- Email: [email protected]
Identification of nuclear factor kappaB (NF-κB) binding motifs in Biomphalaria glabrata
Developmental and Comparative Immunology 53 (2015) 366e370
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Short communication
Identification of nuclear factor kappaB (NF-kB) binding motifs in Biomphalaria glabrata Judith Humphries*, Briana Harter Lawrence University, Appleton, WI 54911, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 July 2015 Received in revised form 5 August 2015 Accepted 6 August 2015 Available online 12 August 2015
Biomphalaria glabrata acts as the intermediate host to the parasite, Schistosoma mansoni, and for this reason, the immune system of B. glabrata has been researched extensively. Several studies have demonstrated that the transcriptome profile of B. glabrata changes following exposure to a variety of pathogens, yet very little is known regarding the regulation of gene expression in this species. Nuclear factor kappaB (NF-kB) homologues have recently been identified in B. glabrata but few functional studies have been carried out on this family of transcription factors. The aims of this study therefore were to identify NF-kB binding sites (kB motifs) in B. glabrata and examine them via functional assays. Two different kB motifs were predicted. Furthermore, the Rel homology domain (RHD) of a B. glabrata NF-kB was able to bind these kB motifs in EMSAs, as well as a vertebrate kB motif. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Biomphalaria glabrata NF-kB Electrophoretic mobility shift assays p38 MAPK IkB Innate immunity
1. Introduction The freshwater snail Biomphalaria glabrata acts as an intermediate host to the parasite Schistosoma mansoni, one of several species of trematode that cause the debilitating disease schistosomiasis in humans (Colley et al., 2014). Studies of the mechanisms by which this snail defends itself against pathogens have provided some understanding of B. glabrata's immune system (Yoshino and Coustau, 2011). At the cellular level, the snail's defense strategies include phagocytosis and cellular encapsulation of pathogens, while humoral factors include lectins, the production of oxygen radicals and a recently identified family of fibrinogen-related proteins (FREPs) (Yoshino and Coustau, 2011). These defense mechanisms likely involve changes in gene expression, and several studies show that the transcriptional profile of B. glabrata is modified in response to stressors such as gram-negative and gram-positive bacteria, mechanical wounding, and metazoan parasites (Adema et al., 2010; Hanelt et al., 2008; Hanington et al., 2010; Ittiprasert et al., 2010; Lockyer et al., 2012; Mitta et al., 2005; Zahoor et al., 2014). Despite ample evidence of altered gene expression during immune responses in B. glabrata, the regulatory mechanisms
* Corresponding author. E-mail address: [email protected] (J. Humphries). http://dx.doi.org/10.1016/j.dci.2015.08.004 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
responsible are not known. Transcription factors have only recently been identified in B. glabrata (Bouton et al., 2005; Kaur et al., 2015; Zhang and Coultas, 2011) and just one promoter region has ever been characterized (Yoshino et al., 1998). The regulation of gene expression is a complex process involving various proteineprotein and proteineDNA interactions, such as the binding of transcription factors to regulatory DNA sequences. One group of transcription factors shown to regulate gene expression in immune and inflammatory responses is the nuclear factor kappa B (NF-kB) family (Liang et al., 2004). NF-kB proteins make up a highly conserved and evolutionarily ancient family of transcription factors, with members having been identified in nearly all animal phyla ranging from prebilateria (sponges) to deuterostomes (mammals) (Gauthier and Degnan, 2008; Gilmore and Wolenski, 2012; Wang et al., 2006). An increasing number of invertebrate and specifically molluscan NF-kB homologues have been reported in recent years, with homologues in Crassostrea gigas, Euprymna scolopes, Haliotis diversicolor supertexta, Pinctada fucata and Chlamys farerri for example (Goodson et al., 2005; Jiang and Wu, 2007; Montagnani et al., 2004; Wang et al., 2011; Wu et al., 2007). In addition, two NF-kB homologues were recently discovered in B. glabrata and they show most similarity to p65 (RelA) and p105 NF-kB proteins (Zhang and Coultas, 2011). Typically p105 is cleaved to a shorter active form, p50, which is often found in a heterodimer with p65 (Gilmore, 2006). Following activation of an
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
NF-kB signaling pathway, the NF-kB dimer is released from IkB and translocates to the nucleus to regulate gene transcription. This regulation requires the recognition and binding of kappa-binding (kB) motifs in the regulatory regions upstream of particular genes by the Rel homology domains (RHD) of NF-kB dimers. Kappabinding motifs are somewhat conserved as evidenced by the identity between the insect consensus kB motif (GGGRNTYYYY) and the mammalian consensus kB motif (GGGRNNYYCC; R is a purine, Y is a pyrimidine and N is any base) (Gilmore, 2006; Kappler et al., 1993). Despite the discovery of several molluscan NF-kB homologues, kappa-binding motifs have so far been identified in only one molluscan species, C. gigas (Montagnani et al., 2007). Evidently, little is known regarding how molluscan NF-kB proteins function. Therefore, the aims of this study were to identify putative kappabinding motifs in representative B. glabrata genes and subsequently assess them in functional assays. 2. Materials and methods 2.1. Snail maintenance B. glabrata snails (BS90 and NMRI strains) were maintained in artificial pond water at 26 C with a 12:12 h lightedark cycle. They were fed romaine lettuce ad libitum and TetraMin® fish flakes, and cuttlefish bone was supplied as a slow release source of calcium.
367
motif, were synthesized (Midland Certified Reagent Company Inc.). In addition, a vertebrate consensus kB motif was synthesized for use in EMSAs. Oligonucleotide probes were labeled with biotin according to the manufacturer's instructions (Biotin 30 End DNA Labeling Kit, Pierce™, Rockford, IL, USA). Double-stranded biotinlabeled probes (20 fmoles) were each incubated with 0.25 mg BgRHD at room temperature for 20 min in binding buffer (10 mM Tris, 50 mM KCl, 1 mM DTT, pH 9) containing 1 mg polyI:C and glycerol at a final concentration of 5%. This was repeated with the addition of unlabeled probe at 200 fold excess (4 pmoles). Following the incubation, the reactions were run on a 6% nondenaturing polyacrylamide gel for 30 min, and were then transferred to a nylon membrane (type B positive; Fluka Analytical, St. Louis, MO, USA). Biotin-labeled probes were then detected using a Chemiluminescent Nucleic Acid Detection Module according to the manufacturers' instructions (ThermoScientific, Rockford, IL, USA). The results were visualized using a ChemiDoc-It2 510 Imager (Upland, CA, USA). The following reagents were provided by the NIAID Schistosomiasis Resource Center for distribution through BEI Resources, NIAID, NIH: B. glabrata, Strain NMRI (Unexposed to Schistosoma mansoni), NR-21970, Strain BS-90 (Unexposed to Schistosoma mansoni), NR-34791, Genomic DNA from B. glabrata, Strains BS-90, NMRI and BB02, NR-29375, NR-29377 and NR-29376, respectively. 3. Results
2.2. Identification of putative-kappa binding motifs 3.1. Identification of putative kappa-binding motifs The upstream regions of immune-related genes were surveyed for the presence of potential kappa-binding (kB) motifs. The genes subjected to this analysis were selected based on their putative roles in the immune system and included: inhibitor of NF-kB (IkB), superoxide dismutase allele b (SOD) and p38 mitogen activated protein kinase (MAPK) (Goodall et al., 2004; Hahn et al., 2001; Humphries and Yoshino, 2006, 2008). In order to acquire the upstream sequences, preliminary data from the B. glabrata genome project (http://129.24.144.93/blast_bg/2index.html) was searched via Basic Local Alignment Search Tool (BLAST) using the gene of interest's sequence. The resulting 50 sequences (~1000e1200 bp in length) were confirmed via PCR using specific primers (Midland Certified Reagent Company Inc., Midland, Texas, USA) and B. glabrata genomic DNA as a template. Genomic DNA from BS90, NMRI and BBO2 B. glabrata strains were used as templates. The strains were chosen based on either their resistance (BS90) or susceptibility (NMRI) to S. mansoni infection, or their use in the B. glabrata genome project (BBO2) (Adema et al., 2006). PCR products were sequenced at the DNA Analysis Facility on Science Hill at Yale University (New Haven, CT, USA), and the resulting DNA sequences were then submitted to TFSEARCH (Wingender et al., 1996) in order to identify potential transcription factor binding motifs. Any kB motifs predicted via this approach were used to design oligonucleotide probes for electrophoretic mobility shift assays (EMSAs). In addition, for each gene of interest, the upstream sequences acquired using the three different genomic templates were aligned and compared using Vector NTI® software (Life Technologies, Grand Island, NY, USA). 2.3. Electrophoretic mobility shift assays BgRHD, a 310 amino acid peptide, representing the Rel homology domain (RHD) of B. glabrata p65 NF-kB, (amino acids 83e392; NCBI Accession No. ACZ25559.1) was expressed in Escherichia coli using the vector pET-32a (GenScript, Piscataway, NJ, USA). Oligonucleotide probes containing the 10 bp kB motifs predicted upstream of B. glabrata genes, as well as the 10 bp 50 and 30 of the kB
The upstream regions of the genes encoding IkB, p38 MAPK and SOD were amplified via PCR, and surveyed for transcription factor binding motifs using TFSEARCH. Consequently, kB motifs were predicted upstream of IkB (GGGCCTTTCC) and p38 MAPK (CGGATTTTCC), beginning at positions 1050 and 263 upstream of the start codon, respectively (see supplementary data). The latter 5 nucleotides of the two kB motifs were identical, but 3 out of 5 nucleotides in the first half of each motif differed. In contrast, a putative kB motif was not identified within the region amplified upstream of SOD. Furthermore, all these upstream regions were amplified using genomic DNA from three different B. glabrata strains: BS90, NMRI and BBO2. The resulting sequences were aligned for comparison but no differences were observed among them. 3.2. Electrophoretic mobility shifts assays EMSAs were carried out to examine the ability of BgRHD to recognize and bind the kB motifs predicted upstream of IkB and p38 MAPK. BgRHD bound to the biotin-labeled oligonucleotide probe containing the kB motif found upstream of IkB. Furthermore, this binding was reduced in the presence of 200-fold of the unlabeled equivalent probe (Fig. 1A). In contrast, binding of the previous labeled wild type (WT) probe by BgRHD was not inhibited by an unlabeled mutant probe (Table 1), supporting the notion that the interaction between BgRHD and the IkB probe is specific. Moreover, no binding was observed between BgRHD and the labeled mutant probe. When using the probe containing the kB motif located upstream of p38 MAPK, the EMSA results were identical to those reported for the IkB probe, likewise indicating a specific interaction between BgRHD and the kB motif upstream of p38 MAPK (Fig. 1B). In addition, EMSAs were carried out using BgRHD and a vertebrate consensus kB motif. Interestingly, the results demonstrated that BgRHD was also capable of binding the vertebrate kB probe, and this interaction could be reduced by the addition of unlabeled vertebrate probe, but not by an unlabeled mutant probe. However,
368
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
no binding was observed between a mutant vertebrate probe and BgRHD (Fig. 1C). 4. Discussion
Fig. 1. Electrophoretic Mobility Shift Assays. EMSAs were carried out in order to determine the DNA-binding ability of the recombinant BgRHD domain. The oligonucleotide probes used comprise the kappa-binding motifs predicted upstream of B. glabrata IkB (A) and p38 MAPK (B) genes, as well as a vertebrate consensus probe (C) (see Table 1). The BgRHD domain was incubated with either the biotin-labeled wild type (WT) probe (lane 2), or the labeled mutant probe (lane 6). The specificity of the BgRHD-WT probe interaction was assessed by the addition of either unlabeled WT or mutant probes (lanes 3 and 4, respectively) to the BgRHD and WT probe reaction. Lanes 1 and 6 contain the WT probe and mutant probe, respectively. The reactions were incubated at room temp for 20 min then separated on a 6% polyacrylamide gel. n ¼ 3.
Table 1 Table showing nucleotide probes used in Electrophoretic Mobility Shift Assays. B. glabrata wild type (WT) nucleotide probes comprise the kappa-binding motif (kB; bold letters) and the 10 nucleotides 50 and 3’ of the motif. Mutant probes were also generated by altering the first 5 nucleotides of the kB motif (italicized letters). The vertebrate wild type and mutant probes were generated based on commercially available probes. Probe
Nucleotide sequence
B. glabrata IkB WT B. glabrata IkB mutant B. glabrata 38 MAPK WT B. glabrata 38 MAPK mutant Vertebrate WT Vertebrate mutant
ggaaaacccagggcctttccaaatcgaggc ggaaaacccactcaatttccaaatcgaggc aaactgataccggattttccaatcacagga aaactgatacatccctttccaatcacagga agttgaggggactttcccaggc agttgagctcactttcccaggc
In recent years, several NF-kB homologues have been identified in mollusks, but only a few have been subjected to functional analysis. The majority of these functional studies have analyzed NFkB gene expression in response to pathogens or pathogen associated molecular patterns (PAMPs), and collectively, the findings suggest that molluscan NF-kB proteins may play a regulatory role in immune responses (Jiang and Wu, 2007; Wu et al., 2007; Zhang and Coultas, 2011). The DNA-binding ability of molluscan NF-kBs, a function fundamental to transcription factors, has been examined in only one previous study to our knowledge. Jiang and Wu (2007) demonstrated that the recombinant RHD domain from the mollusk, H. diversicolor supertexta, was capable of binding to a vertebrate consensus kB motif in EMSAs. Moreover, the genomic sequences recognized by NF-kB proteins, kB motifs, have previously been identified in only one mollusk, C. gigas, where three kB motifs were found upstream of a tissue inhibitor of metalloproteinase, Cg-TIMP (Montagnani et al., 2007). However, RHD recognition of the C. gigas kB motifs has not yet been reported. Here we report the first identification of kB motifs in the gastropod, B. glabrata, upstream of two immune-related genes, IkB and p38 MAPK. Furthermore, functional analyses demonstrated the recognition of these kB motifs by the BgRHD domain. Importantly, the lack of binding between the BgRHD and mutant probes in the EMSAs supports the specificity of these protein-DNA interactions. In addition, this is the first demonstration of the DNA-binding ability of BgRHD, and as a result supports the classification of B. glabrata p65 NF-kB as a functional NF-kB homologue and transcription factor. NF-kB activity is regulated by IkB, which retains the NF-kB dimer in the cytoplasm until dissociation of the complex is initiated by an upstream signaling pathway. An IkB homologue was previously discovered in B. glabrata (GenBank: EF127687.1), and a kB motif was identified upstream of this gene in the current study. This finding is not unexpected though, as in other studies, IkB has demonstrated to be a transcriptional target of NF-kB, as a negative feedback mechanism (Brown et al., 1993; De Martin et al., 1993). It is possible therefore that NF-kB self regulates in B. glabrata by increasing transcription of IkB following the nuclear translocation of NF-kB. A functional kB motif was also identified upstream of p38 MAPK, implicating NF-kB as a transcriptional regulator of p38 MAPK in B. glabrata. In contrast though, similar findings for other species are lacking in the published literature. Interestingly, we surveyed the upstream region of human p38 MAPK (available at http://www. ncbi.nlm.nih.gov) for the presence of kB motifs and indeed, one was predicted (GGAAAGCCTCA) within 1000 bp upstream of the coding region (unpublished). Therefore, it is possible that p38 MAPK expression is under NF-kB regulation in species other than B. glabrata, but documentation of this is lacking as the relevant studies have not been carried out or published. p38 MAPK is known to participate in signaling pathways associated with the immune and inflammatory responses of vertebrates as well as some invertebrates (Ashwell, 2006; Dong et al., 2002). Similarly, previous studies suggest p38 MAPK plays a role in immune responses in B. glabrata. To illustrate, p38 MAPK was demonstrated to play a role in hemocyte in vitro H2O2 production (Goodall et al., 2004; Humphries and Yoshino, 2008). This is of particular significance, as the production of H2O2 is considered an anti-schistosome defense mechanism, employed by some strains of B. glabrata (Hahn et al., 2001). In addition, p38 MAPK was activated in response to S. mansoni excretory-secretory products and laminarin, a b-1,3-glucan polymer commonly used to mimic fungal
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
pathogens (Humphries and Yoshino, 2006). The potential role of p38 MAPK in immune responses of B. glabrata, in conjunction with the identification of a functional kB motif upstream of this kinase, suggests that NF-kB may regulate immune responses in B. glabrata. Moreover, this proposition is further supported by a recent study in which B. glabrata snails were exposed to S. mansoni larvae, and following, transcript levels of p65 NF-kB (RelA) were found to significantly increase (Zhang and Coultas, 2011). Although kB motifs were located upstream of IkB and p38 MAPK in B. glabrata, none were predicted in the upstream region of the SOD b allele. In contrast, Rojo et al. (2004) identified and characterized a kB motif upstream of the human SOD1 gene. It is worth noting though, that the present study focused on a region approximately 1000 bp upstream of the coding region; therefore it is possible that kB motifs are present elsewhere, for example further upstream or within introns (Lenardo et al., 1987). Having demonstrated that the B. glabrata RHD domain could bind native kB motifs, it was of interest to determine whether the BgRHD could recognize and bind a kB motif from a species of a different phylum, belonging to Deuterostomia. A specific proteinDNA interaction was demonstrated between the BgRHD and a vertebrate kB motif in EMSAs. Likewise, a similar phenomenon has been reported for the mollusk, H. diversicolor supertexta as stated previously (Jiang and Wu, 2007). Moreover, an NF-kB from the cnidarian Nematostella bound a kB motif from a human major histocompatibility complex (MHC) gene, showing cross reactivity across a wide range of animal phylogeny (Wolenski et al., 2011). This study along with others, suggest that there is substantial cross reactivity between RHD domains and kB motifs over a wide range of animal phyla. The extent of cross reactivity may be explained by the sequence variations in kB motifs, which are considered more heterogeneous than the RHD domain of NF-kB proteins (Mrinal et al., 2011). In conclusion, the identification of kB motifs upstream of p38 MAPK and IkB implies that the expression of these genes may be regulated, at least in part, by NF-kB in B. glabrata. Furthermore, the findings of this study and others (Humphries and Yoshino, 2006, 2008; Zhang and Coultas, 2011) lead us to hypothesize that NF-kB plays a role in the immune system in B. glabrata, which has been proposed for other molluscs (Jiang and Wu, 2007; Wu et al., 2007). However, the severe lack of functional studies on molluscan NF-kB homologues in general, highlights the essential need for increased research in this area. Such studies would provide a deeper understanding of NF-kBs and their functional roles in mollusks, as well as of the evolution of this important family of transcription factors. Acknowledgments This research was funded by Lawrence University. I would like to thank Laura Deneckere, Luqiong Wang and Andrea Wilkinson for proofreading the manuscript. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2015.08.004. References Adema, C.M., Hanington, P.C., Lun, C.M., Rosenberg, G.H., Aragon, A.D., Stout, B.A., Richard, M.L.L., Gross, P.S., Loker, E.S., 2010. Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes). Mol. Immunol. 47 (4), 849e860. http://dx.doi.org/10.1016/ j.molimm.2009.10.019. Adema, C.M., Luo, M.-Z., Hanelt, B., Hertel, L.A., Marshall, J.J., Zhang, S.-M.,
369
DeJong, R.J., Kim, H.-R., Kudrna, D., Wing, R.W., Soderlund, C., Knight, M., Lewis, F.A., Caldeira, R.L., Jannotti-Passos, L.K., Carvalho, O.S., Loker, E.S., 2006. A bacterial artificial chromosome library for Biomphalaria glabrata, intermediate snail host of Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 101 (Suppl. 1), 167e177. Ashwell, J.D., 2006. The many paths to p38 mitogen-activated protein kinase activation in the immune system. Nat. Rev. Immunol. 6, 532e540. http://dx.doi.org/ 10.1038/nri1865. €l, C., RobinsonBouton, D., Escriva, H., de Mendonça, R.L., Glineur, C., Bertin, B., Noe Rechavi, M., de Groot, A., Cornette, J., Laudet, V., Pierce, R.J., 2005. A conserved retinoid X receptor (RXR) from the mollusk Biomphalaria glabrata transactivates transcription in the presence of retinoids. J. Mol. Endocrinol. 34 (2), 567e582. http://dx.doi.org/10.1677/jme.1.01766. Brown, K., Park, S., Kanno, T., Franzoso, G., Siebenlist, U., 1993. Mutual regulation of the transcriptional activator NF-kB and its inhibitor. IkB-a. Proc. Natl. Acad. Sci. U. S. A. 90, 2532e2536. Colley, D.C., Bustinduy, A.L., Secor, W.E., King, C.H., 2014. Human schistosomiasis. Lancet 383, 2253e2264. http://dx.doi.org/10.1016/S0140-6736(13)61949-2. De Martin, R., Vanhove, B., Cheng, Q., Hofer, E., Csizmadia, V., Winkler, H., Bach, F.H., 1993. Cytokine-inducible expression in endothelial cells of an IkBa-like gene is regulated by NFkB. EMBO J. 12 (7), 2773e2779. Dong, C., Davis, R.J., Flavell, R.A., 2002. MAP kinases in the immune response. Ann. Rev. Immunol. 20, 55e72. http://dx.doi.org/10.1146/ annurev.immunol.20.091301.131133. Gauthier, M., Degnan, B.M., 2008. The transcription factor NF-kappaB in the demosponge Amphimedon queenslandica: insights on the evolutionary origin of the Rel homology domain. Dev. Genes Evol. 218 (1), 23e32. http://dx.doi.org/ 10.1007/s00427-007-0197-5. Gilmore, T.D., 2006. Introduction to NF-kB players: players, pathways, perspectives. Oncogene 25, 6680e6684. Gilmore, T.D., Wolenski, F.S., 2012. NF-kB: where did it come from and why? Immunol. Rev. 246, 14e35. http://dx.doi.org/10.1111/j.1600-065X.2012.01096.x. Goodall, C.P., Bender, R.C., Broderick, E.J., Bayne, C.J., 2004. Constitutive differences in CU/Zn superoxide dismutase mRNA levels and activity in hemocytes of Biomphalaria glabrata (Mollusca) that are either susceptible or resistant to Schistosoma mansoni (Trematoda). Mol. Biochem. Parasitol. 137 (2), 321e328. Goodson, M.S., Kojadinovic, M., Troll, J.V., Scheetz, T.E., Casavant, T.L., Soares, M.B., McFall-Ngai, M.J., 2005. Identifying components of the NF-kB pathway in the beneficial Euprymna scolopes-Vibrio fischeri light organ symbiosis. Appl. Environ. Micro 71 (11), 6934e6946. http://dx.doi.org/10.1128/AEM.71.11.69346946.2005. Hahn, U.K., Bender, R.C., Bayne, C.J., 2001. Killing of Schistosoma mansoni sporocysts by hemocytes from resistant Biomphalaria glabrata: role of reactive oxygen species. J. Parasitol. 87 (2), 292e299 doi: http://dx.doi.org/10.1645/00223395(2001)087[0292:KOSMSB]2.0.CO;2. Hanelt, B., Lun, C.M., Adema, C.M., 2008. Comparative ORESTES-sampling of transcriptomes of immune-challenged Biomphalaria glabrata snails. J. Invertebr. Pathol. 99 (2), 192e203. http://dx.doi.org/10.1016/j.jip.2008.06.002. Hanington, P.C., Lun, C.M., Adema, C.M., Loker, E.S., 2010. Time series analysis of the transcriptional responses of Biomphalaria glabrata throughout the course of intramolluscan development of Schistosoma mansoni and Echinostoma paraensei. Int. J. Parasitol. 40 (7), 819e831. http://dx.doi.org/10.1016/ j.ijpara.2009.12.005. Humphries, J.E., Yoshino, T.P., 2006. Schistosoma mansoni excretory-secretory products stimulate a p38 signalling pathway in Biomphalaria glabrata embryonic cells. Int. J. Parasitol. 36, 37e46. http://dx.doi.org/10.1016/ j.ijpara.2005.08.009. Humphries, J.E., Yoshino, T.P., 2008. Regulation of hydrogen peroxide release in circulating hemocytes of the planorbid snail Biomphalaria glabrata. Dev. Comp. Immunol. 32 (5), 554e562. http://dx.doi.org/10.1016/j.dci.2007.09.001. Ittiprasert, W., Miller, A., Myers, J., Nene, V., El-Sayed, N.M., Knight, M., 2010. Identification of immediate response genes dominantly expressed in juvenile resistant and susceptible Biomphalaria glabrata snails upon exposure to Schistosoma mansoni. Mol. Biochem. Parasitol. 169 (1), 27e39. http://dx.doi.org/ 10.1016/j.molbiopara.2009.09.009. Jiang, Y., Wu, X., 2007. Characterization of a Rel\NF-kB homologue in a gastropod abalone, Haliotis diversicolor supertexta. Dev. Comp. Immunol. 31, 121e131. http://dx.doi.org/10.1016/j.dci.2006.05.014. Kappler, C., Meister, M., Lagueux, M., Gateff, E., Hoffmann, J.A., Reichhart, J.M., 1993. Insect immunity. Two 17 bp repeats nesting a kappa B-related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteriachallenged Drosophila. EMBO J. 12, 1561e1568. Kaur, S., Jobling, S., Jones, C.S., Noble, L.R., Routledge, E.J., Lockyer, A.E., 2015. The nuclear receptors of Biomphalaria glabrata and Lottia gigantea: implications for developing new model organisms. PLoS One 10 (4), e0121259. http://dx.doi.org/ 10.1371/journal.pone.0121259. Lenardo, M., Pierce, J.W., Baltimore, D., 1987. Protein-binding sites in Ig gene enhancers determine transcriptional activity and inducibility. Science 236, 1573e1577. http://dx.doi.org/10.1126/science.3109035. Liang, Y., Zhou, Y., Shen, P., 2004. NF-kB and its regulation on the immune system. Cell Mol. Immunol 1 (5), 343e350. Lockyer, A.E., Emery, A.M., Kane, R.A., Walker, A.J., Mayer, C.D., Mitta, G., Coustau, C., Adema, C.M., Hanelt, B., Rollinson, D., Noble, L.R., Jones, C.S., 2012. Early differential gene expression in haemocytes from resistant and susceptible Biomphalaria glabrata strains in response to Schistosoma mansoni. PLoS One 7 (12),
370
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
e51102. http://dx.doi.org/10.1371/journal.pone.0051102. Mrinal, N., Tomar, A., Nagaraju, J., 2011. Role of sequence encoded kB DNA geometry in gene regulation by Dorsal. Nucl. Acids Res. 39 (22), 1e18. http://dx.doi.org/ 10.1093/nar/gkr672. Mitta, G., Galinier, R., Tisseyre, P., Allienne, J.F., Girerd-Chambaz, Y., Guillou, F., Bouchut, A., Coustau, C., 2005. Gene discovery and expression analysis of immune-relevant genes from Biomphalaria glabrata hemocytes. Dev. Comp. Immunol. 29, 393e407. http://dx.doi.org/10.1016/j.dci.2004.10.002. Montagnani, C.K.C., Reichhart, J.M., Escoubas, J.M., 2004. Cg-Rel, the first Rel/NFkappaB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas. FEBS. Lett. 561 (1e3), 75e82. Montagnani, C., Avarre, J.C., de Lorgeril, J., Quiquand, M., Boulo, V., Escoubas, J.M., 2007. First evidence of the activation of Cg-timp, an immune response component of Pacific oysters, through a damage-associated molecular pattern pathway. Dev. Comp. Immunol. 31 (1), 1e11. http://dx.doi.org/10.1016/ j.dci.2006.04.002. Rojo, A.I., Salinas, M., Martín, D., Perona, R., Cuadrado, A., 2004. Regulation of Cu/Znsuperoxide dismutase expression via the phosphatidylinositol 3 kinase/Akt pathway and nuclear factor-kB. J. Neurosci. 24 (33), 7324e7334. http:// dx.doi.org/10.1523/jneurosci.2111-04.2004. Wang, X.W., Tan, N.S., Ho, B., Ding, J.L., 2006. Evidence for the ancient origin of the NF-kB/IkB cascade: its archaic role in pathogen infection and immunity. Proc. Natl. Acad. Sci. U. S. A. 103 (11), 4204e4209. http://dx.doi.org/10.1073/ pnas.0507044103. Wang, M., Yang, J., Zhou, Z., Qiu, L., Wang, L., Zhang, H., Gao, Y., Wang, X., Zhang, L., Zhao, J., Song, L., 2011. A primitive toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farerri. Dev. Comp. Immunol. 35 (4), 511e520. http://dx.doi.org/10.1016/j.dci.2010.12.005.
Wingender, E., Dietze, P., Karas, H., Knüppel, R., 1996. TRANSFAC: a database on transcription factors and their DNA binding sites. Nucl. Acids Res. 24 (1), 238e241. http://dx.doi.org/10.1093/nar/24.1.238. Wolenski, F.S., Garbati, M.R., Lubinski, T.J., Traylor-Knowles, N., Dresselhaus, E., Stefanik, D.J., Goucher, H., Finnerty, J.R., Gilmore, T.D., 2011. Characterization of the core elements of the NF-kB signaling pathway of the sea anemone Nematostella vectensis. Mol. Cell. Biol. 31 (5), 1076e1087. http://dx.doi.org/10.1128/ MCB.00927-10. Wu, X., Xiong, X., Xie, L., Zhang, R., 2007. Pf-Rel, a rel/nuclear factor-kB homolog identified from the pearl oyster, Pinctada fucata. Acta Biochim. Biophys. Sin. 39 (7), 533e539. http://dx.doi.org/10.1111/j.1745-7270.2007.00306.x. Yoshino, T.P., Coustau, C., 2011. Immunobiology of Biomphalaria glabrata-trematode interactions. In: Toledo, R., Fried, B. (Eds.), Biomphalaria glabrata snails and Larval Trematodes. Springer, New York, pp. 159e189. Yoshino, T.P., Wu, X.J., Liu, H.D., 1998. Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line. Am. J. Trop. Med. Hyg. 59 (3), 414e420. Zahoor, Z., Lockyer, A.E., Davies, A.J., Kirk, R.S., Emery, A.M., Rollinson, D., Jones, C.S., Noble, L.R., Walker, A.J., 2014. Differences in the gene expression profiles of haemocytes from schistosome-susceptible and -resistant Biomphalaria glabrata exposed to Schistosoma mansoni excretory-secretory products. PLoS One 9 (3), e93215. http://dx.doi.org/10.1371/journal. pone.0093215. Zhang, S.M., Coultas, K.A., 2011. Identification and characterization of five transcription factors that are associated with evolutionarily conserved immune signaling pathways in the schistosome-transmitting snail Biomphalaria glabrata. Mol. Immunol. 48 (15e16), 1868e1881. http://dx.doi.org/10.1016/ j.molimm.2011.05.017.
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Short communication
Identification of nuclear factor kappaB (NF-kB) binding motifs in Biomphalaria glabrata Judith Humphries*, Briana Harter Lawrence University, Appleton, WI 54911, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 July 2015 Received in revised form 5 August 2015 Accepted 6 August 2015 Available online 12 August 2015
Biomphalaria glabrata acts as the intermediate host to the parasite, Schistosoma mansoni, and for this reason, the immune system of B. glabrata has been researched extensively. Several studies have demonstrated that the transcriptome profile of B. glabrata changes following exposure to a variety of pathogens, yet very little is known regarding the regulation of gene expression in this species. Nuclear factor kappaB (NF-kB) homologues have recently been identified in B. glabrata but few functional studies have been carried out on this family of transcription factors. The aims of this study therefore were to identify NF-kB binding sites (kB motifs) in B. glabrata and examine them via functional assays. Two different kB motifs were predicted. Furthermore, the Rel homology domain (RHD) of a B. glabrata NF-kB was able to bind these kB motifs in EMSAs, as well as a vertebrate kB motif. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Biomphalaria glabrata NF-kB Electrophoretic mobility shift assays p38 MAPK IkB Innate immunity
1. Introduction The freshwater snail Biomphalaria glabrata acts as an intermediate host to the parasite Schistosoma mansoni, one of several species of trematode that cause the debilitating disease schistosomiasis in humans (Colley et al., 2014). Studies of the mechanisms by which this snail defends itself against pathogens have provided some understanding of B. glabrata's immune system (Yoshino and Coustau, 2011). At the cellular level, the snail's defense strategies include phagocytosis and cellular encapsulation of pathogens, while humoral factors include lectins, the production of oxygen radicals and a recently identified family of fibrinogen-related proteins (FREPs) (Yoshino and Coustau, 2011). These defense mechanisms likely involve changes in gene expression, and several studies show that the transcriptional profile of B. glabrata is modified in response to stressors such as gram-negative and gram-positive bacteria, mechanical wounding, and metazoan parasites (Adema et al., 2010; Hanelt et al., 2008; Hanington et al., 2010; Ittiprasert et al., 2010; Lockyer et al., 2012; Mitta et al., 2005; Zahoor et al., 2014). Despite ample evidence of altered gene expression during immune responses in B. glabrata, the regulatory mechanisms
* Corresponding author. E-mail address: [email protected] (J. Humphries). http://dx.doi.org/10.1016/j.dci.2015.08.004 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
responsible are not known. Transcription factors have only recently been identified in B. glabrata (Bouton et al., 2005; Kaur et al., 2015; Zhang and Coultas, 2011) and just one promoter region has ever been characterized (Yoshino et al., 1998). The regulation of gene expression is a complex process involving various proteineprotein and proteineDNA interactions, such as the binding of transcription factors to regulatory DNA sequences. One group of transcription factors shown to regulate gene expression in immune and inflammatory responses is the nuclear factor kappa B (NF-kB) family (Liang et al., 2004). NF-kB proteins make up a highly conserved and evolutionarily ancient family of transcription factors, with members having been identified in nearly all animal phyla ranging from prebilateria (sponges) to deuterostomes (mammals) (Gauthier and Degnan, 2008; Gilmore and Wolenski, 2012; Wang et al., 2006). An increasing number of invertebrate and specifically molluscan NF-kB homologues have been reported in recent years, with homologues in Crassostrea gigas, Euprymna scolopes, Haliotis diversicolor supertexta, Pinctada fucata and Chlamys farerri for example (Goodson et al., 2005; Jiang and Wu, 2007; Montagnani et al., 2004; Wang et al., 2011; Wu et al., 2007). In addition, two NF-kB homologues were recently discovered in B. glabrata and they show most similarity to p65 (RelA) and p105 NF-kB proteins (Zhang and Coultas, 2011). Typically p105 is cleaved to a shorter active form, p50, which is often found in a heterodimer with p65 (Gilmore, 2006). Following activation of an
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
NF-kB signaling pathway, the NF-kB dimer is released from IkB and translocates to the nucleus to regulate gene transcription. This regulation requires the recognition and binding of kappa-binding (kB) motifs in the regulatory regions upstream of particular genes by the Rel homology domains (RHD) of NF-kB dimers. Kappabinding motifs are somewhat conserved as evidenced by the identity between the insect consensus kB motif (GGGRNTYYYY) and the mammalian consensus kB motif (GGGRNNYYCC; R is a purine, Y is a pyrimidine and N is any base) (Gilmore, 2006; Kappler et al., 1993). Despite the discovery of several molluscan NF-kB homologues, kappa-binding motifs have so far been identified in only one molluscan species, C. gigas (Montagnani et al., 2007). Evidently, little is known regarding how molluscan NF-kB proteins function. Therefore, the aims of this study were to identify putative kappabinding motifs in representative B. glabrata genes and subsequently assess them in functional assays. 2. Materials and methods 2.1. Snail maintenance B. glabrata snails (BS90 and NMRI strains) were maintained in artificial pond water at 26 C with a 12:12 h lightedark cycle. They were fed romaine lettuce ad libitum and TetraMin® fish flakes, and cuttlefish bone was supplied as a slow release source of calcium.
367
motif, were synthesized (Midland Certified Reagent Company Inc.). In addition, a vertebrate consensus kB motif was synthesized for use in EMSAs. Oligonucleotide probes were labeled with biotin according to the manufacturer's instructions (Biotin 30 End DNA Labeling Kit, Pierce™, Rockford, IL, USA). Double-stranded biotinlabeled probes (20 fmoles) were each incubated with 0.25 mg BgRHD at room temperature for 20 min in binding buffer (10 mM Tris, 50 mM KCl, 1 mM DTT, pH 9) containing 1 mg polyI:C and glycerol at a final concentration of 5%. This was repeated with the addition of unlabeled probe at 200 fold excess (4 pmoles). Following the incubation, the reactions were run on a 6% nondenaturing polyacrylamide gel for 30 min, and were then transferred to a nylon membrane (type B positive; Fluka Analytical, St. Louis, MO, USA). Biotin-labeled probes were then detected using a Chemiluminescent Nucleic Acid Detection Module according to the manufacturers' instructions (ThermoScientific, Rockford, IL, USA). The results were visualized using a ChemiDoc-It2 510 Imager (Upland, CA, USA). The following reagents were provided by the NIAID Schistosomiasis Resource Center for distribution through BEI Resources, NIAID, NIH: B. glabrata, Strain NMRI (Unexposed to Schistosoma mansoni), NR-21970, Strain BS-90 (Unexposed to Schistosoma mansoni), NR-34791, Genomic DNA from B. glabrata, Strains BS-90, NMRI and BB02, NR-29375, NR-29377 and NR-29376, respectively. 3. Results
2.2. Identification of putative-kappa binding motifs 3.1. Identification of putative kappa-binding motifs The upstream regions of immune-related genes were surveyed for the presence of potential kappa-binding (kB) motifs. The genes subjected to this analysis were selected based on their putative roles in the immune system and included: inhibitor of NF-kB (IkB), superoxide dismutase allele b (SOD) and p38 mitogen activated protein kinase (MAPK) (Goodall et al., 2004; Hahn et al., 2001; Humphries and Yoshino, 2006, 2008). In order to acquire the upstream sequences, preliminary data from the B. glabrata genome project (http://129.24.144.93/blast_bg/2index.html) was searched via Basic Local Alignment Search Tool (BLAST) using the gene of interest's sequence. The resulting 50 sequences (~1000e1200 bp in length) were confirmed via PCR using specific primers (Midland Certified Reagent Company Inc., Midland, Texas, USA) and B. glabrata genomic DNA as a template. Genomic DNA from BS90, NMRI and BBO2 B. glabrata strains were used as templates. The strains were chosen based on either their resistance (BS90) or susceptibility (NMRI) to S. mansoni infection, or their use in the B. glabrata genome project (BBO2) (Adema et al., 2006). PCR products were sequenced at the DNA Analysis Facility on Science Hill at Yale University (New Haven, CT, USA), and the resulting DNA sequences were then submitted to TFSEARCH (Wingender et al., 1996) in order to identify potential transcription factor binding motifs. Any kB motifs predicted via this approach were used to design oligonucleotide probes for electrophoretic mobility shift assays (EMSAs). In addition, for each gene of interest, the upstream sequences acquired using the three different genomic templates were aligned and compared using Vector NTI® software (Life Technologies, Grand Island, NY, USA). 2.3. Electrophoretic mobility shift assays BgRHD, a 310 amino acid peptide, representing the Rel homology domain (RHD) of B. glabrata p65 NF-kB, (amino acids 83e392; NCBI Accession No. ACZ25559.1) was expressed in Escherichia coli using the vector pET-32a (GenScript, Piscataway, NJ, USA). Oligonucleotide probes containing the 10 bp kB motifs predicted upstream of B. glabrata genes, as well as the 10 bp 50 and 30 of the kB
The upstream regions of the genes encoding IkB, p38 MAPK and SOD were amplified via PCR, and surveyed for transcription factor binding motifs using TFSEARCH. Consequently, kB motifs were predicted upstream of IkB (GGGCCTTTCC) and p38 MAPK (CGGATTTTCC), beginning at positions 1050 and 263 upstream of the start codon, respectively (see supplementary data). The latter 5 nucleotides of the two kB motifs were identical, but 3 out of 5 nucleotides in the first half of each motif differed. In contrast, a putative kB motif was not identified within the region amplified upstream of SOD. Furthermore, all these upstream regions were amplified using genomic DNA from three different B. glabrata strains: BS90, NMRI and BBO2. The resulting sequences were aligned for comparison but no differences were observed among them. 3.2. Electrophoretic mobility shifts assays EMSAs were carried out to examine the ability of BgRHD to recognize and bind the kB motifs predicted upstream of IkB and p38 MAPK. BgRHD bound to the biotin-labeled oligonucleotide probe containing the kB motif found upstream of IkB. Furthermore, this binding was reduced in the presence of 200-fold of the unlabeled equivalent probe (Fig. 1A). In contrast, binding of the previous labeled wild type (WT) probe by BgRHD was not inhibited by an unlabeled mutant probe (Table 1), supporting the notion that the interaction between BgRHD and the IkB probe is specific. Moreover, no binding was observed between BgRHD and the labeled mutant probe. When using the probe containing the kB motif located upstream of p38 MAPK, the EMSA results were identical to those reported for the IkB probe, likewise indicating a specific interaction between BgRHD and the kB motif upstream of p38 MAPK (Fig. 1B). In addition, EMSAs were carried out using BgRHD and a vertebrate consensus kB motif. Interestingly, the results demonstrated that BgRHD was also capable of binding the vertebrate kB probe, and this interaction could be reduced by the addition of unlabeled vertebrate probe, but not by an unlabeled mutant probe. However,
368
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
no binding was observed between a mutant vertebrate probe and BgRHD (Fig. 1C). 4. Discussion
Fig. 1. Electrophoretic Mobility Shift Assays. EMSAs were carried out in order to determine the DNA-binding ability of the recombinant BgRHD domain. The oligonucleotide probes used comprise the kappa-binding motifs predicted upstream of B. glabrata IkB (A) and p38 MAPK (B) genes, as well as a vertebrate consensus probe (C) (see Table 1). The BgRHD domain was incubated with either the biotin-labeled wild type (WT) probe (lane 2), or the labeled mutant probe (lane 6). The specificity of the BgRHD-WT probe interaction was assessed by the addition of either unlabeled WT or mutant probes (lanes 3 and 4, respectively) to the BgRHD and WT probe reaction. Lanes 1 and 6 contain the WT probe and mutant probe, respectively. The reactions were incubated at room temp for 20 min then separated on a 6% polyacrylamide gel. n ¼ 3.
Table 1 Table showing nucleotide probes used in Electrophoretic Mobility Shift Assays. B. glabrata wild type (WT) nucleotide probes comprise the kappa-binding motif (kB; bold letters) and the 10 nucleotides 50 and 3’ of the motif. Mutant probes were also generated by altering the first 5 nucleotides of the kB motif (italicized letters). The vertebrate wild type and mutant probes were generated based on commercially available probes. Probe
Nucleotide sequence
B. glabrata IkB WT B. glabrata IkB mutant B. glabrata 38 MAPK WT B. glabrata 38 MAPK mutant Vertebrate WT Vertebrate mutant
ggaaaacccagggcctttccaaatcgaggc ggaaaacccactcaatttccaaatcgaggc aaactgataccggattttccaatcacagga aaactgatacatccctttccaatcacagga agttgaggggactttcccaggc agttgagctcactttcccaggc
In recent years, several NF-kB homologues have been identified in mollusks, but only a few have been subjected to functional analysis. The majority of these functional studies have analyzed NFkB gene expression in response to pathogens or pathogen associated molecular patterns (PAMPs), and collectively, the findings suggest that molluscan NF-kB proteins may play a regulatory role in immune responses (Jiang and Wu, 2007; Wu et al., 2007; Zhang and Coultas, 2011). The DNA-binding ability of molluscan NF-kBs, a function fundamental to transcription factors, has been examined in only one previous study to our knowledge. Jiang and Wu (2007) demonstrated that the recombinant RHD domain from the mollusk, H. diversicolor supertexta, was capable of binding to a vertebrate consensus kB motif in EMSAs. Moreover, the genomic sequences recognized by NF-kB proteins, kB motifs, have previously been identified in only one mollusk, C. gigas, where three kB motifs were found upstream of a tissue inhibitor of metalloproteinase, Cg-TIMP (Montagnani et al., 2007). However, RHD recognition of the C. gigas kB motifs has not yet been reported. Here we report the first identification of kB motifs in the gastropod, B. glabrata, upstream of two immune-related genes, IkB and p38 MAPK. Furthermore, functional analyses demonstrated the recognition of these kB motifs by the BgRHD domain. Importantly, the lack of binding between the BgRHD and mutant probes in the EMSAs supports the specificity of these protein-DNA interactions. In addition, this is the first demonstration of the DNA-binding ability of BgRHD, and as a result supports the classification of B. glabrata p65 NF-kB as a functional NF-kB homologue and transcription factor. NF-kB activity is regulated by IkB, which retains the NF-kB dimer in the cytoplasm until dissociation of the complex is initiated by an upstream signaling pathway. An IkB homologue was previously discovered in B. glabrata (GenBank: EF127687.1), and a kB motif was identified upstream of this gene in the current study. This finding is not unexpected though, as in other studies, IkB has demonstrated to be a transcriptional target of NF-kB, as a negative feedback mechanism (Brown et al., 1993; De Martin et al., 1993). It is possible therefore that NF-kB self regulates in B. glabrata by increasing transcription of IkB following the nuclear translocation of NF-kB. A functional kB motif was also identified upstream of p38 MAPK, implicating NF-kB as a transcriptional regulator of p38 MAPK in B. glabrata. In contrast though, similar findings for other species are lacking in the published literature. Interestingly, we surveyed the upstream region of human p38 MAPK (available at http://www. ncbi.nlm.nih.gov) for the presence of kB motifs and indeed, one was predicted (GGAAAGCCTCA) within 1000 bp upstream of the coding region (unpublished). Therefore, it is possible that p38 MAPK expression is under NF-kB regulation in species other than B. glabrata, but documentation of this is lacking as the relevant studies have not been carried out or published. p38 MAPK is known to participate in signaling pathways associated with the immune and inflammatory responses of vertebrates as well as some invertebrates (Ashwell, 2006; Dong et al., 2002). Similarly, previous studies suggest p38 MAPK plays a role in immune responses in B. glabrata. To illustrate, p38 MAPK was demonstrated to play a role in hemocyte in vitro H2O2 production (Goodall et al., 2004; Humphries and Yoshino, 2008). This is of particular significance, as the production of H2O2 is considered an anti-schistosome defense mechanism, employed by some strains of B. glabrata (Hahn et al., 2001). In addition, p38 MAPK was activated in response to S. mansoni excretory-secretory products and laminarin, a b-1,3-glucan polymer commonly used to mimic fungal
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
pathogens (Humphries and Yoshino, 2006). The potential role of p38 MAPK in immune responses of B. glabrata, in conjunction with the identification of a functional kB motif upstream of this kinase, suggests that NF-kB may regulate immune responses in B. glabrata. Moreover, this proposition is further supported by a recent study in which B. glabrata snails were exposed to S. mansoni larvae, and following, transcript levels of p65 NF-kB (RelA) were found to significantly increase (Zhang and Coultas, 2011). Although kB motifs were located upstream of IkB and p38 MAPK in B. glabrata, none were predicted in the upstream region of the SOD b allele. In contrast, Rojo et al. (2004) identified and characterized a kB motif upstream of the human SOD1 gene. It is worth noting though, that the present study focused on a region approximately 1000 bp upstream of the coding region; therefore it is possible that kB motifs are present elsewhere, for example further upstream or within introns (Lenardo et al., 1987). Having demonstrated that the B. glabrata RHD domain could bind native kB motifs, it was of interest to determine whether the BgRHD could recognize and bind a kB motif from a species of a different phylum, belonging to Deuterostomia. A specific proteinDNA interaction was demonstrated between the BgRHD and a vertebrate kB motif in EMSAs. Likewise, a similar phenomenon has been reported for the mollusk, H. diversicolor supertexta as stated previously (Jiang and Wu, 2007). Moreover, an NF-kB from the cnidarian Nematostella bound a kB motif from a human major histocompatibility complex (MHC) gene, showing cross reactivity across a wide range of animal phylogeny (Wolenski et al., 2011). This study along with others, suggest that there is substantial cross reactivity between RHD domains and kB motifs over a wide range of animal phyla. The extent of cross reactivity may be explained by the sequence variations in kB motifs, which are considered more heterogeneous than the RHD domain of NF-kB proteins (Mrinal et al., 2011). In conclusion, the identification of kB motifs upstream of p38 MAPK and IkB implies that the expression of these genes may be regulated, at least in part, by NF-kB in B. glabrata. Furthermore, the findings of this study and others (Humphries and Yoshino, 2006, 2008; Zhang and Coultas, 2011) lead us to hypothesize that NF-kB plays a role in the immune system in B. glabrata, which has been proposed for other molluscs (Jiang and Wu, 2007; Wu et al., 2007). However, the severe lack of functional studies on molluscan NF-kB homologues in general, highlights the essential need for increased research in this area. Such studies would provide a deeper understanding of NF-kBs and their functional roles in mollusks, as well as of the evolution of this important family of transcription factors. Acknowledgments This research was funded by Lawrence University. I would like to thank Laura Deneckere, Luqiong Wang and Andrea Wilkinson for proofreading the manuscript. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2015.08.004. References Adema, C.M., Hanington, P.C., Lun, C.M., Rosenberg, G.H., Aragon, A.D., Stout, B.A., Richard, M.L.L., Gross, P.S., Loker, E.S., 2010. Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes). Mol. Immunol. 47 (4), 849e860. http://dx.doi.org/10.1016/ j.molimm.2009.10.019. Adema, C.M., Luo, M.-Z., Hanelt, B., Hertel, L.A., Marshall, J.J., Zhang, S.-M.,
369
DeJong, R.J., Kim, H.-R., Kudrna, D., Wing, R.W., Soderlund, C., Knight, M., Lewis, F.A., Caldeira, R.L., Jannotti-Passos, L.K., Carvalho, O.S., Loker, E.S., 2006. A bacterial artificial chromosome library for Biomphalaria glabrata, intermediate snail host of Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 101 (Suppl. 1), 167e177. Ashwell, J.D., 2006. The many paths to p38 mitogen-activated protein kinase activation in the immune system. Nat. Rev. Immunol. 6, 532e540. http://dx.doi.org/ 10.1038/nri1865. €l, C., RobinsonBouton, D., Escriva, H., de Mendonça, R.L., Glineur, C., Bertin, B., Noe Rechavi, M., de Groot, A., Cornette, J., Laudet, V., Pierce, R.J., 2005. A conserved retinoid X receptor (RXR) from the mollusk Biomphalaria glabrata transactivates transcription in the presence of retinoids. J. Mol. Endocrinol. 34 (2), 567e582. http://dx.doi.org/10.1677/jme.1.01766. Brown, K., Park, S., Kanno, T., Franzoso, G., Siebenlist, U., 1993. Mutual regulation of the transcriptional activator NF-kB and its inhibitor. IkB-a. Proc. Natl. Acad. Sci. U. S. A. 90, 2532e2536. Colley, D.C., Bustinduy, A.L., Secor, W.E., King, C.H., 2014. Human schistosomiasis. Lancet 383, 2253e2264. http://dx.doi.org/10.1016/S0140-6736(13)61949-2. De Martin, R., Vanhove, B., Cheng, Q., Hofer, E., Csizmadia, V., Winkler, H., Bach, F.H., 1993. Cytokine-inducible expression in endothelial cells of an IkBa-like gene is regulated by NFkB. EMBO J. 12 (7), 2773e2779. Dong, C., Davis, R.J., Flavell, R.A., 2002. MAP kinases in the immune response. Ann. Rev. Immunol. 20, 55e72. http://dx.doi.org/10.1146/ annurev.immunol.20.091301.131133. Gauthier, M., Degnan, B.M., 2008. The transcription factor NF-kappaB in the demosponge Amphimedon queenslandica: insights on the evolutionary origin of the Rel homology domain. Dev. Genes Evol. 218 (1), 23e32. http://dx.doi.org/ 10.1007/s00427-007-0197-5. Gilmore, T.D., 2006. Introduction to NF-kB players: players, pathways, perspectives. Oncogene 25, 6680e6684. Gilmore, T.D., Wolenski, F.S., 2012. NF-kB: where did it come from and why? Immunol. Rev. 246, 14e35. http://dx.doi.org/10.1111/j.1600-065X.2012.01096.x. Goodall, C.P., Bender, R.C., Broderick, E.J., Bayne, C.J., 2004. Constitutive differences in CU/Zn superoxide dismutase mRNA levels and activity in hemocytes of Biomphalaria glabrata (Mollusca) that are either susceptible or resistant to Schistosoma mansoni (Trematoda). Mol. Biochem. Parasitol. 137 (2), 321e328. Goodson, M.S., Kojadinovic, M., Troll, J.V., Scheetz, T.E., Casavant, T.L., Soares, M.B., McFall-Ngai, M.J., 2005. Identifying components of the NF-kB pathway in the beneficial Euprymna scolopes-Vibrio fischeri light organ symbiosis. Appl. Environ. Micro 71 (11), 6934e6946. http://dx.doi.org/10.1128/AEM.71.11.69346946.2005. Hahn, U.K., Bender, R.C., Bayne, C.J., 2001. Killing of Schistosoma mansoni sporocysts by hemocytes from resistant Biomphalaria glabrata: role of reactive oxygen species. J. Parasitol. 87 (2), 292e299 doi: http://dx.doi.org/10.1645/00223395(2001)087[0292:KOSMSB]2.0.CO;2. Hanelt, B., Lun, C.M., Adema, C.M., 2008. Comparative ORESTES-sampling of transcriptomes of immune-challenged Biomphalaria glabrata snails. J. Invertebr. Pathol. 99 (2), 192e203. http://dx.doi.org/10.1016/j.jip.2008.06.002. Hanington, P.C., Lun, C.M., Adema, C.M., Loker, E.S., 2010. Time series analysis of the transcriptional responses of Biomphalaria glabrata throughout the course of intramolluscan development of Schistosoma mansoni and Echinostoma paraensei. Int. J. Parasitol. 40 (7), 819e831. http://dx.doi.org/10.1016/ j.ijpara.2009.12.005. Humphries, J.E., Yoshino, T.P., 2006. Schistosoma mansoni excretory-secretory products stimulate a p38 signalling pathway in Biomphalaria glabrata embryonic cells. Int. J. Parasitol. 36, 37e46. http://dx.doi.org/10.1016/ j.ijpara.2005.08.009. Humphries, J.E., Yoshino, T.P., 2008. Regulation of hydrogen peroxide release in circulating hemocytes of the planorbid snail Biomphalaria glabrata. Dev. Comp. Immunol. 32 (5), 554e562. http://dx.doi.org/10.1016/j.dci.2007.09.001. Ittiprasert, W., Miller, A., Myers, J., Nene, V., El-Sayed, N.M., Knight, M., 2010. Identification of immediate response genes dominantly expressed in juvenile resistant and susceptible Biomphalaria glabrata snails upon exposure to Schistosoma mansoni. Mol. Biochem. Parasitol. 169 (1), 27e39. http://dx.doi.org/ 10.1016/j.molbiopara.2009.09.009. Jiang, Y., Wu, X., 2007. Characterization of a Rel\NF-kB homologue in a gastropod abalone, Haliotis diversicolor supertexta. Dev. Comp. Immunol. 31, 121e131. http://dx.doi.org/10.1016/j.dci.2006.05.014. Kappler, C., Meister, M., Lagueux, M., Gateff, E., Hoffmann, J.A., Reichhart, J.M., 1993. Insect immunity. Two 17 bp repeats nesting a kappa B-related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteriachallenged Drosophila. EMBO J. 12, 1561e1568. Kaur, S., Jobling, S., Jones, C.S., Noble, L.R., Routledge, E.J., Lockyer, A.E., 2015. The nuclear receptors of Biomphalaria glabrata and Lottia gigantea: implications for developing new model organisms. PLoS One 10 (4), e0121259. http://dx.doi.org/ 10.1371/journal.pone.0121259. Lenardo, M., Pierce, J.W., Baltimore, D., 1987. Protein-binding sites in Ig gene enhancers determine transcriptional activity and inducibility. Science 236, 1573e1577. http://dx.doi.org/10.1126/science.3109035. Liang, Y., Zhou, Y., Shen, P., 2004. NF-kB and its regulation on the immune system. Cell Mol. Immunol 1 (5), 343e350. Lockyer, A.E., Emery, A.M., Kane, R.A., Walker, A.J., Mayer, C.D., Mitta, G., Coustau, C., Adema, C.M., Hanelt, B., Rollinson, D., Noble, L.R., Jones, C.S., 2012. Early differential gene expression in haemocytes from resistant and susceptible Biomphalaria glabrata strains in response to Schistosoma mansoni. PLoS One 7 (12),
370
J. Humphries, B. Harter / Developmental and Comparative Immunology 53 (2015) 366e370
e51102. http://dx.doi.org/10.1371/journal.pone.0051102. Mrinal, N., Tomar, A., Nagaraju, J., 2011. Role of sequence encoded kB DNA geometry in gene regulation by Dorsal. Nucl. Acids Res. 39 (22), 1e18. http://dx.doi.org/ 10.1093/nar/gkr672. Mitta, G., Galinier, R., Tisseyre, P., Allienne, J.F., Girerd-Chambaz, Y., Guillou, F., Bouchut, A., Coustau, C., 2005. Gene discovery and expression analysis of immune-relevant genes from Biomphalaria glabrata hemocytes. Dev. Comp. Immunol. 29, 393e407. http://dx.doi.org/10.1016/j.dci.2004.10.002. Montagnani, C.K.C., Reichhart, J.M., Escoubas, J.M., 2004. Cg-Rel, the first Rel/NFkappaB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas. FEBS. Lett. 561 (1e3), 75e82. Montagnani, C., Avarre, J.C., de Lorgeril, J., Quiquand, M., Boulo, V., Escoubas, J.M., 2007. First evidence of the activation of Cg-timp, an immune response component of Pacific oysters, through a damage-associated molecular pattern pathway. Dev. Comp. Immunol. 31 (1), 1e11. http://dx.doi.org/10.1016/ j.dci.2006.04.002. Rojo, A.I., Salinas, M., Martín, D., Perona, R., Cuadrado, A., 2004. Regulation of Cu/Znsuperoxide dismutase expression via the phosphatidylinositol 3 kinase/Akt pathway and nuclear factor-kB. J. Neurosci. 24 (33), 7324e7334. http:// dx.doi.org/10.1523/jneurosci.2111-04.2004. Wang, X.W., Tan, N.S., Ho, B., Ding, J.L., 2006. Evidence for the ancient origin of the NF-kB/IkB cascade: its archaic role in pathogen infection and immunity. Proc. Natl. Acad. Sci. U. S. A. 103 (11), 4204e4209. http://dx.doi.org/10.1073/ pnas.0507044103. Wang, M., Yang, J., Zhou, Z., Qiu, L., Wang, L., Zhang, H., Gao, Y., Wang, X., Zhang, L., Zhao, J., Song, L., 2011. A primitive toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farerri. Dev. Comp. Immunol. 35 (4), 511e520. http://dx.doi.org/10.1016/j.dci.2010.12.005.
Wingender, E., Dietze, P., Karas, H., Knüppel, R., 1996. TRANSFAC: a database on transcription factors and their DNA binding sites. Nucl. Acids Res. 24 (1), 238e241. http://dx.doi.org/10.1093/nar/24.1.238. Wolenski, F.S., Garbati, M.R., Lubinski, T.J., Traylor-Knowles, N., Dresselhaus, E., Stefanik, D.J., Goucher, H., Finnerty, J.R., Gilmore, T.D., 2011. Characterization of the core elements of the NF-kB signaling pathway of the sea anemone Nematostella vectensis. Mol. Cell. Biol. 31 (5), 1076e1087. http://dx.doi.org/10.1128/ MCB.00927-10. Wu, X., Xiong, X., Xie, L., Zhang, R., 2007. Pf-Rel, a rel/nuclear factor-kB homolog identified from the pearl oyster, Pinctada fucata. Acta Biochim. Biophys. Sin. 39 (7), 533e539. http://dx.doi.org/10.1111/j.1745-7270.2007.00306.x. Yoshino, T.P., Coustau, C., 2011. Immunobiology of Biomphalaria glabrata-trematode interactions. In: Toledo, R., Fried, B. (Eds.), Biomphalaria glabrata snails and Larval Trematodes. Springer, New York, pp. 159e189. Yoshino, T.P., Wu, X.J., Liu, H.D., 1998. Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line. Am. J. Trop. Med. Hyg. 59 (3), 414e420. Zahoor, Z., Lockyer, A.E., Davies, A.J., Kirk, R.S., Emery, A.M., Rollinson, D., Jones, C.S., Noble, L.R., Walker, A.J., 2014. Differences in the gene expression profiles of haemocytes from schistosome-susceptible and -resistant Biomphalaria glabrata exposed to Schistosoma mansoni excretory-secretory products. PLoS One 9 (3), e93215. http://dx.doi.org/10.1371/journal. pone.0093215. Zhang, S.M., Coultas, K.A., 2011. Identification and characterization of five transcription factors that are associated with evolutionarily conserved immune signaling pathways in the schistosome-transmitting snail Biomphalaria glabrata. Mol. Immunol. 48 (15e16), 1868e1881. http://dx.doi.org/10.1016/ j.molimm.2011.05.017.