Identification of novel temperature-regulated genes in the human pathogen Cryptococcus neoformans using representational difference analysis

Research in Microbiology 159 (2008) 221e229 www.elsevier.com/locate/resmic

Identification of novel temperature-regulated genes in the human pathogen Cryptococcus neoformans using representational difference analysis Lı´via Kmetzsch Rosa e Silva a, Charley Christian Staats a, Letı´cia Silveira Goulart a, Luis Gustavo Morello b, Maria Helena Pelegrinelli Fungaro b, Augusto Schrank a, Marilene H. Vainstein a,* a

Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Gonc¸alves 9500, 43421, Caixa Postal 15005, Porto Alegre, RS 91501-970, Brazil b Centro de Cieˆncias Biolo´gicas, Universidade Estadual de Londrina, Rodovia Celso Garcia Cid, Campus Universita´rio, Caixa Postal 6001, Londrina, PR 86051-990, Brazil Received 27 August 2007; accepted 15 December 2007 Available online 3 January 2008

Abstract Cryptococcus neoformans is a basidiomycetous fungus and an opportunistic human pathogen that causes infections in both immunocompromised and immunocompetent hosts. The ability to survive and proliferate at the human body temperature is an essential virulence attribute of this microorganism. Representational difference analysis (RDA) was used to profile gene expression in C. neoformans grown at 37  C or 25  C. Contig assembly of 300 high-quality sequenced cDNAs and comparison analysis to the GenBank database led to the identification of transcripts that may be critical for both pathogen-host interactions and responses to either low or high temperature growth. Gene products involved in cell wall integrity, stress response, filamentation, oxidative metabolism, protein targeting and fatty acids metabolism were induced at 37  C. In addition, genes related to chromatin silencing and phospholipid transport were upregulated at 25  C. Therefore, our RDA analysis, comparing saprophytic and host temperature conditions, revealed new genes with potential involvement in C. neoformans virulence. Ó 2008 Elsevier Masson SAS. All rights reserved. Keywords: Cryptococcus neoformans; RDA (representational difference analysis); High temperature growth; Virulence

1. Introduction Cryptococcus neoformans is an encapsulated basidiomycetous fungus that has been recognized as a human pathogen for more than a century [5]. The C. neoformans species complex comprises yeasts causing life-threatening diseases of the central nervous system, lungs and skin in humans and animals. C. neoformans var. grubii (serotype A) and C. neoformans var. * Corresponding author. Tel.: þ55 51 3308 6060; fax: þ55 51 3308 7309. E-mail addresses: [email protected] (L.K. Rosa e Silva), staats@cbiot. ufrgs.br (C.C. Staats), [email protected] (L.S. Goulart), lgmorello@ yahoo.com.br (L.G. Morello), [email protected] (M.H. Pelegrinelli Fungaro), [email protected] (A. Schrank), [email protected] (M.H. Vainstein). 0923-2508/$ - see front matter Ó 2008 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2007.12.006

neoformans (serotype D) have been isolated worldwide, typically causing disease in immunocompromised patients. C. neoformans var. gattii (serotypes B and C), recently raised to species level as Cryptococcus gattii [17], is the most frequent cause of infection in healthy hosts. C. gattii had been considered restricted to tropical and subtropical climates [31]. However, a recent outbreak of C. gattii infection in the temperate climate of Vancouver Island, Canada, was reported [12]. Thus far, C. neoformans and C. gattii well-characterized virulence factors include: (i) the ability to synthesize the antioxidant pigment melanin; (ii) the production of an antiphagocytic polysaccharide capsule; and (iii) the ability to survive and proliferate at 37  C [5]. The fungi kingdom comprises over 20,000 different species, but less than two dozen

222

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

consistently cause human disease. The ability of fungi to grow well at mammalian body temperature is a key feature of invasive human fungal pathogens. Pathogenic fungi have developed the molecular tools required to survive at the host body temperature, while the non-pathogenic fungi rarely possess this innate ability. To date, at least 38 Cryptococcus species have been described, but only C. neoformans and C. gattii grow at human body temperatures and are considered pathogens [5,26]. Many genes associated with growth at high temperature have been identified in C. neoformans species complex. The disruption of these genes results in either attenuation or complete loss of virulence in mammalian models of cryptococcosis (reviewed in refs. [26,27]). The genome sequence of two C. neoformans strains (JEC21 and B3501-A) are complete [22]. The increasing availability of entire genome sequences has resulted in the proliferation of large-scale techniques for studying gene function. Also, DNA microarray and serial analysis of gene expression (SAGE) have been used to identify C. neoformans genes that are preferentially transcribed under conditions of high temperature growth [15,32]. In this study, our goal was to identify novel temperatureregulated genes of C. neoformans, which may be important for pathogen-host interactions and virulence. Representational difference analysis (RDA) was used to profile gene expression in C. neoformans grown at 37  C or 25  C. Our experiments showed the feasibility of RDA to examine the transcriptome of C. neoformans as a function of temperature. We identified several C. neoformans genes that displayed differential expression during growth at 37  C. The products of these genes are involved in distinct biological processes, such as cell wall integrity, stress response and oxidative metabolism. Furthermore, we have also identified genes related to chromatin silencing and phospholipids transport that appear to be upregulated at 25  C. Our findings provide new insights into the molecular determinants of C. neoformans ability to grow at host temperature. 2. Materials and methods 2.1. Strain and culture conditions C. neoformans var. grubii HC6 strain (clinical sample) was utilized for RDA experiments and gene expression analysis. C. neoformans var. neoformans A45 strain (environmental sample) and C. gattii AL33 (clinical sample) were utilized for RT-PCR experiments [6]. For constructions of RDA libraries, the fungus was grown at either 25  C or 37  C for 18 h on yeast-peptone-dextrose medium (YPD) with continuous shaking. Cells were harvested by centrifugation and immediately frozen in liquid nitrogen prior to RNA extraction. 2.2. RNA isolation and cDNA synthesis Total RNA was isolated and cDNA was prepared using the RNeasy minikit (Qiagen) and SMART PCR synthesis kit (Clontech Laboratories), respectively, according to manufacturer’s

instructions. First-strand cDNA synthesis was performed with reverse transcriptase (RT M-MLV, Invitrogen) from 500 ng of RNA. An aliquot of 5 ml of first-strand cDNA was used as template for second-strand synthesis. 2.3. RDA RDA was performed according to a modification of the protocol previously described by Dutra et al. [9]. Briefly, for the forward library, cDNAs from C. neoformans grown at 37  C were used as tester and cDNAs from C. neoformans grown at 25  C as driver. In a reverse library, cDNAs from C. neoformans grown at 25  C were used as tester and cDNAs from C. neoformans grown at 37  C as driver. A doublestranded cDNA sample of each condition was digested with Sau3AI (Amersham Biosciences) and the resulting products were purified using GFX PCR DNA and the gel band purification kit (Amersham Biosciences). RBam24/12 adapters were ligated to the digested cDNA to be used as tester. The first differential product (DP1) was obtained with a step of hybridization (20 h at 67  C) of driver and cDNAs mixed at a 10:1 ratio, followed by PCR amplification with a RBam24 primer. To generate the second (DP2) and third (DP3) differential products, NBam and JBam adapters were ligated to the tester in each round of subtractive hybridization, and the driver/tester ratio was raised to 100:1 and 1000:1, respectively. Oligonucleotides for RDA are listed in Table 1. 2.4. Cloning and sequence analysis of the RDA products The final RDA products (DP3) were blunted with a Klenow fragment of DNA polymerase I (Invitrogen) and phosphorylated with T4 polynucleotide kinase (Invitrogen). The fragments were ligated to an SmaI-digested and dephosphorylated pUC18 vector. Escherichia coli XL1-Blue competent cells were transformed with the ligation products, and plasmid DNA was prepared from selected clones. Cloned inserts were sequenced with the Dyenamic ET Dye Terminator cycle sequencing kit for the Megabace DNA analysis system (GE). Sequence quality was analyzed and the contig assembly was performed using the Staden Package Software. The resulting sequences were compared to the GenBank database using the BLASTX algorithm at the National Center for Biotechnology Information (NCBI). Sequences returning matches with an E-value 10 were annotated and classified based on their putative molecular function and/or biological process using the Gene Ontology classification system. Searches for wellconserved functional motifs were performed in the NCBI conserved domain database. 2.5. Gene expression analysis For northern blot analysis, total RNA (10 mg) was electrophoresed in 1.2% agarose-formaldehyde gels and blotted to nylon membranes (Hybond Nþ, Amersham Biosciences). The blots were hybridized with [32P]-dCTP-labeled cDNA clones as described [30]. For a loading control, membranes

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

223

Table 1 List of primers used in this study Name

Sequence (50 -30 )

Purpose

RBam24 RBam12 NBam24 NBam12 JBam24 JBam12 ACTF ACTR GLOF GLOR DYGF DYGR CATF CATR RUMF RUMR PI3KF PI3KR RT_CATF RT_CATR RT_CARCF RT_CARCR RT_CONJF RT_CONFR RT_DYGF RT_DYGR RT_GLOF RT_GLOR RT_ACTF RT_ACTR RT_HP04300F RT_HP04300R RT_HP42134F RT_HP42134R

AGCACTCTCCAGCCTCTCTCACCGAC GATCCTCGGTGA AGGCAACTGTGCTATCCGAGGGAG GATCCTCCCTCG ACCGACGTCGACTATCCATGAACG GATCCGTTCATG CCTTCTACGTCTCTATCCAG TTTCAAGCTGAGAAGACTGG CAGTATGTCGGACTGTCTGGCG CCAAGTCAGATCGACATCGGG TTGACGCCTACAAATACTCGGG GGATACCTTCAACAGGACCGG CGAACACTTCTACATCTTCCGG GTCACGAAAATAGCTATGGGG CATTTCTCTCAAGCACTTCCCC GAAAGTTGAGTTTGGCCCGGG CTCGCGCTTAAAATGTCAGCCC GGGTGAATTACAGGCTGGGG GTCATCAGCAGAATCCGA CCAGGGCAGTCATCAAAA CCTCCTTCCCACCACAACTC CACCAGCCAGCATCAACTC GAACTATGCTCGTCTCTTT AATACAGGTGATGGGTGG GCCGCTAATGTTTTCATCTG CTTGCCGTTCTCATCCTTG CCCTAATGCGGACTATGTGG CCTTGTGGTGTCGGCTTTAC CCTTGCTCCTTCTTCTAT CTCGTCGTATTCGCTCTT CAACCAGCAGAGAAACCG TGAAGGGGACCAGATAGCG CAGGCGATTAGGGAGAATGG TTGGGGTCAACGAACTTGG

First round RDA primer/adapter First round RDA adapter Second round RDA primer/adapter Second round RDA adapter Third round RDA primer/adapter Third round RDA adapter Amplification of a 320 bp fragment from the C. neoformans actin gene RT-PCR primer pair for amplification of glyoxal oxidase transcript RT-PCR primer pair for amplification of diacylglycerol cholinephosphotransferase transcript RT-PCR primer pair for amplification of calcium ion transporter transcript RT-PCR primer pair for amplification of RUM1 transcript

were hybridized with an ACT1 probe from the C. neoformans actin gene. For RT-PCR analysis, first-strand cDNA synthesis was performed with reverse transcriptase (RT M-MLV, Invitrogen) according to the manufacturer’s protocol. PCRs were accessed with 2 ml of the RT reaction with GoTaq DNA polymerase (Promega) in a final volume of 25 ml. The reaction was performed by initially heating the samples for 5 min at 95  C followed by 20 cycles of 95  C for 30 s, 54  C for 30 s and 72  C for 60 s. PCR products were resolved through electrophoresis in 1.0% agarose gel. The analysis of relative differences was performed with Image J 1.38x software (http://rsb.info.nih.gov/ij/). Oligonucleotides for RT-PCR are listed in Table 1. Real-time PCR reactions were performed in a PTC 200 DNA engine cycler using a Chromo4 detection system (MJ Research). PCR thermal cycling conditions were as follows: an initial step at 95  C for 5 min and 40 cycles at 95  C for 15 s, 50  C for 30 s and 72  C for 20 s. Platinum SYBR green qPCR Supermix (Invitrogen) was used as reaction mixture, adding 10 pmol of each primer and 2 ml of template cDNA at a final volume of 25 ml. All experiments were done with two independent cultures and each cDNA sample was

RT-PCR primer pair for amplification of phosphatidylinositol 3-kinase transcript Quantitative real-time RT-PCR primer pair for amplification of calcium ion transporter transcript Quantitative real-time RT-PCR primer pair for amplification of carnitine acyl/carnitine carrier transcript Quantitative real-time RT-PCR primer pair for amplification of conjugation with cellular fusion related protein transcript Quantitative real-time RT-PCR primer pair for amplification of diacylglycerol cholinephosphotransferase transcript Quantitative real-time RT-PCR primer pair for amplification of glyoxal oxidase transcript Quantitative real-time RT-PCR primer pair for amplification of actin transcript Quantitative real-time RT-PCR primer pair for amplification of hypothetical protein CNL04300 transcript Quantitative real-time RT-PCR primer pair for amplification of hypothetical protein AAW42134 transcript

analyzed in duplicate with each primer pair. Melting curve analysis was performed at the end of the reaction to confirm a single PCR product. The data were normalized to actin and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNAs amplified in each set of PCR experiments. Relative expression data was obtained using the 2DDCT method [21]. The oligonucleotides utilized in this experiment are listed in Table 1.

3. Results In order to identify sequences that are preferentially expressed in C. neoformans var. grubii grown at 25  C or 37  C, we constructed subtracted libraries using the RDA approach. Three sequential subtractive reactions were carried out for each library, using different driver/tester ratios. The cDNA products were electrophoresed to confirm that size distributions of the amplified fragments were adequate for subsequent analyses (Fig. 1). DNA fragments of cDNA pools obtained in the third RDA round (from both libraries) were predominantly detected around a length of 400 bp. Approximately 400 independent clones (200 clones from each library)

224

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

Fig. 1. RDA products analyzed by gel electrophoresis. (A) C. neoformans var. grubii grown at 37  C was utilized as tester condition. Lane M, molecular marker (numbers on the left indicate size in bp); Lane 1, total cDNA of tester condition; lane 2, products of the first RDA round (driver/tester ratio 10:1); lane 3, products of the second RDA round (driver/tester ratio 100:1); lane 4, products of the third RDA round (driver/tester ratio 1000:1). (B) C. neoformans grown at 25  C was utilized as tester condition. Lane M, molecular marker; lane 1, products of the first RDA round (driver/tester ratio 10:1); lane 2, products of the second RDA round (driver/tester ratio 100:1); lane 3, products of the third RDA round (driver/tester ratio 1000:1).

were sequenced, and after Staden analysis, 300 high-quality sequenced cDNAs were compared to the GenBank database. The results of computational homology search for cDNAs obtained from C. neoformans grown at 37  C are shown in Table 2. EST alignment resulted in a total of 137 assembled sequences, comprehending both contiguous sequences (13 contigs, grouping 122 sequences) and 15 singlets. The putative gene products listed in Table 2 have been related to many different biological processes, such as cell wall integrity (chitin synthase 2), stress response (Rds1), cell cycle (cyclin hcs26), sporulation (endopeptidase), oxidative metabolism (glyoxal oxidase precursor; laccase precursor), protein targeting (phosphoadidylinositol 3-kinase) and fatty acid metabolism (carnitine carrier). In an attempt to define potential functions for the gene products classified as hypothetical/ conserved hypothetical or with no obvious role in biological processes (unknown function), we also performed searches in the NCBI conserved domain database to reveal the presence of well-conserved functional motifs. We found conserved domains related to transcription factors in two sequences identified in this library. RUM1 (GenBank accession number AAN75172) contains a JmjN domain found in the jumonji family of transcription factors, and a DNA binding BRIGHT ARID domain containing a helix turn helix structure. A conserved hypothetical protein (GenBank accession number AAW45588) possesses a conserved domain from the SART1 family. This family of proteins appears to contain a leucine zipper and therefore may represent a family of transcription factors. Furthermore, one hypothetical protein (GenBank accession number CNL04300), possibly involved in stress response and ubiquitination, possesses a UFD2 domain (ubiquitin fusion degradation protein 2) which is related to chaperones and posttranslational modification. The assembly of the ESTs found to be upregulated in C. neoformans grown at 25  C resulted in 163 total joined

sequences divided into 12 contigs (grouping 160 sequences) and 3 singlets, as shown in Table 3. The gene products identified are involved in a variety of biological processes, including chromatin silencing (protein-lysine N-methyltransferase), phospholipid transport (phospholipid transporter), protein folding (DNAj) and cell cycle (MMS2) and cellular protein metabolism (proliferation-associated serine/threonine protein kinase). As this study represents the first application of RDA in C. neoformans, we validated the results by three independent methods. To examine the expression of genes identified as upregulated by the RDA, we performed RT-PCR analysis of some genes potentially involved in virulence. Upregulation during growth at 37  C revealed by RDA was confirmed for all five genes by RT-PCR (namely calcium ion transporter, diacylglycerol cholinephosphotransferase, glyoxal oxidase precursor, RUM1 and phosphatidylinositol 3-kinase) (Fig. 2A). Northern blot analysis was also carried out for the glyoxal oxidase precursor, corroborating RDA and RT-PCR data (Fig. 2C). C. neoformans actin gene was utilized as loading control for northern blot and RT-PCR in all experiments. Furthermore, to gain information on temperature-regulated genes in C. gattii and C. neoformans var. neoformans, we selected three genes (calcium ion transporter, diacylglycerol cholinephosphotransferase and glyoxal oxidase precursor) and compared their expression at 25  C or 37  C (Fig. 2B). As observed in C. neoformans var. grubii, these three genes are temperature-regulated in C. gattii. However, we found that in C. neoformans var. neoformans, only the glyoxal oxidase precursor appeared to be upregulated at 37  C. Upregulation of the calcium ion transporter, diacylglycerol cholinephosphotransferase and glyoxal oxidase precursor was also confirmed during C. neoformans growth at 37  C by quantitative realtime RT-PCR, in agreement with RDA and RT-PCR data (Fig. 3). We observed minor differences in real time RT-PCR data normalization using either actin or GAPDH as reference genes, as well as in expression of the glyoxal oxidase precursor among the three methods tested. Quantitative real time RT-PCR was also done for three more transcripts: carnitine acyl/ carnitine carrier, hypothetical protein CNL04300 and conjugation with cellular fusion-related protein (Fig. 3). All three are upregulated in C. neoformans grown at 37  C. 4. Discussion We applied RDA methodology to identifying genes with differential expression during growth at 25  C or 37  C in the human pathogen C. neoformans. This technique was successfully employed for gene expression profiling in other fungi, such as Metarhizium anisopliae [9], Lentinula edodes [23] and Paracoccidioides brasiliensis [1,2]. This method was chosen because of its low rate of false-positives, speed and ease of operation and sensitivity in detecting rare messages [25]. Concerning C. neoformans and C. gattii, this methodology represents an alternative approach to identifying novel temperature-regulated genes which may be essential for pathogen-host interactions and virulence. The genes thus far

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

225

Table 2 Summary of computational analysisa of genes obtained from C. neoformans var. grubii growth at 37  C Annotation

E valueb

Accession number (GenBank)c

Frequency (number of clones)d

Putative molecular function and/or biological processe

Alpha-amylase precursor, putative Alpha-amylase AmyA, putative Ammonium transporter MEP1 BSP2 Calcium ion transporter, putative Carnitine/acyl carnitine carrier, putative Chitin synthase 2, CHS2 Co-chaperone, putative Conjugation with cellular fusion-related protein Conserved hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Conserved hypothetical protein Diacylglycerol cholinephosphotransferase Endopeptidase, putative Glyoxal oxidase precursor, putative G1/s-specific cyclin pcl1 (cyclin hcs26), putative Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein CNBH2810 Hypothetical protein CNE05340 Hypothetical protein CNL04300

1E-59 3E-22 2E-23 8E-16 5E-37 6E-72 2E-49 7E-49 7E-32 2E-20 6E-27 5E-36 1E-12 4E-48 2E-53 3E-68 1E-08 1E-50 1E-23 4E-23 1E-17 5E-66 3E-37 3E-18

AAW43607 AAW45221 AAW40795 AAV98462 AAW46295 AAW41174 AAW44688 AAW43300 AAW42889 AAW47028 AAW45588 AAW43213 AAW41010 AAW44309 AAW44235 AAW44259 CNG01990 AAW42134 AAW43641 EAL22234 AAW42564 EAL19182 CNE05340 CNL04300

1 2 1 1 2 1 3 1 1 19 2 1 7 1 11 26 11 10 1 1 1 1 1 18

Laccase precursor Phosphatidylinositol 3-kinase, putative Rds1 protein, putative RUM1 Small nuclear ribonucleoprotein

2E-13 6E-28 3E-48 3E-33 5E-16

AB184016 AAW41582 AAW46997 AAN75172 AAW45522

2 7 1 1 2

Hydrolase activity Hydrolase activity Ammonium transporter pseudohyphal growth Unknown Calcium ion homeostasis/calcium ion transport Fatty acid metabolism Cell wall integrity Protein folding Conjugation with cellular fusion Unknown Unknown Unknown Unknown Phosphatidylcholine biosynthesis Cellular response to starvation sporulation Oxidative metabolism Cell cycle Unknown Unknown Unknown Unknown Unknown Allantoate transporter activity Ubiquitin conjugating enzyme activity/response to stress Oxidative metabolism Protein targeting to vacuole Stress response Unknown Spliceosome assembly

a Sequence quality was analyzed and contig assembly was performed using Staden Package Software. Resulting sequences were compared to the GenBank database using the BLASTX program. b E value according to information from BLASTX searches of non-redundant database at NCBI. c Accession number of gene products in the GenBank database. d Frequency represents the number of clones found in a total of 137 high quality sequenced cDNA clones. e Putative molecular function and/or biological process according to the Gene Ontology classification system.

identified by SAGE and DNA microarray [15,32] provided the initial steps in understanding genetic controls for hightemperature growth, which are predicted to include over 100 genes [27]. Our main focus was on identifying fundamental genes involved in growth at 37  C, a crucial virulence attribute of the C. neoformans species complex. Mechanisms of sensing and adaptation to low oxygen were studied in C. neoformans in order to understand how this yeast can adapt to reduced oxygen levels in the human brain during infection. Expression of transcription factor Sre1p (required for low oxygen adaptation and infection) was induced in the presence of the hypoxia-mimicking agent cobalt chloride [7,18]. Microarray experiments were performed in an attempt to identify potential Sre1p target genes modulated by cobalt chloride. Two temperature-regulated transcripts identified in our study, glyoxal oxidase precursor and ammonium transporter MEP1, appear to be upregulated by Sre1p [18]. In the phytopathogenic fungus Ustilago maydis, the glyoxal oxidase gene ( glo1) is membrane-bound, produces H2O2 and is required for filamentous growth and pathogenicity. The

morphological phenotype of glo1 mutants suggests that cellwall-modifying activities might require H2O2 production, indicating a possible function of Glo1 in maturation of cell walls [20]. In C. neoformans, the glyoxal oxidase precursor gene might have a role in virulence, since it is upregulated under two distinct conditions that mimic infection: growth at 37  C and hypoxia. Additional studies are necessary for establishing a functional role for this gene in C. neoformans and C. gattii pathogenicity. Genes related to signaling pathways were also described in our RDA analysis. The C. albicans phosphatidylinositol 3 kinase orthologue Vps34 influences vesicular intracellular transport, filamentous growth and virulence [10,13,28]. Filamentation in C. neoformans enables the production of spores, which are thought to be the infectious particles [26]. The Caþ2/calmodulin-activated phosphatase calcineurin (CNA1) pathway regulates growth at mammalian body temperature [24]. Caþ2 signaling underlies diverse fungal physiological process, including cell cycle regulation, stress response and hyphal morphogenesis. Caþ2 permeable channels, pumps

226

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

Table 3 Summary of computational analysisa of genes obtained from C. neoformans var. grubii growth at 25  C Annotation

E valueb

Accession number (GenBank)c

Frequency (number of clones)d

Putative molecular function and/or biological processe

Carboxypeptidase C Chitin deacetylase-like mannoprotein MP98 Conserved hypothetical protein Conserved hypothetical protein DNAj protein Hypothetical protein CNBL2460 Hypothetical protein Hypothetical protein Hypothetical protein CNBC5160 MMS2 Phospholipid transporter Proliferation-associated serine/threonine protein kinase Protein-lysine N-methyltransferase, putative (R,R)-butanediol dehydrogenase WD repeat protein

2E-88 1E-77 1E-29 1E-115 3E-46 2E-49 6E-59 5E-19 2E-56 6E-97 2E-61 1E-51

AAW44329 AAW43254 AAW43875 AAW45770 AAW42161 EAL17732 AAW46923 AAW45360 EAL21814 AAW46047 AAW42935 AAW45972

30 22 18 8 3 3 7 4 1 32 13 1

1E-69 2E-59 3E-29

AAW46180 AAW46969 AAW42800

1 15 5

Vacuolar protein catabolism Chitin deacetylase activity Unknown Unknown Protein folding Unknown Unknown Unknown Unknown ER-associated protein catabolism/cell cycle Phospholipid transport Protein amino acid phosphorylation/cellular protein metabolism Chromatin silencing/histone methylation Glucose catabolism to butanediol Signal transduction

a Sequence quality was analyzed and contig assembly was performed using Staden package software. The resulting sequences were compared to the GenBank database using BLASTX program. b E value according to information from BLASTX searches of the non-redundant database at NCBI. c Accession number of gene products in the GenBank database. d Frequency represents the number of clones found among a total of 163 high quality sequenced cDNA clones. e Putative molecular function and/or biological process according to the Gene Ontology classification system.

and transporters are key regulators of Caþ2 signaling [16]. C. neoformans virulence was shown to be regulated by signal transduction pathways activated by calcium ions [11]. RDA also revealed genes involved in cell wall and membrane integrity regulated by temperature. The chitin synthase 2 gene (Chs2) is involved in fungal cell wall architecture, and in C. neoformans, eight putative chitin synthases were described. The deletion of any of the chitin synthase genes produces viable yeasts at 30  C [3,14]. The diacylglycerol cholinephosphotransferase gene, involved in phosphatidylcholine biosynthesis, appears to be upregulated at 37  C. This suggests that cell membranes may require remodeling for responses to high growth temperature. Recently, transcription factor MGA2 involved in fatty acid biosynthesis was found to be upregulated at 37  C [15]. Membrane remodeling via fatty acid biosynthesis and sterol metabolism is an important component of the regulatory mechanisms involved in stress response in C. neoformans [15]. Changes in membrane composition and fluidity are likely to occur during growth at either low or high temperature extremes [33]. Genes putatively involved in stress response were identified in our RDA experiments. Expression of the Rds1 gene is induced in response to heat stress in Schizosaccharomyces pombe, and its ortholog appears to be upregulated in microarray analysis of genes preferentially transcribed at 37  C in

C. neoformans [15]. Furthermore, we identified a hypothetical protein (GenBank accession number CNL04300) involved in stress response and ubiquitination. This pattern of expression was expected due to heat stress caused by growth at 37  C. We also identified the Rum1 gene which contains a JmjN domain found in the jumonji family of transcription factors, and a DNA binding BRIGHT ARID domain. Genetic screening for specific genes in C. neoformans mating-type locus showed that the Rum1 gene maps to the MAT locus, but has no obvious role in sexual development [19]. Rum1 was further characterized in U. maydis. It is a co-regulator of the retinoblastoma binding protein 2-like and functions by co-repressing genes regulated by the homeodomain transcription factors bE and bW that are involved in pathogenic development [29]. The identification of transcription factors and subsequent definition of their targets is essential for recognizing virulence pathways controlled by genes induced by host temperature growth. Changes in membrane composition are correlated with growth temperature. The pattern of transcription in C. neoformans grown at 25  C may reflect general features of temperature adaptation in this yeast. Transcripts that were upregulated at 25  C include the protein-lysine N-methyltransferase and phospholipid transporter. Methyltransferase activity is related to histone methylation and the chromatin silencing process. Low temperature growth may exert a general influence on

Fig. 2. Validation of RDA results by RT-PCR and northern blot analysis. (A) RT-PCR was carried out with specific primers from total RNA isolated from C. neoformans var. grubii growth at 37  C or 25  C. The same amounts of cDNA were used for all PCRs. Gene product names are written on the right side of the figure. (B) RT-PCR was carried out with specific primers from total RNA isolated from C. neoformans var. neoformans and C. gattii growth at 37  C or 25  C. The same amounts of cDNAs were used for all PCRs. Gene product names are written on the right side of figure. (C) Northern blot analysis for glyoxal oxidase precursor expression. Total RNA of C. neoformans var. grubii grown at 37  C or 25  C was loaded and hybridized with labeled glyoxal oxidase precursor gene probe (a), and actin gene probe (b). In (c), gel showing rRNA bands for measurement of RNA loading. Numbers associated with the bars indicate relative differences, which were established by densitometry analysis.

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

227

228

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

Fig. 3. Validation of RDA results by quantitative real time RT-PCR analysis. Relative expression of calcium ion transporter, diacylglycerol cholinephosphotransferase, glyoxal oxidase precursor, carnitine acyl/carnitine carrier, hypothetical protein CNL04300 and conjugation with cellular fusion-related protein, in C. neoformans var. grubii growth at 37  C. The measured quantity of the mRNA in each of the samples was normalized using the Ct values obtained for the actin gene (A) and the GAPDH gene (B) from C. neoformans. The values represent the number of times (relative fold change) that a selected gene is expressed in C. neoformans growth at 37  C compared to C. neoformans growth at 25  C. Gene product names are written on the right side of figure. Data are shown as mean  SD.

chromatin structure. Genes involved in sterol and lipid metabolisms are also upregulated. Cells adapt to a lower temperature by increasing the production of desaturase, resulting in unsaturated fatty acids in membrane phospholipids to maintain proper fluidity. This expression pattern is consistent with the data from SAGE analysis [32]. Recently, Kraus and colleagues [15] analyzed temperatureregulated transcription in C. neoformans using DNA microarray and described 49 genes induced at 37  C. In our study, we identified 29 genes that are upregulated at 37  C. We found a few similarities in our RDA-mediated transcriptional profiling and the microarray data reported. Among genes that are induced at 37  C, a chitin synthase and Rds1 were found in both studies. Also, a WD repeat protein involved in signal transductions pathways was found to be upregulated at 25  C in both analyses. We validated RDA analysis by three independent methods: semi-quantitative RT-PCR, Northern blot and quantitative real time RT-PCR. Minor differences observed in the expression profile among methods were probably due to intrinsic limitations of each technique. The choice of the reference gene for normalization is critical for the estimation and comparison of mRNA levels in gene expression studies [4]. Therefore, we utilized two different housekeeping genes (actin and GAPDH) to normalize our real time RT-PCR data (Fig. 3).

We observed that transcript levels for all genes tested were proportionally higher when GAPDH was the reference gene. Such differences in the expression profile were also described when using actin or GAPDH for real time RT-PCR normalization in other systems [4,8]. This argues that experimental results are highly dependent on the reference gene chosen, so discrepancies between the ratios observed in RT-PCR and qRT-PCR experiments are probably due to these boundaries. We also analyzed the expression pattern of three selected genes in C. neoformans var. neoformans and C. gattii and found differences. SAGE analysis of temperature-regulated transcriptomes of C. neoformans H99 strain (var. grubii) and C. neoformans B3501-A strain (var. neoformans) indicates that transcript levels of a large number of genes are influenced by growth temperature and display different responses in each variety [32]. There has been significant progress in identifying the many genes thought to be associated with high temperature growth in yeasts. Studies in Saccharomyces cerevisiae revealed over 70 genes and inactive mutants are unable to grow at 37  C. Therefore, it is reasonable to assume that the small number of temperature-regulated genes thus far identified in C. neoformans do not truly represent potential targets for inhibition of its development in the host [26]. Functional studies of genes

L.K. Rosa e Silva et al. / Research in Microbiology 159 (2008) 221e229

identified in our work by targeted gene disruption and utilization of animal models may validate their role in virulence and should contribute to a better understanding of C. neoformanse host interactions. Acknowledgements This work was supported by grants from the CNPq, CAPES and FAPERGS. Automated DNA sequencing was performed at the facilities of the Brazilian Genome Network at the Center of Biotechnology, CBiot-UFRGS-RS. The authors thank Dr. A. Zaha for critical reading of the manuscript. References [1] Bail~ao, A.M., Schrank, A., Borges, C.L., Dutra, V., Walquiria Ines Molinari-Madlum, E.E., Soares Felipe, M.S., et al. (2006) Differential gene expression by Paracoccidioides brasiliensis in host interaction conditions: representational difference analysis identifies candidate genes associated with fungal pathogenesis. Microbes and Infection 8, 2686e2697. [2] Bail~ao, A.M., Schrank, A., Borges, C.L., Parente, J.A., Dutra, V., Felipe, M.S., et al. (2007) The transcriptional profile of Paracoccidioides brasiliensis yeast cells is influenced by human plasma. FEMS Immunology and Medical Microbiology 51, 43e57. [3] Banks, I.R., Specht, C.A., Donlin, M.J., Gerik, K.J., Levitz, S.M., Lodge, J.K. (2005) A chitin synthase and its regulator protein are critical for chitosan production and growth of the fungal pathogen Cryptococcus neoformans. Eukaryotic Cell 11, 1902e1912. [4] Bas, A., Forsberg, G., Hammarstro¨m, S., Hammarstro¨m, M.L. (2004) Utility of the housekeeping genes 18S rRNA, b-actin and glyceraldehydes-3phosphate-dehydrogenase for normalization in real time quantitative reverse transcriptase chain reaction analysis of gene expression in human T lymphocytes. Scandinavian Journal of Immunology 59, 566e573. [5] Casadevall, A., Perfect, J.R. (1998) Cryptococcus neoformans. Washington: American Society for Microbiology Press. [6] Casali, A.K., Goulart, L., Rosa e Silva, L.K., Ribeiro, A.M., Amaral, A.A., Alves, S.H., et al. (2003) Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. FEMS Yeast Research 3, 405e415. [7] Chang, Y.C., Bien, C.M., Lee, H., Espenshade, P.J., Kwon-Chung, K.J. (2007) Sre1p, a regulator of oxygen sensing and sterol homeostasis, is required for virulence in Cryptococcus neoformans. Molecular Microbiology 64, 614e629. [8] Dheda, K., Huggett, J.F., Chang, J.S., Kim, L.U., Bustin, S.A., Johnson, M.A., et al. (2005) The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Analytical Biochemistry 344, 141e143. [9] Dutra, V., Nakazato, L., Broetto, L., Schrank, I.S., Vainstein, M.H., Schrank, A. (2004) Application of representational difference analysis to identify sequence tags expressed by Metarhizium anisopliae during the infection process of the tick Boophilus microplus cuticle. Research in Microbiology 155, 245e251. [10] Eck, R., Nguyen, M., Gunther, J., Kunkel, W., Zipfel, P.F. (2005) The phosphatidylinositol 3-kinase Vps34p of the human pathogenic yeast Candida albicans is a multifunctional protein that interacts with the putative vacuolar Hþ-ATPase subunit Vma7p. International Journal of Medical Microbiology 295, 57e66. [11] Idnurm, I., Bahn, Y., Nielsen, K., Xiaorong, L., Fraser, J.A., Heitman, J. (2005) Deciphering the model pathogenic fungus Cryptococcus neoformans. Nature Reviews Microbiology 3, 753e764. [12] Kidd, S.E., Hagen, F., Tscharke, R.L., Huynh, M., Bartlett, K.H., Fyfe, M., et al. (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proceedings of the National Academy of Sciences USA 101, 17258e17263.

229

[13] Kitanovic, A., Nguyen, M., Vogl, G., Hartmaan, A., Gunther, J., Wurzner, R., et al. (2005) Phosphatidylinositol 3-kinase VPS34 of Candida albicans is involved in filamentous growth, secretion of aspartic proteases, and intracellular detoxification. FEMS Yeast Research 5, 431e439. [14] Klutts, J.S., Yoneda, A., Reilly, M.C., Bose, I., Doering, T.L. (2006) Glycosyltransferases and their products: cryptococcal variations on fungal themes. FEMS Yeast Research 6, 499e512. [15] Kraus, P.R., Boily, M., Giles, S.S., Stajich, J.E., Allen, A., Cox, G.M., et al. (2004) Identification of Cryptococcus neoformans temperatureregulated genes with a Genomic-DNA microarray. Eucaryotic Cell 3, 1249e1260. [16] Kraus, P.R., Nichols, C.B., Heitman, J. (2005) Calcium and calcineurin independent roles for calmodulin in Cryptococcus neoformans morphogenesis and high temperature growth. Eucaryotic Cell 4, 1079e1087. [17] Kwon-Chung, K.J., Boekhout, T., Fell, J.W., Diaz, M. (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51, 804e806. [18] Lee, H., Bien, C.M., Hughes, A.L., Espenshade, P.J., Kwon-Chung, K.J., Chang, Y.C. (2007) Cobalt chloride, a hypoxia-mimicking agent, targets sterol synthesis in the pathogenic fungus Cryptococcus neoformans. Molecular Microbiology 65, 1018e1033. [19] Lengeler, K.B., Fox, D.S., Fraser, J.A., Allen, A., Forrester, K., Dietrich, F.S., et al. (2002) Mating-type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes. Eukaryotic Cell 1, 704e718. [20] Leuthner, B., Aichinger, C., Oehmen, E., Koopmann, E., Muller, O., Muller, P., et al. (2005) A H2O2 e producing glyoxal oxidase is required for filamentous growth and pathogenicity in Ustilago maydis. Molecular Genetics and Genomics 272, 639e650. [21] Livak, K.J., Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 25, 402e440. [22] Loftus, B.J., Fung, E., Roncaglia, P., Rowley, D., Amedeo, P., Bruno, D., et al. (2005) The genome of the basidiomycetous yeast human pathogen Cryptococcus neoformans. Science 307, 1321e1324. [23] Miyazaki, Y., Nakamura, M., Babasaki, K. (2005) Molecular cloning of developmentally specific genes by representational difference analysis during the fruiting body formation in the basidiomycete Lentinula edodes. Fungal Genetics and Biology 42, 493e505. [24] Odom, A., Muir, S., Lim, E., Toffaletti, D.L., Perfect, J.R., Heitman, J. (1997) Calcineurin is required for virulence of Cryptococcus neoformans. EMBO Journal 16, 2576e2589. [25] Pastorian, K., Hawel, L., Byus, C.V. (2000) Optimization of cDNA representational difference analysis for the identification of differentially expressed mRNAs. Analytical Biochemistry 283, 89e98. [26] Perfect, J.R. (2005) Cryptococcus neoformans: a sugar-coated killer with designer genes. FEMS Immunology and Medical Microbiology 45, 395e404. [27] Perfect, J.R. (2006) Cryptococcus neoformans: the yeast that likes it hot. FEMS Yeast Research 6, 463e468. [28] Poltermaan, S., Nguyen, M., Gunther, J., Wendland, J., Hartl, A., Kunkel, W., et al. (2005) The putative vacuolar ATPase subunit Vma7p of Candida albicans is involved in vacuole acidification, hyphal development and virulence. Microbiology 151, 1645e1655. [29] Quadbeck-Seeger, C., Wanner, G., Huber, S., Kahrmann, R., Kamper, J. (2000) A protein with similarity to the human retinoblastoma binding protein 2 acts specifically as a repressor for genes regulated by the b mating type locus in Ustilago maydis. Molecular Microbiology 38, 154e166. [30] Sambrook, J., Russel, D.W. (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory. [31] Sorrell, T.C. (2001) Cryptococcus neoformans var gattii. Medical Mycology 39, 155e168. [32] Steen, B.R., Lian, S., Zuyderduyn, D.L., MacDonald, W.K., Marra, M., Jones, S.J., et al. (2002) Temperature regulated transcription in the pathogenic fungus Cryptococcus neoformans. Genome Research 12, 1386e1400. [33] Steels, E.L., Learmonth, R.P., Watson, K. (1994) Stress tolerance and membrane lipid unsaturation in Saccharomyces cerevisiae grown aerobically or anaerobically. Microbiology 140, 569e576.