induction throughout the dehydration treatment. Taken together, these data demonstrated the suitability of our experimental system for the identification of genes involved in water stress responses in bean roots. 3.2. Isolation of the bean PvD cDNAs by differential display
3. Results and discussion 3.1. Characterization of the ‘‘aeroponic/dehydration’’ system To analyse drought responses in bean roots, an experimental system using ‘‘aeroponic/dehydration’’ was developed. Aeroponic process was preferred to soil culture because it allows both a better reproducibility of plant growth and stress application and the rapid collection of large amounts of roots with undetectable contamination. A 3-week-old plants were subjected to dehydration treatments by vaporisation stop for 1, 2, 5 or 8 h (d1–d8 samples). Simultaneously, untreated root samples were collected (c1–c8 samples). Measurements of water potentials in control roots showed that the water status did not change significantly during the 8 h period (Table 1). By contrast, in water-stressed samples, water potential began to decrease after 2 h of dehydration and dropped very rapidly to 2.4 MPa after 8 h (Table 1). This latest value was similar to those reported for bean after 1 week of progressive drought [18].
To identify dehydration-responsive genes, differential display RT-PCR (DDRT) analyses were conducted using RNAs
Fig. 1. Transcript accumulation profiles of three drought-regulated genes in bean dehydrated roots. Total RNA was isolated from dehydrated (d1, d2, d5, and d8) and well-watered (c1–c8) roots collected 1, 2, 5 and 8 h after the beginning of the treatment. After electrophoresis and transfer, 12 mg of RNA were hybridised with Pvnced1, Pvlea18 and Pvlox probes. As a loading control, the same blot was hybridised with a ribosomal DNA probe (18S rDNA).
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
303
Table 2 Selection of 20 early dehydration-responsive PvD cDNAs by reverse northern
A A A A A A A A A B
Clone
d1/c1
d2/c2
PvD1 PvD2 PvD3 PvD4 PvD5 PvD6 PvD7 PvD8 PvD9 PvD10 Genomic DNA
6.9 0.9 3.5 0.4 2.5 0.2 2.2 0.2 3.6 0.8 2.9 0.4 2.5 0.1 2.9 0.4 1.9 0.5 0.1 0.1 1.1 0.5
3.2 0.7 1.1 0.2 0.3 0.2 1 0.1 1.8 0.2 0.8 0.1 2.3 0.2 2.2 0.2 2.1 0.1 0.4 0.2 0.9 0.1
B A B A A A A A A A
Clone
d1/c1
d2/c2
PvD11 PvD12 PvD13 PvD14 PvD15 PvD16 PvD17 PvD18 PvD19 PvD20 18S rDNA
0.4 0.1 2 0.2 0.4 0.1 2 0.2 4 0.8 3.6 0.4 5.8 0.9 2.7 0.4 2.4 0.2 3.2 0.3 1 0.1
0.6 0.1 1.7 0.3 0.6 0.2 0.3 0.1 0.5 0.1 0.5 0.2 0.4 0.2 2.5 0.2 0.9 0.1 0.4 0.2 1 0.1
After electrophoresis, PCR-amplified DNA from all PvD clones were transferred and hybridised with 32P-labeled complex cDNA probes corresponding to roots dehydrated for 1 and 2 h (d1 and d2) or to well-watered roots (c1 and c2). The mean ratio of transcript accumulation in stressed samples compared to controls (d1/c1 and d2/c2) have been calculated for two independent experiments. Ratio values higher than 2 (A) or lower than 0.5 (B) are in bold. Genomic DNA and the 18S rDNA gene represent internal and constitutive controls, respectively.
extracted from roots, that were either dehydrated or wellwatered for 1, 2, 5 or 8 h. Twelve combinations of primers were tested, allowing the detection of approximately 1200 DDRT bands ranging from 50 to 700 bp. Among them, 8.7% displayed differential accumulation between dehydrated and control roots. This level of drought-responsive genes was similar to those obtained using microarrays in Arabidopsis subjected to different kinds of osmotic stresses [9]. Thirty-two differential bands were selected, according to four main criteria: highly reproducible profiles in the four independent dehydration treatments, early regulation (after 1 and/or 2 h of treatment), sizes ranging from 200 to 700 bp and no or few diurnal regulation in controls. After cloning, restriction analyses and sequencing, 42 different cDNAs between 189 and 665 bp were identified and named PvD1 to PvD42 for P. vulgaris cDNAs identified in Dehydrated roots. 3.3. Selection and expression analysis of the dehydrationresponsive PvD genes The early dehydration-responsive PvD cDNAs were selected by reverse northern experiments (Table 2). We focused our analysis on gene regulation in roots occurring prior to activation of known ABA-responsive genes (Pvnced1 and Pvlea18). For that purpose, complex cDNA probes corresponding to RNAs of c1, d1, c2 and d2 roots were hybridised onto membranes that contained 200 ng of each PvD cDNA. The constitutive 18S rDNA gene and genomic DNA were used as internal controls. Hybridisation signals were quantified in two independent experiments and the mean ratio of transcript accumulation between dehydrated and control samples (d1/c1 and d2/c2 ratio) were calculated. Twenty PvD clones, called PvD1 to PvD20, showed a d1/c1 and/or a d2/c2 ratio higher than two (class A: induced by stress) or lower than 0.5 (class B: repressed) and were thus considered as early dehydrationresponsive. The other 20 cDNAs (PvD21 to PvD42: class C) encompasses genes for which transcript levels were either undetectable or similar in control and stressed samples after 1 and 2 h of treatment (not shown). According to reverse northern
hybridised with leaf RNA (not shown), mRNAs for 8 PvD genes were detectable in unstressed leaves and five presented an over-accumulation after 2 h dehydration (PvD4, 9, 12, 17 and 18). To confirm these expression profiles during dehydration treatment, Northern blot analyses were performed using representative cDNAs of each class (Fig. 2). The results were globally consistent with reverse northern; indeed, all class A and B cDNAs tested presented an early induction or decrease. Only PvD29, first classified in class C, displayed in fact a weak induction after 1 h of stress in comparison to the control. For most class A genes, the early induction was followed by a dramatic decline of transcript levels. Indeed, at 8 h, mRNA levels were either similar (PvD4, PvD5) or lower (PvD1, PvD2, PvD3, PvD6, PvD7, PvD8 and 9) than the controls. Only PvD18 was progressively induced during all the treatment. The two class B cDNAs tested in northern (PvD10 and PvD11) presented a progressive decrease of mRNA levels throughout the treatment. In class C, PvD25 was a false-positive (constitutively expressed) whereas PvD29, induced in untreated roots during the light period, was slowly induced after 1 and 2 h and subsequently down-regulated at 5 and 8 h of dehydration. By contrast, PvD21, PvD22 and PvD28 transcripts clearly accumulated at the later stages of dehydration, allowing us to consider these genes as late dehydration-responsive. 3.4. Sequence analysis of the PvD cDNAs and putative involvement in drought responses Results of sequence and expression analysis of the 42 PvD clones are summarized in Table 3. Blastn search was firstly used to compare the PvD sequences to bean databases. Only PvD2 and PvD8 were identical to bean accessions, coding for an ATP synthase protein 6 (ATP6) homolog (U28921) and ubiquitin (U77939), respectively. For PvD2, we assume that the previous annotation was incorrect. Since, it displayed strong homology to a common ice plant EST, which codes for a salinity-induced phosphoglycerate mutase. No significant homology was found in the 8000 non-redundant ESTs from the bean Mesoamerican
304
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
Fig. 2. Time-course of mRNA accumulation of selected PvD genes in bean roots throughout the dehydration kinetics. Total RNA (12 mg), extracted from roots either dehydrated for 1, 2, 5, and 8 h (d1–d8) or untreated (c1–c8), was fractionated by electrophoresis on a denaturing agarose gel. Identical northern blots were probed with 32P-labeled PvD cDNAs representative from each expression profile (class A: early-induced; class B: early repressed; class C: not modulated after 1 and 2 h dehydration). As a loading control, the same blot was probed with the constitutive 18S rDNA. A representative gel is shown. Time of exposure was not identical for all probes.
genotype Negro Jamapa 81 derived from five libraries, one of which corresponded to roots [11]. By contrast, 17 PvD cDNAs were homologous to leaf cDNAs present in the sole EST library from an Andean cultivar G19833. These results reinforced the
fact that La Victoire is an Andean genotype as shown by phaseolin markers analysis (V. Geffroy, personal communication). Secondly, for 29 PvD clones, blastx analysis using the PvD sequence and/or the corresponding EST provided significant similarity with plant proteins (Table 3). Finally, no significant similarity was found in databases for 13 PvD clones (30%) although all but one present 40–120 amino acids ORFs. Thus, our approach revealed novel genes linked to water stress. Based on their sequence and expression pattern, putative functions could be attributed to several dehydration-related PvD genes. We have recently characterised PvD3, which exhibited strong similarity with animal organic cation transporters, as a new phloem transporter in plants [22]. At least two PvD clones (PvD5 and PvD19) could be elements of drought-associated transduction pathways. PvD5, whose expression was transitorily induced at d1 and broken down since d2 (Fig. 2), encoded a putative lipase/acylhydrolase. In Arabidopsis and in the legume Vigna unguiculata, droughtinduced lipid acylhydrolases [23] and phospholipases [24,25] participate, at least in leaves, to specific lipid signalling pathways in response to water stress. The absence of PvD5 mRNA in leaves (not shown) and its early and transient activation argued in the favour of a root-specific lipid signalling. Interestingly, the EST corresponding to the earlyinduced PvD19 encoded a protein similar to an Arabidopsis putative auxin-induced cytosolic kinase. The involvement of auxin-dependent pathways in osmotic stress responses has been few documented; nevertheless, in Arabidopsis, auxins, together with endogenous ABA and gibberellins, play a promotive role in drought-induced rhizogenesis during progressive drought [26,27]. Moreover, Sadiqov et al. [28] reported that auxins participate in signalling mechanisms of drought-induced accumulation of proline, a major plant osmolyte. Numerous drought-responsive PvD genes encoded proteins are involved in the turn-over (PvD6, 8, 9), folding (PvD7, 28 and 29) and translocation (PvD12 and 17) of cellular proteins, mechanisms which are ubiquitous in water stress tolerance [1] and seem to be fundamental in bean roots. The regulation of protein turn-over in response to abiotic stress, especially the specific translation of proteins involved in tolerance and the proteolysis of damaged or unfolded proteins, has been intensively studied in seedling of several species [7,29] but never in roots. More striking was the early induction of PvD6 that encoded a translation initiation factor eIF4A. Indeed, although other translation initiation factors were reported as drought-responsive [7], eif4A genes have long been considered as constitutive genes in plant expression studies [30]. PvD7, PvD28 and PvD29 encoded proteins functioning as molecular chaperones. PvD7 coding for a cytosolic heatshock-cognate protein of 70 kDa (HSC70) and PvD29 coding for its putative DnaJ-like cochaperone, were concomitantly induced during the light period in untreated roots (Fig. 2). Such a diurnal regulation of cytosolic HSC70s, mainly associated to polysomes, was previously reported in Arabidopsis and spinach leaves [31]. We show here that the diurnal regulation also occurs in roots. So, the HSP70/DnaJ-like chaperone
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
305
Table 3 Sequence analysis of the 42 bean PvD cDNAs Clone
Expression
Class A: early induced PvD1 (R/N) (R/N) PvD2*
Functional category
Length (bp)
Annotation
Cellular division Metabolism
242 189
Centromere protein Phosphoglycerate mutase
189
Organic cation transporter Maturase Lipase/acylhydrolase Similar to auxininduced cytosolic kinase eiF4A HSP/HSC70 Polyubiquitin Polyubiquitin Similar to ribosomeassociated RAMP4 Membrane protein YKT61
Best blastx hit Accession number
Length (AA)
e-Value
AAD25801 (A.t.) S60473 (common ice plant) AAG52125 (A.t.) CAA66945 (A.t.) AAM61667 (A.t.) AAM45011 (A.t.)
80 63
3E37 2E25
167 221 87 122
6E49 E116 E23 8E18
P41381 (tobacco) CAA83548 (pea) UQSY (soybean) BAA05670 (soybean) NP_564279 (A.t.)
107 37 58 134 68
8E51 5E14 5E26 E69 2E28
Q9ZRD6 (A.t.)
199
E98
PvD3 PvD4 PvD5 PvD19*
(R/N) (R/N) (R/N) (R)
Transport Gene expression Signalling Signalling
502 665 446 222
PvD6 PvD7 PvD8 PvD9 PvD12
(R/N) (R/N) (R/N) (R/N) (R)
467 277 376 522 340
PvD17*
(R)
PvD14 PvD15 PvD16 PvD18 PvD20
(R) (R) (R) (R/N) (R)
Protein turn-over Protein folding Protein turn-over Protein turn-over Protein translocation Protein translocation – – – – –
290 394 310 287 290
No No No No No
– Signalling
467 346
BAC42648 (A.t.) AAR20754 (A.t.)
69 35
4E27 E07
–
471
GPI-anchored protein Similar to P53-related protein kinase No similarity
253
Myosin VIII-like protein
79
2E30
379
107
4E41
505
Callose synthase/glycosyl transferase Malate dehydrogenase, nodule enhanced Inosine-uridine preferring nucleoside hydrolase High mobility group protein Jumonji transcription factor Calcium binding protein FKBP type peptidyl -prolyl-cis-trans-isomerase DnaJ-like protein
AAB71526 (sunflower) NP_172136 (A.t.) T06325 (soybean)
247
E127
NP_197390 (A.t)
99
9E18
BAA32827 (carrot) NP_199502 (A.t.) AAG40381 (A.t.) AAL09783 (A.t.)
66 50 85 87
6E14 8E16 3E27 7E24
CAA47925 (cucumber) AAQ63967 (A.t.)
25
5E05
87
9E10
92 120 91
E09 2E20 E21
39 119
4E4 E44
Class B: early repressed PvD10 (R/N) (R/N) PvD11* PvD13
(R)
Class C: not regulated at 1 and 2 h PvD21 Late induced (R/N) PvD22
Late induced (R/N)
PvD23*
(R)
Cellular organization Cellular organization Metabolism
PvD24*
(R)
Metabolism
184
PvD25 PvD26 PvD27 PvD28
Constitutive (R/N) (R) (R) Late induced (R/N)
Gene regulation Gene regulation Signalling Protein folding
208 366 368 271
PvD29
Protein folding
367
PvD30
Early-induced late repressed (R/N) (R)
501
PvD31 PvD32 PvD33*
(R) (R) (R)
Intercellular trafficking Retroelement Retroelement –
369 371 332
PvD34 PvD35 PvD36 PvD37 PvD38 PvD39 PvD40 PvD41 PvD42
(R) (R) (R) (R) (R) (R) (R) (R) (R)
– – – – – – – – –
380 374 248 357 359 381 374 267 268
similarity similarity similarity similarity similarity
SNARE-like protein VAP27-2 Gag/pol polyprotein Pol polyprotein Similar to woundinduced protein Unknown protein Unknown protein No similarity No similarity No similarity No similarity No similarity No similarity No similarity
AAQ82037 (A.t.) AAD19773 (A.t.) CAB65284 (M. truncatula) AAL24177 (A.t.) AAK97729 (A.t.)
A.t.: Arabidopsis thaliana. For PvD cDNAs with a * symbol, the putative function was determined thanks blastx analysis of the corresponding bean EST clone. Expression profiles were determined according reverse northern (R) and/or northern (N) data.
306
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
complex could also be involved in general tolerance to abiotic stresses in bean. This is also the case for the late dehydrationresponsive PvD28, which encoded another putative chaperone, that shared 80% of similarity with the Arabidopsis nucleartargeted FKBP protein FKBP53 [32]. Our data thus corroborate microarray analysis on maize roots, which showed that a FKBP-like gene was late up-regulated in response to PEG treatment [33]). PvD12 and PvD17 early-induced genes encoded proteins that are putatively involved in the protection and translocation of membrane proteins in the endoplasmic reticulum (ER) and golgi network. The PvD12 predicted protein was similar to an Arabidopsis RAMP4-like protein. In animals, RAMP4 is a stress-associated protein involved in the translocation of proteins across the ER membrane [34]. Interestingly, PvD17 encoding a YKT61-like protein, essential for membrane fusion at the trans-Golgi network in Arabidopsis [35] was concomitantly induced in bean dehydrated roots. Finally, one of the major process of plant adaptation to water stress is the ability to rapidly regulate the growth and development of the root apparatus. However, these responses widely differ according to the species and the severity of the treatment. For instance, in maize, but not in wheat, the maintenance of root elongation is an important adaptive response to low water potentials [36]. By contrast, more drastic water deficit affects maize root growth via an inhibition of cell division associated to microtubules reorientation [37]. PvD1 predicted protein, which was similar to an Arabidopsis putative microtubule-associated centromere protein could be involved in cell division in bean roots. We assume that the late dehydration-induced PvD21 and PvD22 cDNAs, coding for an unconventional myosin VIII and callose synthase, respectively, could also participate in the network of regulation of root growth under soil water limitation. In conclusion, this analysis allowed us to identify 20 early and four late dehydration-responsive genes in bean roots. At least 14 of these genes encoded proteins whose function could be related to water stress responses and/or tolerance, some of which were not yet described in plants. The expression pattern of a variety of theses genes opens interesting perspectives to understand the role of these genes in bean roots and their involvement in drought response and tolerance. Acknowledgements We are grateful to Dr M. Crespi and Pr A. Rode for helpful comments on the manuscript, E. Besin for technical assistance and R. Boyer for photography. We thank Dr. Georgina Herna´ndez D. Centro de Ciencias Geno´micas-UNAM, Ap. Postal 565-A, Cuernavaca, Mor. MEXICO, which allowed the use of its bean EST databases before publication. G.A.M. Torres was financially supported by CAPES–Brası´lia/Brazil. References [1] H.J. Bohnert, E. Sheveleva, Plant stress adaptations – making metabolism move, Curr. Opin. Plant Biol. 1 (1998) 267–274.
[2] K. Shinozaki, K. Yamagushi-Shinozaki, M. Seki, Regulatory network of gene expression in the drought and cold stress responses, Curr. Opin. Plant Biol. 6 (2003) 410–417. [3] H. Nonami, J.S. Boyer, Turgor and growth at low water potentials, Plant Physiol. 89 (1989) 798–804. [4] W.J. Davies, J. Zhang, Root signals and the regulation of growth and development of plants in drying soil, Annu. Rev. Plant Physiol. Plant Mol. Biol. 42 (1991) 55–76. [5] B. Vinocur, A. Altman, Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations, Curr. Opin. Biotech. 16 (2005) 123–132. [6] J.A. Kreps, Y. Wu, H.S. Chang, T. Zhu, X. Wang, J.F. Harper, Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress, Plant Physiol. 130 (2002) 2129–2141. [7] M. Seki, M. Narusaka, J. Ishida, T. Nanjo, M. Fujita, Y. Oono, A. Kamiya, M. Nakajima, A. Enju, T. Sakurai, M. Satou, K. Akiyama, T. Taji, K. Yamaguchi-Shinozaki, P. Carninci, J. Kawai, Y. Hayashizaki, K. Shinozaki, Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray, Plant J. 31 (2002) 279–292. [8] Y. Oono, M. Seki, T. Nanjo, M. Narusaka, M. Fujita, R. Satoh, M. Satou, T. Sakurai, J. Ishida, K. Akiyama, K. Iida, K. Maruyama, S. Satoh, K. Yamaguchi-Shinozaki, K. Shinozaki, Monitoring expression profiles of Arabidopsis gene expression during rehydration process after dehydration using ca 7000 full-length cDNA microarray, Plant J. 34 (2003) 868–887. [9] E.A. Bray, Genes commonly regulated by water-deficit stress in Arabidopsis thaliana, J. Exp. Bot. 55 (2004) 2331–2341. [10] H. Teran, S.P. Singh, Comparison of sources and lines selected for drought resistance in common bean, Crop Sci. 42 (2002) 217–233. [11] M. Ramirez, M.A. Graham, L. Blanco-Lopez, S. Silvente, A. MedranoSoto, M.W. Blair, G. Hernandez, C.P. Vance, M. Lara, Sequencing and analysis of common bean ESTs. Building a foundation for functional genomics, Plant Physiol. 137 (2005) 1211–1227. [12] J.M. Colmenero-Flores, F. Campos, A. Garciarubio, A.A. Covarrubias, Characterization of Phaseolus vulgaris cDNA clones responsive to water deficit: identification of a novel late embryogenesis abundant like protein, Plant Mol. Biol. 35 (1997) 393–405. [13] X. Qin, J.A.D. Zeevaart, The 9-cis–epoxycarotenoid cleavage reaction is the key regulatory step of abscissic acid biosynthesis in water-stressed bean, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 15354–15361. [14] V. Glisin, R. Crkvenjakov, C. Buys, Ribonucleic acid isolation by cesium chloride centrifugation, Biochemistry 13 (1974) 2633–2640. [15] P. Liang, A.B. Pardee, Differential display of eukaryotic messager RNA by means of the polymerase chain reaction, Science 257 (1992) 967–997. [16] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory Press, 1989. [17] S.F. Altschul, T.L. Madden, A.A. Scha¨ffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucl. Acids Res. 25 (1997) 3389–3402. [18] H. Roy-Macauley, Y. Zuily-Fodil, M. Kidric, A.T. Pham-Thi, J. Viera da Silva, Effect of drought stress on proteolytic activities in Phaseolus and Vigna leaves from sensitive and resistant plants, Plant Physiol. 85 (1992) 90–96. [19] S. Iuchi, M. Kobayashi, T. Taji, M. Naramoto, M. Seki, T. Kato, S. Tabata, Y. Kakubari, K. Yamaguchi-Shinozaki, K. Shinozaki, Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis, Plant J. 27 (2001) 325–333. [20] L.P. Moreno-Fonseca, A.A. Covarrubias, Dowsnstream DNA sequences are required to modulate Pvlea18 gene expression in response to dehydration, Plant Mol. Biol. 45 (2001) 501–515. [21] H. Porta, P. Rueda-Benitez, F. Campos, J.M. Colmenero-Flores, J.M. Colorado, M.J. Carmona, A.A. Covarrubias, M. Rocha-Sosa, Analysis of lipoxygenase mRNA accumulation in the common bean (Phaseolus vulgaris L.), Plant Cell Physiol. 40 (1999) 850–858. [22] G.A. Torres, C. Lelandais-Briere, E. Besin, M.F. Jubier, O. Roche, C. Mazubert, F. Corre-Menguy, C. Hartmann, Characterization of the expression of Phaseolus vulgaris OCT1, a dehydration-responsive gene that
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
[23]
[24]
[25]
[26]
[27]
[28] [29]
encodes a new type of phloem transporter, Plant Mol. Biol. 51 (2003) 341– 349. A.R. Matos, A. d’Arcy-Lameta, M. Franca, Y. Zuily-Fodil, A.T. PhamThi, A patatin-like protein with galactolipase activity is induced by drought stress in Vigna unguiculata leaves, Biochem. Soc. Trans. 28 (2000) 779–781. H. El Maarouf, Y. Zuily-Fodil, M. Gareil, A. d’Arcy-Lametta, A.T. PhamThi, Enzymatic activity and gene expression under water stress of phospholipase D in two cultivars of Vigna unguiculata L., Plant Mol. Biol. 39 (1999) 1257–1265. T. Katagiri, S. Takahashi, K. Shinozaki, Involvement of a novel Arabidopsis phospholipase D, AtPLDdelta, in dehydration-inducible accumulation of phosphatidic acid in stress, Plant J. 26 (2001) 595–605. N. Vartanian, L. Marcotte, J. Giraudat, Drought Rhizogenesis in Arabidopsis thaliana (differential responses of hormonal mutants), Plant Physiol. 104 (1994) 761–767. J. Leymarie, C. Damerval, L. Marcotte, V. Combes, N. Vartanian, Twodimensional protein patterns of Arabidopsis wild-type and auxin insensitive mutants, axr1, axr2, reveal interactions between drought and hormonal responses, Plant Cell Physiol. 37 (1996) 966–975. S.T. Sadiqov, M. Akbulut, V. Ehmedov, Role of Ca2+ in drought stress signaling in wheat seedlings, Biochemistry (Mosc) 67 (2002) 491–497. Z.N. Oztur, V. Talame, M. Deyholos, C.B. Michalowski, D.W. Galbraith, N. Gozukirmizi, R. Tuberosa, H.J. Bohnert, Monitoring large-scale changes in transcript abundance in drought- and salt-stressed barley, Plant Mol. Biol. 48 (2002) 551–573.
307
[30] T. Mandel, A.J. Fleming, R. Kra¨henbu¨hl, C. Kuhlemeier, Definition of constitutive gene expression in plants: the translation initiation factor 4A gene as a model, Plant Mol. Biol. 29 (1995) 995–1004. [31] Q.B. Li, D. Haskell, C. Zhang, D.Y. Sung, C. Guy, Diurnal regulation of Hsp70s in leaf tissue, Plant J. 21 (2000) 373–378. [32] H. Zengyong, L. Legong, L. Sheng, Immunophilins and parvulins. Superfamily of peptidyl Polyl isomerases in Arabidopsis, Plant Physiol. 134 (2004) 1248–1267. [33] J. Zheng, J. Zhao, Y. Tao, J. Wang, Y. Liu, J. Fu, Y. Jin, P. Gao, J. Zhang, Y. Bai, G. Wang, Isolation and analysis of water stress induced genes in maize seedlings by subtractive PCR and cDNA macroarray, Plant Mol. Biol. 55 (2004) 807–823. [34] A. Yamaguchi, O. Hori, D.M. Stern, E. Hartmann, S. Ogawa, M. Tohyama, Stress-associated endoplasmic reticulum protein 1 (SERP1)/Ribosomeassociated membrane protein 4 (RAMP4) stabilizes membrane proteins during stress and facilitates subsequent glycosylation, J. Cell Biol. 147 (1999) 1195–1204. [35] Y. Chen, Y.K. Shin, D.C. Bassham, YKT6 is a core constituent of membrane fusion machineries at the arabidopsis trans-Golgi network, J. Mol. Biol. 350 (2005) 92–101. [36] Y. Wu, D.J. Cosgrove, Adaptation of roots to low water potentials by changes in cell wall extensibility and cell wall proteins, J. Exp. Bot. 51 (2000) 1543–1553. [37] E.B. Blancaflor, K.H. Hasenstein, Growth and microtubule orientation of Zea mays roots subjected to osmotic stress, Int. J. Plant Sci. 156 (1995) 774–783.
Identification of novel drought-related mRNAs in common bean roots by differential display RT-PCR Gisele A.M. Torres a, Stephanie Pflieger b, Fabienne Corre-Menguy c, Christelle Mazubert c, Caroline Hartmann c, Christine Lelandais-Brie`re c,* a
Instituto Agronoˆmico de Campinas, Centro de Pesquisa e Desenvolvimento de Recursos Gene´ticos Vegetais, Caixa Postal 28, 13001-970 Campinas, SP, Brazil b Virologie Moleculaire, Institut Jacques Monod, CNRS, Universite´s Paris 6-7, 2 Place Jussieu, 75251 Paris Cedex 05, France c Institut des Sciences du Ve´ge´tal, CNRS, bat 23, Avenue de la terrasse, 91198 Gif/Yvette, France Received 11 October 2005; received in revised form 17 March 2006; accepted 22 March 2006 Available online 18 April 2006
Abstract Drought is a major constraint for the production of common bean (Phaseolus vulgaris L.). To identify molecular responses to water deficit, we performed a differential display RT-PCR (DDRT) analysis using roots of bean plants grown aeroponically and submitted to dehydration. This allowed us to visualise 1200 DDRT bands, 8.7% of which showed a clear regulation by dehydration, and to clone 42 cDNAs, called PvD1 to PvD42. Among them, 20 early-dehydration-responsive cDNAs were selected by reverse northern that were induced or repressed before detectable water status changes and induction of ABA-regulated genes. Northern analysis for 16 PvD clones confirmed these early regulations and allowed us to identify four late dehydration-responsive genes. Their putative involvement in signalling, protein turn-over and translocation, chaperones as well as root growth modulations in response to water stress is discussed. # 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Dehydration; DDRT; Gene regulation; Legumes; Water deficit
1. Introduction Environmental stresses such as drought, salinity and temperature extremes limit crop productivity. To cope with these constraints, plants induce complex modifications of both their physiological state and metabolic pathways, which are not still clarified. However, some ubiquitous physiological responses have been reported, such as stomatal closure, osmotic adjustment and increase in abscisic acid (ABA) content [1]. At molecular level, many groups of proteins play important roles in these responses, like proteins involved in signal transduction and regulation of gene expression and proteins that participate in adaptation to stress such as heat shock proteins (HSP) and late embryogenesis abundant (LEA) proteins [2]. As all the modifications associated with stress responses generally affect plant growth and yield [3,4], more drought-tolerant varieties must be developed. However, both
* Corresponding author. Tel.: +33 1 69 82 35 93. E-mail address: [email protected] (C. Lelandais-Brie`re). 0168-9452/$ – see front matter # 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2006.03.008
classic breeding and engineering strategies, relying on the transfer of one or several genes, are limited by the genetic complexity and multigenic trait of water stress tolerance [5]. Thus, it appears that an important step will be the discovery of new genes, involved in water stress response and/or tolerance. For model plants, analyses using full genome microarrays allow to reveal genes whose expression is modulated during application of different types of stresses. However, a comparative analysis of published microarray data from about 7000 to 8000 genes of Arabidopsis ecotype Columbia [6–8] showed that methods of water deficit imposition have a strong impact on the results [9]. Indeed, among the 1919 genes present on the three sets of microarrays, only 27 were induced and three were repressed under the three hyperosmotic stress conditions tested: desiccation, mannitol treatment and progressive soil–water deficit. Moreover, the great variety of inducible or repressible genes in each experiment (around 10% of the genes) confirms the complexity of water stress responses and the difficulty to transfer data from model plants to crops. Therefore, one challenge remains to identify the maximum of molecular elements involved in drought responses for each cultivated species.
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
Drought is one of the major constraints for the productivity of common bean (Phaseolus vulgaris L.), an important crop legume for human consumption [10]. Unfortunately, among legumes, common bean genomics was not a priority and the first large expressed sequence tag (ESTs) data have only been published this year [11]. These data correspond to five libraries derived from different organs and treatments, like phosphorus starvation, but do not include osmotic treatments. To date, only a dozen of genes have been reported as drought-related in bean. Some are involved in protection or repair of cell components under stress conditions, such as Pvlea18 or Pvlea4-25, two late embryogenesis abundant proteins and Pvhsp17-19, a lowmolecular-weight heat shock protein [12]. Others, like prolinerich proteins or a lipid-transfer protein, could participate in modifications of cell wall composition and thus certainly in growth adaptation in response to drought [12]. Finally, like in other plant species, the activation of Pvnced1 expression was tightly correlated with the rapid accumulation of ABA in dehydrated leaves and roots. Indeed, this gene encodes the ninecis-epoxycarotenoid dioxygenase, an enzyme which catalyses a key limiting step in ABA biosynthesis [13]. Identification of new bean drought-responsive genes is essential to dissect molecular regulation in response to water deficit. A dehydration system was thus developed and differential display RT-PCR (DDRT) allowed to identify 24 genes putatively linked to drought responses in common bean roots.
301
root water status, water potentials (Cw) were measured for five dehydrated and five control plants at each period with a portable pressure chamber (PMS Intrument, Corvallis, OR). The Cw data are reported as the mean value of the five samples S.E. in three replicates. 2.3. RNA extraction and differential display RT-PCR
2. Materials and methods
Total RNA was extracted using the cesium chloride cushion method [14]. RNA (20 mg) was treated with 10 U of RNase-free DNAse I (Amersham Biosciences) for 15 min at 37 8C. Differential display RT-PCR (DDRT) was then performed as described in [15]. Briefly, 0.2 mg of RNAwas reverse-transcribed with 40 U of Superscript II reverse transcriptase (Invitrogen) and 50 mM of anchor primer (T12CA or T12GC) for 1 h at 42 8C. PCR was performed using 1/8 v of cDNA, 2 mL of [a-33P]-dATP (Amersham Biosciences), 1 U of Taq DNA Polymerase (Perkin Elmer Applied Biosystems), 2.5 mM of anchor primer and 0.5 mM of an arbitrary upstream primer (30 s at 94 8C, 2 min at 40 8C and 45 s at 72 8C for 40 cycles). Upstream primers were U5: 50 GGAACCAATC30 , U6: 50 AAACTCCGTC30 , U13: 50 GTTTTCGCAG30 , U17: 50 GATCTGACAC30 , U19: 50 GATCATAGCC30 and U25: 50 TGGATTGGTC30 . DDRT products were separated on 6% sequencing denaturing gels and visualised by autoradiography. After excision from the gel, partial cDNAs were amplified by PCR in similar conditions and cloned using the Topo TA Cloning Kit (Invitrogen). For each DDRT band, 12 clones were analysed and the different cDNA families were selected according their AluI and HaeIII restriction pattern.
2.1. Plant material and aeroponic growth conditions
2.4. Reverse northern analysis
P. vulgaris L. cv La Victoire is a french bean cultivar of andean origin (according phaseolin markers analysis), whose field qualities (productivity, precocity) are counterbalanced by a high sensitivity to pathogens (V. Geffroy, personal communication). Seeds were grown on perlite in a growth chamber with 16 h of light at 26 8C (OSRAM TLD 83 lamps, MGIE, France, 300 mmol m2 s1) and 8 h of dark at 17 8C in a relative humidity of 70%. Plants were watered daily with a nutrient solution (Hydrokani C2 – Hydro Agri Spe´cialite´s, France) 5% (w/v), chelate iron (0.144 g/L) buffered to pH 5.8 with 0.4 N nitric acid. After 1 week, seedlings were transferred to an aeroponic ‘‘Rainforest-72 sites’’ system, manufactured by General Hydroponics Europe. In these conditions, roots grew during 2 weeks in a black plastic box with a constantly spraying of the nutrient solution, whereas stems were kept in the controlled conditions described above.
The 42 cDNAs obtained by DDRT were amplified by PCR in standard conditions using 10 ng of plasmid and the universal direct and reverse primers. After a short migration on 1.2% agarose gels, 200 ng of each cDNA were transferred onto nylon positive membranes (Qbiogen). Bean genomic DNA (200 ng) was also blotted to test the quality of the transfer and control the counting of the probes. The complex cDNA probes were synthesised from 5 mg of DNAse-treated RNA during 30 min at 42 8C in the presence of 5 mL of [a-32P]-dCTP, 200 U of Superscript II reverse transcriptase, 30 U of RNaseout (Invitrogen), 1.8 mM pdN6 (Invitrogen), 1 mM dNTP without dCTP (Amersham Biosciences) and 0.01 M DTT. An incubation at 42 8C for 30 min with non-radioactive dCTP (2.5 mM) was then performed. The probes were purified onto Nick columns (Amersham Biosciences) and the level of incorporated radioactivity was counted with a Beckman LS6000IC Liquid Scintillation system. After prehybridisation for 2 h at 42 8C in 5 SSC, 50% (v/v) formamide, 0.5% (w/v) SDS, 5 Denhardt’s and 100 mg/mL salmon sperm DNA, the blot were hybridised with 30 106 cpm of complex cDNA probe during 16 h at 42 8C. The membranes were washed twice for 20 min at 42 8C in 2 SSC/0.5% SDS, twice at 42 8C in 0.1 SSC/0.1% SDS and once at 65 8C in 0.1 SSC/0.1% SDS. The hybridisation signals were quantified using a Storm 860 and the ImageQuant 5.0 software (Molecular Dynamics). All values
2.2. Dehydration treatments and water potential measurements A 3-week-old plants, with three trifoliate leaves, were submitted to dehydration by arrest of the spraying, 1 h after the beginning of the light. Roots of five dehydrated and five control well-watered plants were collected after 1, 2, 5, and 8 h of treatment in four independent experiments. To determine the
302
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
were normalised to the hybridisation signals obtained with the constitutive 18S rDNA gene (50 ng). Finally, the mean ratio of transcript accumulation between the dehydrated and the corresponding control samples (d/c ratio) in two independent experiments was calculated for each cDNA. 2.5. Northern blot analysis Total RNA (12 mg) was fractionated on formaldehyde denaturing agarose gels and transferred onto nylon positive membranes according to [16]. The pre-hybridisation and hybridisation steps were performed as described above. The probes were labelled with [a-32P]-dCTP using the Ready To Go Labelling kit (Amersham Biosciences). The PvD probes were obtained by PCR amplification with universal primers on the corresponding clone. The Pvnced1, Pvlea18, Pvlox2 probes were generated by RT-PCR using specific primers designed on published bean sequences (AF190462: 50 CCCGAAACTCGACCCCGTCAAC30 , 50 CCTCCCACGCGTTCCAGAGATG30 ; U72764: 50 CAACAGAGGACAGTCCCTATG30 , 50 CCAACATGTCATGATCGAAAAG30 ; U76687: 50 TGAAT0 ATCAATGGACTTGCACG3 , 50 AGCTTCCTTCCACCAAGTTTG30 ). As a loading control, the membranes were subsequently hybridised with a 18S rDNA constitutive probe. 2.6. Sequence analyses The 42 PvD cDNAs were sequenced using the ABIPRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Applied Biosystems). Accession numbers of the PvD cDNAs are from AF527434 to AF527453 for PvD1 to PvD20 and DQ117555 to DQ117576 for PvD21 to PvD42. The nucleotide and predicted amino acid sequences homologies were searched in databases using the blastn and blastx programs [17]. Sequence alignments were performed with CLUSTAL_X.
Table 1 Effect of dehydration on root water potential Time (h)
0 1 2 5 8
Root water potential (MPa) Control
Dehydration
0.3 0.2 0.4 0.4 0.4 0.1 0.2 0.2 0.2 0.2
– 0.5 0.1 1.3 0.4 1.9 1.1 2.4 0.7
For each condition, root water potential (in MPa) was measured for five plants in three independent experiments.
The Pvnced1, Pvlea18 and Pvlox2 genes, whose transcription was previously known to be activated during water deficit in bean, were used as molecular controls to validate the appropriateness of this experimental system (Fig. 1). Indeed, Qin and Zeevaart [13] showed that the accumulation of ABA in bean was strictly correlated with the activation of the Pvnced1 gene, coding for the 9-cis-epoxycarotenoid dioxygenase, a key enzyme in ABA biosynthesis [19]. In our conditions, the 2.4 kb Pvnced1 transcripts, undetectable in well-watered roots (c1–c8) could be observed as a very faint signal within 1 h after the onset of dehydration (d1) and gradually increased up to 8 h of treatment (d2–d8). Moreover, Moreno-Fonseca and Covarrubias [20] reported that the expression of the LEA-encoding gene Pvlea18 was activated by drought via ABA-dependent signalling. As expected, Pvlea18 mRNA accumulation increased after 2 h of treatment, concomitantly with Pvnced1. Finally, the lipoxygenase-encoding Pvlox genes, whose expression was activated by desiccation in bean [21], showed a progressive induction throughout the dehydration treatment. Taken together, these data demonstrated the suitability of our experimental system for the identification of genes involved in water stress responses in bean roots. 3.2. Isolation of the bean PvD cDNAs by differential display
3. Results and discussion 3.1. Characterization of the ‘‘aeroponic/dehydration’’ system To analyse drought responses in bean roots, an experimental system using ‘‘aeroponic/dehydration’’ was developed. Aeroponic process was preferred to soil culture because it allows both a better reproducibility of plant growth and stress application and the rapid collection of large amounts of roots with undetectable contamination. A 3-week-old plants were subjected to dehydration treatments by vaporisation stop for 1, 2, 5 or 8 h (d1–d8 samples). Simultaneously, untreated root samples were collected (c1–c8 samples). Measurements of water potentials in control roots showed that the water status did not change significantly during the 8 h period (Table 1). By contrast, in water-stressed samples, water potential began to decrease after 2 h of dehydration and dropped very rapidly to 2.4 MPa after 8 h (Table 1). This latest value was similar to those reported for bean after 1 week of progressive drought [18].
To identify dehydration-responsive genes, differential display RT-PCR (DDRT) analyses were conducted using RNAs
Fig. 1. Transcript accumulation profiles of three drought-regulated genes in bean dehydrated roots. Total RNA was isolated from dehydrated (d1, d2, d5, and d8) and well-watered (c1–c8) roots collected 1, 2, 5 and 8 h after the beginning of the treatment. After electrophoresis and transfer, 12 mg of RNA were hybridised with Pvnced1, Pvlea18 and Pvlox probes. As a loading control, the same blot was hybridised with a ribosomal DNA probe (18S rDNA).
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
303
Table 2 Selection of 20 early dehydration-responsive PvD cDNAs by reverse northern
A A A A A A A A A B
Clone
d1/c1
d2/c2
PvD1 PvD2 PvD3 PvD4 PvD5 PvD6 PvD7 PvD8 PvD9 PvD10 Genomic DNA
6.9 0.9 3.5 0.4 2.5 0.2 2.2 0.2 3.6 0.8 2.9 0.4 2.5 0.1 2.9 0.4 1.9 0.5 0.1 0.1 1.1 0.5
3.2 0.7 1.1 0.2 0.3 0.2 1 0.1 1.8 0.2 0.8 0.1 2.3 0.2 2.2 0.2 2.1 0.1 0.4 0.2 0.9 0.1
B A B A A A A A A A
Clone
d1/c1
d2/c2
PvD11 PvD12 PvD13 PvD14 PvD15 PvD16 PvD17 PvD18 PvD19 PvD20 18S rDNA
0.4 0.1 2 0.2 0.4 0.1 2 0.2 4 0.8 3.6 0.4 5.8 0.9 2.7 0.4 2.4 0.2 3.2 0.3 1 0.1
0.6 0.1 1.7 0.3 0.6 0.2 0.3 0.1 0.5 0.1 0.5 0.2 0.4 0.2 2.5 0.2 0.9 0.1 0.4 0.2 1 0.1
After electrophoresis, PCR-amplified DNA from all PvD clones were transferred and hybridised with 32P-labeled complex cDNA probes corresponding to roots dehydrated for 1 and 2 h (d1 and d2) or to well-watered roots (c1 and c2). The mean ratio of transcript accumulation in stressed samples compared to controls (d1/c1 and d2/c2) have been calculated for two independent experiments. Ratio values higher than 2 (A) or lower than 0.5 (B) are in bold. Genomic DNA and the 18S rDNA gene represent internal and constitutive controls, respectively.
extracted from roots, that were either dehydrated or wellwatered for 1, 2, 5 or 8 h. Twelve combinations of primers were tested, allowing the detection of approximately 1200 DDRT bands ranging from 50 to 700 bp. Among them, 8.7% displayed differential accumulation between dehydrated and control roots. This level of drought-responsive genes was similar to those obtained using microarrays in Arabidopsis subjected to different kinds of osmotic stresses [9]. Thirty-two differential bands were selected, according to four main criteria: highly reproducible profiles in the four independent dehydration treatments, early regulation (after 1 and/or 2 h of treatment), sizes ranging from 200 to 700 bp and no or few diurnal regulation in controls. After cloning, restriction analyses and sequencing, 42 different cDNAs between 189 and 665 bp were identified and named PvD1 to PvD42 for P. vulgaris cDNAs identified in Dehydrated roots. 3.3. Selection and expression analysis of the dehydrationresponsive PvD genes The early dehydration-responsive PvD cDNAs were selected by reverse northern experiments (Table 2). We focused our analysis on gene regulation in roots occurring prior to activation of known ABA-responsive genes (Pvnced1 and Pvlea18). For that purpose, complex cDNA probes corresponding to RNAs of c1, d1, c2 and d2 roots were hybridised onto membranes that contained 200 ng of each PvD cDNA. The constitutive 18S rDNA gene and genomic DNA were used as internal controls. Hybridisation signals were quantified in two independent experiments and the mean ratio of transcript accumulation between dehydrated and control samples (d1/c1 and d2/c2 ratio) were calculated. Twenty PvD clones, called PvD1 to PvD20, showed a d1/c1 and/or a d2/c2 ratio higher than two (class A: induced by stress) or lower than 0.5 (class B: repressed) and were thus considered as early dehydrationresponsive. The other 20 cDNAs (PvD21 to PvD42: class C) encompasses genes for which transcript levels were either undetectable or similar in control and stressed samples after 1 and 2 h of treatment (not shown). According to reverse northern
hybridised with leaf RNA (not shown), mRNAs for 8 PvD genes were detectable in unstressed leaves and five presented an over-accumulation after 2 h dehydration (PvD4, 9, 12, 17 and 18). To confirm these expression profiles during dehydration treatment, Northern blot analyses were performed using representative cDNAs of each class (Fig. 2). The results were globally consistent with reverse northern; indeed, all class A and B cDNAs tested presented an early induction or decrease. Only PvD29, first classified in class C, displayed in fact a weak induction after 1 h of stress in comparison to the control. For most class A genes, the early induction was followed by a dramatic decline of transcript levels. Indeed, at 8 h, mRNA levels were either similar (PvD4, PvD5) or lower (PvD1, PvD2, PvD3, PvD6, PvD7, PvD8 and 9) than the controls. Only PvD18 was progressively induced during all the treatment. The two class B cDNAs tested in northern (PvD10 and PvD11) presented a progressive decrease of mRNA levels throughout the treatment. In class C, PvD25 was a false-positive (constitutively expressed) whereas PvD29, induced in untreated roots during the light period, was slowly induced after 1 and 2 h and subsequently down-regulated at 5 and 8 h of dehydration. By contrast, PvD21, PvD22 and PvD28 transcripts clearly accumulated at the later stages of dehydration, allowing us to consider these genes as late dehydration-responsive. 3.4. Sequence analysis of the PvD cDNAs and putative involvement in drought responses Results of sequence and expression analysis of the 42 PvD clones are summarized in Table 3. Blastn search was firstly used to compare the PvD sequences to bean databases. Only PvD2 and PvD8 were identical to bean accessions, coding for an ATP synthase protein 6 (ATP6) homolog (U28921) and ubiquitin (U77939), respectively. For PvD2, we assume that the previous annotation was incorrect. Since, it displayed strong homology to a common ice plant EST, which codes for a salinity-induced phosphoglycerate mutase. No significant homology was found in the 8000 non-redundant ESTs from the bean Mesoamerican
304
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
Fig. 2. Time-course of mRNA accumulation of selected PvD genes in bean roots throughout the dehydration kinetics. Total RNA (12 mg), extracted from roots either dehydrated for 1, 2, 5, and 8 h (d1–d8) or untreated (c1–c8), was fractionated by electrophoresis on a denaturing agarose gel. Identical northern blots were probed with 32P-labeled PvD cDNAs representative from each expression profile (class A: early-induced; class B: early repressed; class C: not modulated after 1 and 2 h dehydration). As a loading control, the same blot was probed with the constitutive 18S rDNA. A representative gel is shown. Time of exposure was not identical for all probes.
genotype Negro Jamapa 81 derived from five libraries, one of which corresponded to roots [11]. By contrast, 17 PvD cDNAs were homologous to leaf cDNAs present in the sole EST library from an Andean cultivar G19833. These results reinforced the
fact that La Victoire is an Andean genotype as shown by phaseolin markers analysis (V. Geffroy, personal communication). Secondly, for 29 PvD clones, blastx analysis using the PvD sequence and/or the corresponding EST provided significant similarity with plant proteins (Table 3). Finally, no significant similarity was found in databases for 13 PvD clones (30%) although all but one present 40–120 amino acids ORFs. Thus, our approach revealed novel genes linked to water stress. Based on their sequence and expression pattern, putative functions could be attributed to several dehydration-related PvD genes. We have recently characterised PvD3, which exhibited strong similarity with animal organic cation transporters, as a new phloem transporter in plants [22]. At least two PvD clones (PvD5 and PvD19) could be elements of drought-associated transduction pathways. PvD5, whose expression was transitorily induced at d1 and broken down since d2 (Fig. 2), encoded a putative lipase/acylhydrolase. In Arabidopsis and in the legume Vigna unguiculata, droughtinduced lipid acylhydrolases [23] and phospholipases [24,25] participate, at least in leaves, to specific lipid signalling pathways in response to water stress. The absence of PvD5 mRNA in leaves (not shown) and its early and transient activation argued in the favour of a root-specific lipid signalling. Interestingly, the EST corresponding to the earlyinduced PvD19 encoded a protein similar to an Arabidopsis putative auxin-induced cytosolic kinase. The involvement of auxin-dependent pathways in osmotic stress responses has been few documented; nevertheless, in Arabidopsis, auxins, together with endogenous ABA and gibberellins, play a promotive role in drought-induced rhizogenesis during progressive drought [26,27]. Moreover, Sadiqov et al. [28] reported that auxins participate in signalling mechanisms of drought-induced accumulation of proline, a major plant osmolyte. Numerous drought-responsive PvD genes encoded proteins are involved in the turn-over (PvD6, 8, 9), folding (PvD7, 28 and 29) and translocation (PvD12 and 17) of cellular proteins, mechanisms which are ubiquitous in water stress tolerance [1] and seem to be fundamental in bean roots. The regulation of protein turn-over in response to abiotic stress, especially the specific translation of proteins involved in tolerance and the proteolysis of damaged or unfolded proteins, has been intensively studied in seedling of several species [7,29] but never in roots. More striking was the early induction of PvD6 that encoded a translation initiation factor eIF4A. Indeed, although other translation initiation factors were reported as drought-responsive [7], eif4A genes have long been considered as constitutive genes in plant expression studies [30]. PvD7, PvD28 and PvD29 encoded proteins functioning as molecular chaperones. PvD7 coding for a cytosolic heatshock-cognate protein of 70 kDa (HSC70) and PvD29 coding for its putative DnaJ-like cochaperone, were concomitantly induced during the light period in untreated roots (Fig. 2). Such a diurnal regulation of cytosolic HSC70s, mainly associated to polysomes, was previously reported in Arabidopsis and spinach leaves [31]. We show here that the diurnal regulation also occurs in roots. So, the HSP70/DnaJ-like chaperone
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
305
Table 3 Sequence analysis of the 42 bean PvD cDNAs Clone
Expression
Class A: early induced PvD1 (R/N) (R/N) PvD2*
Functional category
Length (bp)
Annotation
Cellular division Metabolism
242 189
Centromere protein Phosphoglycerate mutase
189
Organic cation transporter Maturase Lipase/acylhydrolase Similar to auxininduced cytosolic kinase eiF4A HSP/HSC70 Polyubiquitin Polyubiquitin Similar to ribosomeassociated RAMP4 Membrane protein YKT61
Best blastx hit Accession number
Length (AA)
e-Value
AAD25801 (A.t.) S60473 (common ice plant) AAG52125 (A.t.) CAA66945 (A.t.) AAM61667 (A.t.) AAM45011 (A.t.)
80 63
3E37 2E25
167 221 87 122
6E49 E116 E23 8E18
P41381 (tobacco) CAA83548 (pea) UQSY (soybean) BAA05670 (soybean) NP_564279 (A.t.)
107 37 58 134 68
8E51 5E14 5E26 E69 2E28
Q9ZRD6 (A.t.)
199
E98
PvD3 PvD4 PvD5 PvD19*
(R/N) (R/N) (R/N) (R)
Transport Gene expression Signalling Signalling
502 665 446 222
PvD6 PvD7 PvD8 PvD9 PvD12
(R/N) (R/N) (R/N) (R/N) (R)
467 277 376 522 340
PvD17*
(R)
PvD14 PvD15 PvD16 PvD18 PvD20
(R) (R) (R) (R/N) (R)
Protein turn-over Protein folding Protein turn-over Protein turn-over Protein translocation Protein translocation – – – – –
290 394 310 287 290
No No No No No
– Signalling
467 346
BAC42648 (A.t.) AAR20754 (A.t.)
69 35
4E27 E07
–
471
GPI-anchored protein Similar to P53-related protein kinase No similarity
253
Myosin VIII-like protein
79
2E30
379
107
4E41
505
Callose synthase/glycosyl transferase Malate dehydrogenase, nodule enhanced Inosine-uridine preferring nucleoside hydrolase High mobility group protein Jumonji transcription factor Calcium binding protein FKBP type peptidyl -prolyl-cis-trans-isomerase DnaJ-like protein
AAB71526 (sunflower) NP_172136 (A.t.) T06325 (soybean)
247
E127
NP_197390 (A.t)
99
9E18
BAA32827 (carrot) NP_199502 (A.t.) AAG40381 (A.t.) AAL09783 (A.t.)
66 50 85 87
6E14 8E16 3E27 7E24
CAA47925 (cucumber) AAQ63967 (A.t.)
25
5E05
87
9E10
92 120 91
E09 2E20 E21
39 119
4E4 E44
Class B: early repressed PvD10 (R/N) (R/N) PvD11* PvD13
(R)
Class C: not regulated at 1 and 2 h PvD21 Late induced (R/N) PvD22
Late induced (R/N)
PvD23*
(R)
Cellular organization Cellular organization Metabolism
PvD24*
(R)
Metabolism
184
PvD25 PvD26 PvD27 PvD28
Constitutive (R/N) (R) (R) Late induced (R/N)
Gene regulation Gene regulation Signalling Protein folding
208 366 368 271
PvD29
Protein folding
367
PvD30
Early-induced late repressed (R/N) (R)
501
PvD31 PvD32 PvD33*
(R) (R) (R)
Intercellular trafficking Retroelement Retroelement –
369 371 332
PvD34 PvD35 PvD36 PvD37 PvD38 PvD39 PvD40 PvD41 PvD42
(R) (R) (R) (R) (R) (R) (R) (R) (R)
– – – – – – – – –
380 374 248 357 359 381 374 267 268
similarity similarity similarity similarity similarity
SNARE-like protein VAP27-2 Gag/pol polyprotein Pol polyprotein Similar to woundinduced protein Unknown protein Unknown protein No similarity No similarity No similarity No similarity No similarity No similarity No similarity
AAQ82037 (A.t.) AAD19773 (A.t.) CAB65284 (M. truncatula) AAL24177 (A.t.) AAK97729 (A.t.)
A.t.: Arabidopsis thaliana. For PvD cDNAs with a * symbol, the putative function was determined thanks blastx analysis of the corresponding bean EST clone. Expression profiles were determined according reverse northern (R) and/or northern (N) data.
306
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
complex could also be involved in general tolerance to abiotic stresses in bean. This is also the case for the late dehydrationresponsive PvD28, which encoded another putative chaperone, that shared 80% of similarity with the Arabidopsis nucleartargeted FKBP protein FKBP53 [32]. Our data thus corroborate microarray analysis on maize roots, which showed that a FKBP-like gene was late up-regulated in response to PEG treatment [33]). PvD12 and PvD17 early-induced genes encoded proteins that are putatively involved in the protection and translocation of membrane proteins in the endoplasmic reticulum (ER) and golgi network. The PvD12 predicted protein was similar to an Arabidopsis RAMP4-like protein. In animals, RAMP4 is a stress-associated protein involved in the translocation of proteins across the ER membrane [34]. Interestingly, PvD17 encoding a YKT61-like protein, essential for membrane fusion at the trans-Golgi network in Arabidopsis [35] was concomitantly induced in bean dehydrated roots. Finally, one of the major process of plant adaptation to water stress is the ability to rapidly regulate the growth and development of the root apparatus. However, these responses widely differ according to the species and the severity of the treatment. For instance, in maize, but not in wheat, the maintenance of root elongation is an important adaptive response to low water potentials [36]. By contrast, more drastic water deficit affects maize root growth via an inhibition of cell division associated to microtubules reorientation [37]. PvD1 predicted protein, which was similar to an Arabidopsis putative microtubule-associated centromere protein could be involved in cell division in bean roots. We assume that the late dehydration-induced PvD21 and PvD22 cDNAs, coding for an unconventional myosin VIII and callose synthase, respectively, could also participate in the network of regulation of root growth under soil water limitation. In conclusion, this analysis allowed us to identify 20 early and four late dehydration-responsive genes in bean roots. At least 14 of these genes encoded proteins whose function could be related to water stress responses and/or tolerance, some of which were not yet described in plants. The expression pattern of a variety of theses genes opens interesting perspectives to understand the role of these genes in bean roots and their involvement in drought response and tolerance. Acknowledgements We are grateful to Dr M. Crespi and Pr A. Rode for helpful comments on the manuscript, E. Besin for technical assistance and R. Boyer for photography. We thank Dr. Georgina Herna´ndez D. Centro de Ciencias Geno´micas-UNAM, Ap. Postal 565-A, Cuernavaca, Mor. MEXICO, which allowed the use of its bean EST databases before publication. G.A.M. Torres was financially supported by CAPES–Brası´lia/Brazil. References [1] H.J. Bohnert, E. Sheveleva, Plant stress adaptations – making metabolism move, Curr. Opin. Plant Biol. 1 (1998) 267–274.
[2] K. Shinozaki, K. Yamagushi-Shinozaki, M. Seki, Regulatory network of gene expression in the drought and cold stress responses, Curr. Opin. Plant Biol. 6 (2003) 410–417. [3] H. Nonami, J.S. Boyer, Turgor and growth at low water potentials, Plant Physiol. 89 (1989) 798–804. [4] W.J. Davies, J. Zhang, Root signals and the regulation of growth and development of plants in drying soil, Annu. Rev. Plant Physiol. Plant Mol. Biol. 42 (1991) 55–76. [5] B. Vinocur, A. Altman, Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations, Curr. Opin. Biotech. 16 (2005) 123–132. [6] J.A. Kreps, Y. Wu, H.S. Chang, T. Zhu, X. Wang, J.F. Harper, Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress, Plant Physiol. 130 (2002) 2129–2141. [7] M. Seki, M. Narusaka, J. Ishida, T. Nanjo, M. Fujita, Y. Oono, A. Kamiya, M. Nakajima, A. Enju, T. Sakurai, M. Satou, K. Akiyama, T. Taji, K. Yamaguchi-Shinozaki, P. Carninci, J. Kawai, Y. Hayashizaki, K. Shinozaki, Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray, Plant J. 31 (2002) 279–292. [8] Y. Oono, M. Seki, T. Nanjo, M. Narusaka, M. Fujita, R. Satoh, M. Satou, T. Sakurai, J. Ishida, K. Akiyama, K. Iida, K. Maruyama, S. Satoh, K. Yamaguchi-Shinozaki, K. Shinozaki, Monitoring expression profiles of Arabidopsis gene expression during rehydration process after dehydration using ca 7000 full-length cDNA microarray, Plant J. 34 (2003) 868–887. [9] E.A. Bray, Genes commonly regulated by water-deficit stress in Arabidopsis thaliana, J. Exp. Bot. 55 (2004) 2331–2341. [10] H. Teran, S.P. Singh, Comparison of sources and lines selected for drought resistance in common bean, Crop Sci. 42 (2002) 217–233. [11] M. Ramirez, M.A. Graham, L. Blanco-Lopez, S. Silvente, A. MedranoSoto, M.W. Blair, G. Hernandez, C.P. Vance, M. Lara, Sequencing and analysis of common bean ESTs. Building a foundation for functional genomics, Plant Physiol. 137 (2005) 1211–1227. [12] J.M. Colmenero-Flores, F. Campos, A. Garciarubio, A.A. Covarrubias, Characterization of Phaseolus vulgaris cDNA clones responsive to water deficit: identification of a novel late embryogenesis abundant like protein, Plant Mol. Biol. 35 (1997) 393–405. [13] X. Qin, J.A.D. Zeevaart, The 9-cis–epoxycarotenoid cleavage reaction is the key regulatory step of abscissic acid biosynthesis in water-stressed bean, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 15354–15361. [14] V. Glisin, R. Crkvenjakov, C. Buys, Ribonucleic acid isolation by cesium chloride centrifugation, Biochemistry 13 (1974) 2633–2640. [15] P. Liang, A.B. Pardee, Differential display of eukaryotic messager RNA by means of the polymerase chain reaction, Science 257 (1992) 967–997. [16] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory Press, 1989. [17] S.F. Altschul, T.L. Madden, A.A. Scha¨ffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucl. Acids Res. 25 (1997) 3389–3402. [18] H. Roy-Macauley, Y. Zuily-Fodil, M. Kidric, A.T. Pham-Thi, J. Viera da Silva, Effect of drought stress on proteolytic activities in Phaseolus and Vigna leaves from sensitive and resistant plants, Plant Physiol. 85 (1992) 90–96. [19] S. Iuchi, M. Kobayashi, T. Taji, M. Naramoto, M. Seki, T. Kato, S. Tabata, Y. Kakubari, K. Yamaguchi-Shinozaki, K. Shinozaki, Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis, Plant J. 27 (2001) 325–333. [20] L.P. Moreno-Fonseca, A.A. Covarrubias, Dowsnstream DNA sequences are required to modulate Pvlea18 gene expression in response to dehydration, Plant Mol. Biol. 45 (2001) 501–515. [21] H. Porta, P. Rueda-Benitez, F. Campos, J.M. Colmenero-Flores, J.M. Colorado, M.J. Carmona, A.A. Covarrubias, M. Rocha-Sosa, Analysis of lipoxygenase mRNA accumulation in the common bean (Phaseolus vulgaris L.), Plant Cell Physiol. 40 (1999) 850–858. [22] G.A. Torres, C. Lelandais-Briere, E. Besin, M.F. Jubier, O. Roche, C. Mazubert, F. Corre-Menguy, C. Hartmann, Characterization of the expression of Phaseolus vulgaris OCT1, a dehydration-responsive gene that
G.A.M. Torres et al. / Plant Science 171 (2006) 300–307
[23]
[24]
[25]
[26]
[27]
[28] [29]
encodes a new type of phloem transporter, Plant Mol. Biol. 51 (2003) 341– 349. A.R. Matos, A. d’Arcy-Lameta, M. Franca, Y. Zuily-Fodil, A.T. PhamThi, A patatin-like protein with galactolipase activity is induced by drought stress in Vigna unguiculata leaves, Biochem. Soc. Trans. 28 (2000) 779–781. H. El Maarouf, Y. Zuily-Fodil, M. Gareil, A. d’Arcy-Lametta, A.T. PhamThi, Enzymatic activity and gene expression under water stress of phospholipase D in two cultivars of Vigna unguiculata L., Plant Mol. Biol. 39 (1999) 1257–1265. T. Katagiri, S. Takahashi, K. Shinozaki, Involvement of a novel Arabidopsis phospholipase D, AtPLDdelta, in dehydration-inducible accumulation of phosphatidic acid in stress, Plant J. 26 (2001) 595–605. N. Vartanian, L. Marcotte, J. Giraudat, Drought Rhizogenesis in Arabidopsis thaliana (differential responses of hormonal mutants), Plant Physiol. 104 (1994) 761–767. J. Leymarie, C. Damerval, L. Marcotte, V. Combes, N. Vartanian, Twodimensional protein patterns of Arabidopsis wild-type and auxin insensitive mutants, axr1, axr2, reveal interactions between drought and hormonal responses, Plant Cell Physiol. 37 (1996) 966–975. S.T. Sadiqov, M. Akbulut, V. Ehmedov, Role of Ca2+ in drought stress signaling in wheat seedlings, Biochemistry (Mosc) 67 (2002) 491–497. Z.N. Oztur, V. Talame, M. Deyholos, C.B. Michalowski, D.W. Galbraith, N. Gozukirmizi, R. Tuberosa, H.J. Bohnert, Monitoring large-scale changes in transcript abundance in drought- and salt-stressed barley, Plant Mol. Biol. 48 (2002) 551–573.
307
[30] T. Mandel, A.J. Fleming, R. Kra¨henbu¨hl, C. Kuhlemeier, Definition of constitutive gene expression in plants: the translation initiation factor 4A gene as a model, Plant Mol. Biol. 29 (1995) 995–1004. [31] Q.B. Li, D. Haskell, C. Zhang, D.Y. Sung, C. Guy, Diurnal regulation of Hsp70s in leaf tissue, Plant J. 21 (2000) 373–378. [32] H. Zengyong, L. Legong, L. Sheng, Immunophilins and parvulins. Superfamily of peptidyl Polyl isomerases in Arabidopsis, Plant Physiol. 134 (2004) 1248–1267. [33] J. Zheng, J. Zhao, Y. Tao, J. Wang, Y. Liu, J. Fu, Y. Jin, P. Gao, J. Zhang, Y. Bai, G. Wang, Isolation and analysis of water stress induced genes in maize seedlings by subtractive PCR and cDNA macroarray, Plant Mol. Biol. 55 (2004) 807–823. [34] A. Yamaguchi, O. Hori, D.M. Stern, E. Hartmann, S. Ogawa, M. Tohyama, Stress-associated endoplasmic reticulum protein 1 (SERP1)/Ribosomeassociated membrane protein 4 (RAMP4) stabilizes membrane proteins during stress and facilitates subsequent glycosylation, J. Cell Biol. 147 (1999) 1195–1204. [35] Y. Chen, Y.K. Shin, D.C. Bassham, YKT6 is a core constituent of membrane fusion machineries at the arabidopsis trans-Golgi network, J. Mol. Biol. 350 (2005) 92–101. [36] Y. Wu, D.J. Cosgrove, Adaptation of roots to low water potentials by changes in cell wall extensibility and cell wall proteins, J. Exp. Bot. 51 (2000) 1543–1553. [37] E.B. Blancaflor, K.H. Hasenstein, Growth and microtubule orientation of Zea mays roots subjected to osmotic stress, Int. J. Plant Sci. 156 (1995) 774–783.